Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 90%

 1012071972 Xt7.1-XZG60887.5 - 116 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                            3     4     4     4     5     6     5     6    10    13    14    15    19    20    29    31    32    35    33    36    34    37    35    38    35    38    35    38    35    39    38    40    39    41    38    41    39    41    40    42    41    43    42    43    42    43    41    43    42    43    42    43    41    42    41    43    42    43    42    43    41    43    42    43    43    45    42    45    43    45    43    45    42    45    42    45    44    46    43    47    47    50    46    49    44    50    45    50    46    50    45    50    46    51    46    51    46    51    45    50    49    51    48    51    49    52    48    53    48    54    47    53    47    53    47    53    47    52    46    51    44    48    42    47    44    48    42    47    42    48    42    48    41    47    39    44    39    45    36    42    33    41    34    41    35    41    33    39    32    39    32    39    31    37    29    35    30    36    30    35    30    34    29    32    27    31    27    29    27    29    27    29    28    30    29    31    31    32    31    32    31    32    31    32    31    32    31    32    30    32    31    34    33    36    35    37    34    37    32    37    33    36    32    38    35    38    37    40    35    40    34    40    37    41    29    32    32    36    32    37    35    40    35    41    36    43    40    47    40    47    40    48    42    48    41    46    41    47    42    47    42    46    44    48    44    48    45    49    44    48    44    48    44    48    44    48    43    48    41    47    43    47    44    47    43    47    40    46    42    45    42    44    42    45    43    45    42    43    41    42    41    42    41    42    41    42    41    42    41    42    40    41    40    40    39    40    38    39    38    39    39    39    38    39    39    39    37    38    37    38    38    38    36    37    36    37    37    37    35    37    36    37    37    37    34    36    35    36    34    35    33    34    33    34    33    34    33    34    30    33    27    30    25    29    25    29    10    13     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------A
                                               BLH ATG     150     428                                                                                                                                                                                                                                                       
                                               BLH MIN     150      56                                                                                                                                                                                                                                                       
                                               BLH OVR     150      58                                                                                                                                                                                                                                                       
                                               CDS MIN     150      33                                                                                                                                                                                                                                                       
                                               EST CLI      70      33                                                                                                                                                                                                                                                       
                                               ORF LNG     150       2                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN -== Dm ==== 1e-020     NP_573104.1 CG9214-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN -== Br ==== 3e-025     AAB53747.1 anti-proliferation factor [Branchiostoma lanceolatum] =====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 5e-028     XP_786322.1 PREDICTED: similar to B-cell translocation gene 1 [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 4e-041     NP_956314.1 B-cell translocation gene 1 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 2e-047     NP_006754.1 BTG family, member 2; B-cell translocation gene 2 (pheochromacytoma cell-3);B-cell translocation gene 2 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 7e-048     NP_031596.1 B-cell translocation gene 2, anti-proliferative [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PREDICTED - Gg ---- 2e-048     XP_418053.2 PREDICTED: similar to BTG2 protein (NGF-inducible anti-proliferative protein PC3) [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 9e-082     BAE44295.1 B-cell translocation protein 2 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 9e-082     NP_001088812.1 B-cell translocation protein 2 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 4e-089     AAH82726.1 Hypothetical LOC496422 [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG60887.5                                                                                                                                                                                                                                                                                           TAA------TGA---------------TAGTAG---------------------------------------TAA---------TAA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TAA------------------------------------------------------------------------------------------------------------------------------TAA---------------------TAA------TAA---------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------TAA---------------------TAG------------------------------------------------------TAA---TAG---TAG---------------------------------------------------------------------------------------------------TAATAA---------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---TGA---------------------------------TAA---------------------------TAA------------------------------------TGA---------------------------------------------TAATAG------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TGA---------------------------------------------ATG------------------------TAA---------------------------------------TGA------------------------------------------------------------------------------ATG---------------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld 1030 5g                         IMAGE:7093120.5p                                                                                                                                                                                                                                                                                                     GAGTTCAGAGGAAAGCTTAGTAGGTGACAGAGCTGGTACCGGCGGTTTCACTGGTGCGACTATAAGTAGCTTATTAACTACCCGTAGCCAAAGAAAACGTTATTATGGCAAATGGATCCGTGCCCGAAAGTCAACAAGACACTTTACCAGAAATAGTTGCCGCAGTCAATTTTCTTTCCAGTCTCTTACAGAGTCGACTCAACGAGCAACAATTGCGGGGCTTCGGGAAAACATTACGGCATACTTTAACCGAACACTACATGCATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCACAAGATG
  5   1   2       bld Egg  5g                        TEgg115f21.p1kSP6                                                                                                                                                                                                                                                                                                                                GCTGGTACCGGCGGTTTCACTGGTGCGACTATAAGTAGCTTATTAACTACCCGTAGCCAAAGAAAACGTTATTATCGGCAAATAGGCATCCGTGCCCGTAAAGTCAACAAGACACTTTACCAGAAATAGTTGCCGCAGTCAATTTTCTTTCCAGTCTCTTACAGAGTCGACTCAACGAGCAACAATTGCGGGGCTTCGGGAAAACATTACGGCATACTTTAACCGAACACTACATGCATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGATAAACCACAAGATGGATCCAGTCATCAG
  5   1   2       bld Neu       in                   TNeu063l15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGCGAAAGTCAACAAGACACTTTACCAGAAATAGTTGCCGCAGTCAATTTTCTTTCCAGTCTCTTACAGAGTCGACTCAACGAGCAACAATTGCGGGGCTTCGGGAAAACATTACGGAATACTTTAACCGAACACTACATGCATCATTGGTTTCCAGACAAGCCAGCAAAAGGCTCTGGGTATCGTTGTATCAGGAGAAACCACAAGATGGATCCAGTCATCAGTAAAGTTGCATGTCGTATTAACATGAGTAACCAGCATCTGCTTAGTTTGTTGCCCAAAGAGCTCACACTTTGGGTGGATCCTTTCGAAGTTTCATACCGAATTGGAGAGGACGGTTCTATTTGCGTCTTGTATGAAGCCTCGGCGCCTTCTGCGAGAGGACATTTAAACTGTAAAAGTGAGCTGCTGGGGAGCTCTGGCACTCCTTCCCACTACCTAATGA
  3   1   2       bld Gas8 5g3  in                          st20c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCATACCGAATTGGAGAGGACGGTTCTATTTGCGTCTTGTATGAAGCCTCGGCGCCTTCTGCGAGAGGACATTTAAACTGTAAAAGTGAGCTGCTGGGGAGCTCTGGCACTCCTTCCCACTACCTAATGACCGTGCACAGCTAACCTGGGAATTTTCACCCTATCTGCTGCTTGAGTACGTGTAAATACCTTGCTCTGGGAGCCAACTTTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAAATTGTTTAATTAGCCATTTTATGTTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACCAGTGCCTGACCGTTTAACACCATCTTTCAGAG
  3   1   2       bld Brn4 5g3  in                        CAAL18232.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGAGAGGACATTTAAACTGTAAAAGTGAGCTGCTGGGGAGCTCTGGCACTCCTTCCCACTACCTAATGACCGTGCACAGCTAACCTGGGAATTTTCACCCTATCTGCTGCTTGAGTACGTGTAAATACCTTGCTCTGGGAGCCAACTTTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTAC
  3   1   2       bld Te1  5g3  in                         CBWN2840.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACTCCTTCCCACTACCTAATGACCGTGCACAGCTAACCTGGGAATTTTCACCCTATCTGCTGCTTGAGTACGTGTAAATACCTTGCTCTGGGAGCCAACTTTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg036n06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATGACGGTGCACAGCTAACCTGGGAATTTTCACCCTATCTGCTGCTTGAGTAGGTGTAAATACCTTGTTCTGGGAGCCACCTTTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATGGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTCGTCTACTTTTGAGGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCACACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTACAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA                            TTpA076h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCTAACCTGGGAATTTTCACCCTATCTGCTGCTTGAGTACGTGTAAATACCTTGCTCTGGGAGCCAANCTTTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTAC
  3   1   2       bld Egg  5g3  in                    TEgg036p07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTAACCTGGGAATTTTCACCCTATCTGCTGCTTGAGTACGTGTAAATACCTTGCTCTGGGAGCCAACTTTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTCGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCCTTGAACAAGTTTGAAGGTAAAGTTACAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Ova1      in                         CABE5876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTCACCCTATCTGCTGCTTGAGTACGTGTAAATACCTTGCTCTGGGAGCCAANCTTTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATG
  5   1   2       bld Gas7      in                         XZG24556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACCCTATTGCTGCTTGAGTACGTGTAAATACCTTGCTCTGGGAGCCAACTATTTCTAACAAAGATCTATTTATATTTTTAAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTG
  5   1   2       bld Gas7      in                         XZG61987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAAAGCGTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAACATCTAGCAAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTG
  5   1   2       bld Tad5      in                          XZT4129.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTTTTTCAGAAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTTCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCA
  5   1   2       bld TpA       in                   TTpA057o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAGTAAAAATTGTTTAATTAGCCATTTTATGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTANATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCGCAAACATATCTT
  5   1   2       bld Tad5      in                         XZT15295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCTTATTGTAAGAACACTAATGCAATAGTACAGACTCGCCAACCCTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTNAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCGCAACAATATCTTTTAGGGGCCAGCATC
  3   1   2       bld Egg       in                    TEgg047d18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCTAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACGTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTAGAGGTGCCTTGAACAATTTGAAGGTAAAGTTACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg047d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAGTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCTAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTAC
  5   1   2       bld Neu       in                   TNeu079e07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGCACATGGAATGCACCTTTTTGGAATTGTAATGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATG
  5   1   2       bld Tad5                                 XZT33859.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCTGTCCGGTACACCAAAGGTACTGTGGAGAACGGTTTCACTTGAACAGTGCTAGTAGTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACC
  5   1   2       bld Neu                            TNeu012m16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTTCTAGCAGCTTGATATTCTAAACTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACC
  5   1   2       bld Gas                            TGas032o16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTATTCTTGTCTACTTTTGATGTTACTTGGACTTTGGACTTTATTTTTTTAATTACTGAGACCTACAGCAAATAATTTAGTTTGTTCATACTTTTATAGAAGGGGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGT
  5   1   2       bld Ovi1      in                        CABI10091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCTAAATCTTGCATAATAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCAAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCANACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGT
  5   1   2       chi Egg       in                  TEgg053m04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGTTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCC
  5   1   2       bld Tad5      in                         XZT41082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAAT
  5   1   2       bld Egg                            TEgg137p12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTACACTAGGAAATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAAT
  5   1   2       bld Gas7      in                         XZG33745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCATCAAACACCAAATTCACAAACATTTTAATTCTAGCTTTAGCCAGCTTGTGCCAATGATTATTTTGAATTTCAGGAAAATACAGTGCCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCTAAATCTTGCAAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTAAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGNTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCCTAAATCTCACAATTGCTGCATGTCCACACTG
  3   1   2       bld Neu0 FL   in                       IMAGE:6991252                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGCCTGACCGTTTAACACATCTTTCAGAGTTCAAATAGTGACAGCAAAATCTTGCTAATACCACCAAAAAAAAACTATTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGGTGTGTGGCTT
  5   1   2       bld Egg                            TEgg080d04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCA
  5   1   2       bld Egg                            TEgg126n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGACCGTTTAAACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAAAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCT
  5   1   2       bld Egg                            TEgg127p23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCGTTTAACACCATCTTTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGC
  5   1   2       bld Gas7                                  XZG7852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCCATCTTTCGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGT
  5  -1   2       bld Ski1      in                         CABJ1603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAGAGTTTCAATAGTGACAGCAAAATCTTGCTAATAACACCAAAAAAAACTTACTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAG
  3   1   2       bld Neu       in                    TNeu079e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAACTACTTTCATCAAATTGTCATACTTTATTCTGTAAGGTNTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1      in                        CABI10091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTACTTTCATCAAATTGTCATACTTTATTCTGTAAGGTTTGAGGTGCCTGACNNAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGG
  5   1   2       bld Ova1      in                         CABE6301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTTATTCTGTAAGGTTTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGNTAATTTGTAATAAAACTCTTGGTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE6301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTATTCTGTAAGGTNTGAGGTGCCTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTT
  3   1   2      seed Gas7 5g3  in                         XZG59721.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5                                 XZT51629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAACAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn4 5g3  in                        CAAL18166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACATTTGAAAGGTAAAGTTTACAAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATAAAACTCTTGGTTTAAACACT
  5   1   2       bld Neu                            TNeu019m19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAATTTGAAGGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTNTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTG
  5   1   2       bld TbA                            TTbA032p08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATCGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTT
  3   1   2       bld Sto1      in                        CABG11569.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAGTTTACAAAAAAANAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTT
  5  -1   2       bld Te1       in                        CBWN15674.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTAAAGTTTACAAAAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTACTCCAGTAATTCTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAAAAAAAAAA
  3   1   2       bld Neu5 5g3  in                          ANHP981.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAAACTAGAGAGAGGCTTGAATATTGTTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTT
  3   1   2       bld Tad5      in                         XZT15295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTT
  3   1   2       bld Gas7      in                         XZG24556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAAAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld HeRe                              EC2CAA3AB01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACTAGAGAGAGGCTTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTGGGCTGGGAGTGAG
  3   1   2       bld TpA       in                    TTpA057o08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGAATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg053m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCCCCCCCACCCCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTTTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCCTGTTAATTTGTAATAAAACTTCTTGGTTTANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT4129.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTTGTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 5g3  in                         XZG27410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTATTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAAC
  3   1   2       bld Gas7      in                         XZG61987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGTACTACAATTTTACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATAACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Tbd1 5g3  in                         CBXT8500.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTCCAGTAATTCTTACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg035e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCAGTATTCTACCCAAAATTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACACNCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT53765.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTT
  3   1   2       bld Lun1      in                         CABD6682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTT
  3   1   2       bld Brn4 5g3  in                        CAAL21324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTT
  5   1   2       bld Tad5      in                         XZT53765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAATTTTACTTCAGCCCACTGTTGTGAATTACCCCCTTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATANAACTCTTGGTTTAA
  3   1   2       bld Liv1 5g3  in                         CAAR8447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCAGCCCACTGTTGTGAATTACCCCCCTGGTGCAGAGCAACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTT
  3   1   2       bld Gas7      in                           XZG643.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCACTGTTGTGAATTCCCCCTTGGTGCAGAGCAACATGGCTTAGAGGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTAAATAAAGAAAAGAAAT
  3   1   2       bld Eye       in                         CCAX6550.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACATGGCTTTAGAGATGAGTTTCTTGTCTCTTAAGTGCTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAACACTA
  5   1   2       bld Neu                            TNeu022n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTTCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTT
  3   1   2       bld Gas7      in                         XZG33745.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCAAAGAGTTAAATAAGAACATTTTTAGATCAAGCATTTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCCCATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCCCCCCCCCCCCCGCAAACAATATTTTTTAGGGGGCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTTTAACCGAATAGGTAAGAGATTTGCTGGGGGGGGGGGGCTTTTTACAGCTATAGAGGGAGCTGACCCTGCAGTTTGGTCCCTTTGTCCCCCAGGCCGCGGGGGGGGCTTCATCTATAGTTACGCCCCTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCGGGAATCCTAAAATTTCCCAATTGCTGCATGTCCCCCCTGCCCCAGGGATGTTTTTAAGGCATCAACTTTGGGGTATGTACAAGCCCCCAACTTGTTTGAGTAGGGGGTTTTTTAGATCCTAAATTGTTGCAATTTGTTTTAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGATTGTTGGGCTGGGAGGGAGACCTGTTAATTTGTAAAAAAACTCTGGGTTT
  3   1   2       bld Tad5      in                         XZT41082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTGTTCAAGCCTTTTAACCCTGGTTTAGTTTTCAGAACTATTTGGCTTTCCCCTGAATTGCCCCCTTGAATTTTCCCCCTCGTAAATTTGACCCCCCCGCGTTTTAGGGCCCGGCCCCCCCCCCCCCCCCAAACAATTTTTTTTTGGGGCCCCGCTTCCCCCCCCCCCCCTGTGTTTCCAGCTGCTTTAACCGAATAGGTAAAAGTTTTTCTGGGGGGGGGGGACTTTTTTCCCCTTTAGGGGGGGGTGCCCCCCCATTTTGGTCCCTTTTTCCCCCAGGCCGCGGGGGGGGTTTCTTTTATAGTTTCCCCCCTGATTCTCCCTTTTGAAACAGATCCCCCTTTTTCTGATGTTTTTTTTCTGCCGCGGGAATCCTAAAATTTCCCAATTGTTGCATGTCCCCCCCCCCCCCGGGATTTTTTTAAGGCCTCCCCTTTGGGGTTTGTCCAACCCCCCCCCTTTTTTGGGTAGGGTGTTTTTTTGTTCCTAAATTGTTCCAATTTTTTTTAAGA
  5  -1   2       bld Ova1      in                         CABE5876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTAACCCTGGTCTAGTTTTCAGAACTATTTGGCTCTGCCTTGAATTGCCACATTGAATTTTCCAACTCGTAAATATGAGCCAGCAGCGTAATAGGGCCAGGCCACCCCCCACCCCGCAAACAATATCTTTTAGGGGCCCAGCATCCACCCACCAGCCTGTGTTCACAGCTGCTCTAACCGAATAGGTAAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGTTGGGCTGGGAGTGAGACCTGTTAATTTGTAATAAAACTCTTGGTTTAAACACT
  5   1   2       bld Gas0                                 dad24a09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCCCCGGGCCAGCCTGTGTGCACAGCTGCTCTAACCGAAAGGCCAGAGATCTGCTGGGGAGGAGGGACTTCTTACAGCTATAGAGGGAGCTGACCCTGCAGTCTGGTCCCTCTGTCCCCCAGGCCGCTGGGTGTGCTTCATCTATAGTTACGCCACTGATACTACCTGTTGAAACAGATCAGCATTGTACTGATGTTGTTATGCTGCAGCTGGAATCCTAAAATCTCACAATTGCTGCATGTCCACACTGCACCAGAGATGTTACTAAGGCATCAACTTTGGAGTATGTACAAGCACACAACTTGTTTGAGTAGTGTGTTTTTTAGATCCTAAATTGTTGCAATTTGTTATAAGACGCATAATAGTAAAGCTAATATATAAACTATTAATGTATGGGATTGGNGGGCTGGGAGNGAGACCTG

In case of problems mail me! (