Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 89%

 1012072043 Xt7.1-TGas107a20.3 - 50 ESTs
                                                                       ..0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas107a20.3   CAAGCCCACGCTGACCCGGAAGTGGCAACTAGTCACGCCGGTTGGAAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGTATGCAGCTTGGTTTTTTGGTAAATATGGCACCTAATTCGGTGTTCATGCAGATATACACAATGTAAGGTTGTAATATCAGTCCAGTGAATTCAAGGGTAAATAGTGCTGAAAGTCCCTTAATAAGGTACCTAAATAAACATTTGCCTAAAA
                                                  Xt7.1-CHK-1008225749         CACGCTGACCCGGAAGTGGCAACTAGTCACGCCGGTTGGAAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGTATGCAGCTTGGTTTTTTGGTAAATATGGCACCTAATTCGGTGTTCATGCAGATATACACAATGTAAGGTTGTAATATCAGTCCAGTGAATTCAAGGGTAAATAGTGCTGAAAGTCCCTTAATAAGGTACCTAAATAAACATTTGCCTAAAAAGACTG
                                                      consensus depths        2     2     3     3     3     4     5     7     7     9    11    14    15    17    22    25    24    28    28    33    34    38    35    39    37    40    38    41    38    41    38    41    39    42    39    42    39    42    39    42    40    43    40    43    41    44    41    44    41    44    41    44    41    44    41    44    41    44    41    45    41    45    40    45    40    45    40    45    40    45    40    45    40    45    44    49    43    49    44    49    44    49    46    48    46    48    47    48    46    47    46    47    46    47    45    47    45    47    44    47    45    47    45    47    44    46    43    45    43    45    43    45    39    42    39    42    39    42    37    41    37    41    36    40    33    38    31    36    28    35    29    34    27    34    26    33    23    27    24    26     6     8     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2
                                                                   VAR                                                                                                                           GGCAGGATTATAACTTCAATCATTTTACTCAATTATTTTCAAAATTTTTATGGTAAGAAATAATGACTTCCTTAGCTGACTGCAGTGACCAGTTCAACCTCTCTGCACACATTAGTAATAGTGAAAAGCCAGAGTTTTATACATGTAACGTGTATGTTATTTTCTTTAAACATTTACCAAAGCATATACACATGTTACATGATTGAGAAGGCTCTGCTGCAGACAGGACTTTCTACGTGTCTGATAAATCACTAAAATCATCATTTAGATTGTACAATTCATATACTAATACAATTGTTGCAACTGCCCATCTGTATCTAGAATATAAGAGATTGATTCATACATTGTCACCTAATCCTTTAAATTAGGGGC
                                                                   SNP                                                                                                                                                                                                                                                   -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                           ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------C--
                                               BLH ATG      83     404   
                                               BLH MIN      83      82   
                                               BLH MPR      80      82   
                                               BLH OVR      83      46   
                                               CDS MIN      83      29   
                                               EST CLI      75      29   
                                               ORF LNG      83       1   
                                                                                                                                                                  PREDICTED = Sc ==== 4e-032     NP_012603.1 Product of gene unknown; Ham1p [Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                  PROTEIN -== Ce ==== 9e-058     NP_498121.1 yeast HydroxylAminoPurine sensitivity related (20.5 kD) (hap-1) [Caenorhabditiselegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PREDICTED = Sp ==== 3e-065     XP_001184472.1 PREDICTED: similar to putative oncogene protein hlc14-06-p, partial [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                     PROTEIN === Dm ==== 2e-069     NP_608890.1 CG8891-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PREDICTED - Dr ==== 7e-085     XP_687166.1 PREDICTED: similar to inosine triphosphatase isoform a [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Hs ==== 4e-086     NP_258412.1 inosine triphosphatase; Inosine triphosphatase-A [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PREDICTED = Gg ==== 6e-087     XP_422234.1 PREDICTED: similar to Inosine triphosphate pyrophosphatase (ITPase) (Inosine triphosphatase) [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN === Mm ==== 2e-087     NP_080198.2 inosine triphosphatase; nucleoside triphosphate pyrophosphatase [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PROTEIN === Xl ==== 8e-107     AAI10772.1 MGC131132 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                         PREDICTED = ?? ==== 8e-107     NP_001089939.1 hypothetical protein LOC735008 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas107a20.3              TGA---------------TAG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGA------------------------------------------TGA---------------------------------------------------------------------------TAA---TAGATG---ATG---------TAG---------------------------TAA---------TAA---------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------ATG------------ATGTAA
                                                                   ORF                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  0   1   1           BrSp FL                   EC2BBA11DA04.FL-Pollet                                    GACGCCGGTTGGAAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAgCCTAATAAATTTtttaaTattTTTacttaacaaaaaaaaaaagaagaaaaaataaaaagaaactatacttaataagagggacaaatgtggagacgtaagttataaaaatacagagaaagcgaggccgcatcatcacataaaaaaaaaaaaaaaaaaaaaaaaaaaaatggacggcaagcgcgagctgaggaaggggacctcacaccacacccctttttttttcacaaaggggagcctactaaaaaagttattttatatgagtgatccgacaacatttatatccttcatgagaaaataatagcctttttatttatattattt
  0   1   1           Egg  CHI                    TEgg045h11.FL-Sanger                                                AAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCCCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGTATGCAGCTTGGTTTTTTGGTAAATATGGCACCTAATTCGGTGTTCATGCAGATATACACAATGTAAGGTTGTAATATCAGTCCAGTGAATTCAAGGGTAAATAGTGCTGAAAGTCCCTTAATAAGGTACCTAAATAAACATTTGCCTAAAAAGACTAAAAAAAAAAAAAAAAAAGCGGCCGCTTTTTTTTTTTTTTTTTTAAATTGTAAAAAGACATGATTTATTTAAGATAAAAGAATTAAAACACAAATAAACTGTACAAGATAAAGATATGTGGCTAAGAGATCTCATCATCTGTTAAAAAAAGGCCTCAATATATTTTAGTGCTATGCACAGGAAGTCCTAGCAGCGACGATTCCATAGAATACTCCACACAGCAGCTTTTAATCCGCTTTGACTGCTTTGGCTGCATTCTCTAATATTTTTCTTCTCCATTCCTCATAATCTATCCCTTTGTTCTCAGTTTCACTGTCTTGCTGTTTGCGTGGTACTTCTTCATTTGTCTCTGAATCTTGTTCTATGTAATCCAACAGGGTTTTCTGCCTTTTTCTTGGCTGTGTGTTTACAACAGAATTTTCTTGGCAGATCTGCAACCCAATCTTTTCTAGCTGGATACACAAGCGGTCAAAAATTCCTTTCTTGACTCCAGATGCAGAAAATAGCTTGTTCTTCTCAGTTTTTAATTTAAGACACCTGCACGCAGAATACAGAGCTGCTGAAATAAACAAAGGCTTGGATAAGTCCAAGTCTTCCTGCTGTGCTTGAGAAAGGCTGGACTCATATCTGTTTAATATTTCAGATGCAGTGTTTACAGCCTCCATGCAACCATGCTGAACTGCAAGGTCCCGAATTCCCATCCTGGAGGTCACCCCAAGCAAGGATTCAAATGAATTCAGGCAGCTCAGGTAGACCTTCTTGTTTAATCCAGACAACCTAACTAGATAATCCTTGTCGATTGGGTGGTTTAATGAAGTTGCTGCCAGCTGGAGACACATGACAGCATTACTGGTTGCTGTGGTTCTACTACAGAGTCCAGCACATTTCAGCTGGGACAAACGCAGCAGTTCCTCTGCTTTCCCTATTATCCGGCTCGATGTGATACCTAGCCCCGGGGTGCTTTTAGCTCAGGTAGCCTCCTCCTGCCATGGATCTATACACTCTGCTCACCAGCGCCCTGTGCACCCTGGCACTGCCAGTACTACTCCTGCTCACAGCTGCCAAGCTATGGGAAGTGTACTGCCTAAGCCGCAAGGATGCCAGCTGCAGAAACCCTTTGCCCCCTGGCACTATGGGGCTGCCCTTCTTTGGAGAGACTCTGCAAATGGTGCTGCAGAGGCGCAAGTTCCTCCAAGTTAAGCGAAGGAAGTACGGTCGCATCTACAAGACGCATCTATTCGGCAGCCCCACGGTGCGCGTTACGGGCGCAGAGAACGTTCGCCAGATCCTACTGGGGGAGCACAAGCTGGTGTCCGTTCACTGGCCGGCATCTGTCCGCACTATCCTGGGGGCCGGCTGTCTGTCCAACCTGCACGACTCCGAGCACAAGTACACCAAGAAGGTGATCATGCAAGCCTTCTCCCGGGAAGCCCTCGCCAATTACGTCCCGCTGATGGAAGAAGAACTCAGACGCTCCGTCAACCTGTGGCTGCAAAGCGACTCCTGTGTATTGGTGTATCCCGCCATCAAGCGACTGATGTTCCGCATCGCAATGAGGCTGCTGCTCGGCTGCGATCCCCAGCGCTTGGGCCGCGAACAGGAGGAGACGCTGCTAGAAGCCTTCGAGGAAATGACCCGAAATCTCTTCTCTTTGCCTATTGATGTGCCATTTAGCGGCCTCTACCGGGGTCTGCGGGCCAGAAACATAATTCATGCCCAAATTGAAGAAAATATCAAGGAAAAGCTGCAAAGGGAACCAGACGGACAGTGCAGGGATGCCCTGCAGCTGCTGATTGACCACAGCCGCCGGACTGGTGAACCTGTCAACCTGCAGGCTCTGAAAGAATCGGCAACGGAACTCTTGTTTGGAGGCCACGGAACCACAGCCAGTGCTGCCACGTCCCTCACCACCTTTCTTGCACTTCACAAAGACGTTCTGGAAAAGGTCCGCAAGGAGCTTGAATCACAGGGTCTCTTGTCTAATAAACCCGAGGAGAAGAAGGAGCTGAGCATTGAAGTACTCCAACAGTTAAAGTACACTAGCTGCGTCATTAAGGAGACCCTGCGGCTCAGCCCACCAGTGGCGGGTGGATTTCGTGTGGCCCTCAAGACCTTTGTATTAAATGGCTATCAGATTCCCAAGGGTTGGAATGTTATATACAGCATTGCTGACACTCACGGCGAGGCGGAGCTGTTTCCCGACAAGGACGAATTTAACCCGGACCGATTTCTCACACCGCTTCCCGGAGACTCCTCGAGGTTCGGTTTCATCCCGTTCGGAGGTGGCGTGAGGTGCTGTGTCGGCAAAGAGTTTGCTAAAATCCTCCTCAAGGTCTTCATTGTGGAATTGTGCCGGAATTGTGACTGGGAGCTCCTGAATGGATCCCCAGCCATGAAAACCTCCCCAATTATCTGTCCCGTGGACAACCTACCCGCTAAATTCAAGCCCTTTGCCAGCTCTATTTAAGCAATTAATATTCTGTATGTAAACCTACTCTATAGCATCTTAAAGTTGTACATAGTGGCTTTTGTAACTGGTTTTATATTTAATTTGTACAGTGTTGCAGTTATTTATACTTTTAATTTTTGTTTTCGTCACTGAATTGAAGCACTATATGCGGGTCTTGGCCGTGGTGTCTGGGATTTGCATCACTGGACATGTATTAACGCATCTCTGTAAATGTTTCTGTAAATATGAATTTCGTGTTTGCTGTAATAAAGCATTAACATAAAGAAAAAAAAAAAAAAAAAA
  5   1   1           TpA  FL                     TTpA045l15.FL-Sanger                                                                                  GACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1   12    - Gas7 5g3  in                         XZG45740.5p ACCAAGCCCACGCTGACCCGGAAGTGGCAACTAGTCACGCCGGTTGGAAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACANAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGC
  5   1   1   30    - Tbd1 5x3                            CBXT10404.b1 ..CAAGCCCACGCTGACCCGGAAGTGGCAACTAGTCACGCCGGTTGGAAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGCAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGCGTATCATTGCTAA
  5   1   1   22    - Gas7 5g                              XZG17277.5p ........CACGCTGACCCGGAAGTGGCAACTAGTCACGCCGGTTGGAAGCTTTGCGGTACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATTCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTTAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCT
  5   1   1   12    - Tad5 5g3  in                         XZT20879.5p ..........................CCCACGCGTCCGCCCACGCGTCCGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAA
  3   1   1         - BrSp FL   in                     EC2BBA11DA04.b1                                 GGGGACGCCGGTTGGAAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTAAGCCTAATAAAT
  5   1   1         - BrSp FL   in                     EC2BBA11DA04.g1                                  GGGACGCCGGTTGGAAGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTTACTTTAAATGGTGATGC
  5  -1   1         - TbA                            TTbA027p13.p1kSP6                                    AGACCTGGTAGTACAGCTGTCTTTTATTCATTCTCCTGACATCGTCTAAAAAATCCATAGATAACATGTTCGCCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTACATTAGCAAGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   1         - Egg  CHI  out                  TEgg045h11.p1kSP6                                                 AGCTTTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCCCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCT
  3   1   1         - Brn3 5x3  in                        CAAK10719.3p                                                  AATGGGAATCTGTTTTACTAGATGGTTAATTATNTGACATAATTAAGTGGGAAGTAGTCTCCAGCTNTGATGTGGCAGGATTATAACTTCAATCATTTTACTCAATTATTTTCAAAATTTTTATGGTAAGAAATAATGACTTCCTTAGCTGACTGCAGTGACCAGTTCAACCTCTCTGCACACATTAGTAATAGTGAAAAGCCAGAGTTTTATACATGTAACGTGTATGTTATTTTCTTTAAACATTTACCAAAGCATATACACATGTTACATGATTGAGAAGGCTCTGCTGCAGACAGGACTTTCTACGTGTCTGATAAATCACTAAAATCATCATTTAGATTGTACAATTCATATACTAATACAATTGTTGCAACTGCCCATCTGTATCTAGAATATAAGAGATTGATTCATACATTGTCACCTAATCCTTTAAATTAGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACAT
  3   1   1         - Tad5 5g3  in                         XZT20879.3p                                                     TTGCTATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTT
  5   1   1         - HeRe 5g3  in                     EC2CAA18BA08.g1                                                         GATACTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGCAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGA
  5   1   1   10    - Tbd1 5g3  in                         CBXT8176.b1 ............................................................CTTAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGCAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCCCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGA
  5   1   1       chi 1030 5x                         IMAGE:7093761.5p                                                               TGGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAAACAATCTCTCATCGGTATCGTGCTTTAAAGAATGTCTGAGTTTTCTCCAAATGGCCAGATGTTGAGCTAGGTTTCATAAACTCCTAATGTAAATGGACCAAACTGGACTTGTGCACCACTCTAGAGACACTGATATGGAAGACATGCACTAATGGAGAGGTAACATATTTAATTATAAAAAAAGCTATTACGCCCCGGATGCGCATTTGTAGTAAACCATCACTCGTTGTCCAT
  5   1   1         - 1030 5g                         IMAGE:7028215.5p                                                               GAGAGCTATACATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATG
  3   1   1         - Tad5 5g3  in                         XZT46649.3p                                                                   CCACGCGTCCGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTT
  5   1   1   32    - Gas7 5g                              XZG48219.5p ........................................................................CATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGAATCATTGCTAACCTTTAGATGGTGATGGAAGTGGTATAGCCTAATAAATTTTTTATATTTTTACCTAAACTT
  3   1   1         - Limb                                CBSU1389.rev                                                                          ATAGAGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACAT
  5   1   1         - Gas  5g3  in                   TGas107a20.p1kSP6                                                                              AGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCT
  3   1   1         - Gas  5g3  in                    TGas107a20.q1kT7                                                                              AGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1   12    - Tad5 5g3  in                         XZT46649.5p .............................................................................AGCTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAAAAAAAAAAAAAAGG
  5   1   1         - Gas       in                   TGas051m09.p1cSP6                                                                               ACCAAGCCCACGCTGACCCGGAAGTGGCAACTAGTCACGCCGGTTGGAAGCTTTGCTATACTTAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCT
  5   1   1         - Gas  5g                        TGas107g04.p1kSP6                                                                                CTGACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTAT
  5   1   1         - Gas  5x3                       TGas030c01.p1kSP6                                                                                 CTGACCTGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCC
  5   1   1         - TpA  FL   in                  TTpA045l15.p1kaSP6                                                                                   ACCATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTA
  5   1   1       chi Brn3 5x3  in                        CAAK10719.5p                                                                                      ATGGCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGTATGAATTTATAATTCAATGTATAATAAACCATTGGGGCAACTGTACTAAAGTTTATATGTATCTAGGCAGAGGTCTTTAAATGTTTTGGAGTTAGTTTGTAGGCCTTTTGTCATGACAAGTTTACAGATGTATGAAACCATGGTTCCATAGTCGCAGGGATATCTTACATCTTTTTCCCTATTTGGCTGGGCCTCTCTTCCACTGCTTTGGGGCCTGCCCCACAGTTTAGAAACCATTCATTTAAGGGTGAGGGAACAAATATCCTTAAGAGTTTCCAGGATAAATACATGTTAATAATAATAATGATATTAATAATGTACAATCCTATACAATTAAATAAAATCATGGGGCACATTTTGTGGTGCTTTTGCTCTTCACTCGTATTTCACTACTATATTCCATAATATTTTATTTCTTTTTGTAGCCATGTACTTTTTACAAAAATGTTTGACTTTTAAAGAAAACAGCTGGCAACAATACTGCATCTCTCTAGGGATAGTCAGGTTCCATAATGAAATCGCTTTACATTCATGACAGGGTTTACAGAACAGTATCTCATGACTATCA
  5   1   1         - HdA                            THdA014d07.p1kSP6                                                                                        GCTGCTGCCGGCAGAAGTATCGTATTCGTAACAGAGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAAGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCCCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTT
  5   1   1         - Tbd1      in                         CBXT9175.b1                                                                                               GCCGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGCAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGCGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAA
  5   1   1         - Egg                            TEgg122d23.p1kSP6                                                                                                 CGGCAGAAGTATCGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAG
  5   1   1         - Tad5                                 XZT57413.5p                                                                                                     CGGACGCGTGGGTTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACANTAA
  3   1   1         - Tad5      in                         XZT51269.3p                                                                                                       GTAGTCTCCAGCTTTGATGTGGCAGGATTATAACTTCAATCATTTTACTCAATTATTTTCAAAATTTTTATGGTAAGAAATAATGACTTCCTTAGCTGACTGCAGTGACCAGTTCAACCTCTCTGCACACATTAGTAATAGTGAAAAGCCAGAGTTTTATACATGTAACGTGTATGTTATTTTCTTTAAACATTTACCAAAGCATATACACATGTTACATGATTGAGAAGGCTCTGCTGCAGACAGGACTTTCTACGTGTCTGATAAATCACTAAAATCATCATTTAGATTGTACAATTCATATACTAATACAATTGTTGCAACTGCCCATCTGTATCTAGAATATAAGAGATTGATTCATACATTGTCACCTAATCCTTTAAATTAGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTCCAT
  5   1   1         - Tad5      in                         XZT51269.5p                                                                                                       GTAGTCTCCAGCTTTGATGTGGCAGGATTATAACTTCAATCATTTTACTCAATTATTTTCAAAATTTTTATGGTAAGAAATAATGACTTCCTTAGCTGACTGCAGTGACCAGTTCAACCTCTCTGCACACATTAGTAATAGTGAAAAGCCAGAGTTTTATACATGTAACGTGTATGTTATTTTCTTTAAACATTTACCAAAGCATATACACATGTTACATGATTGAGAAGGCTCTGCTGCAGACAGGACTTTCTACGTGTCTGATAAATCACTAAAATCATCATTTAGATTGTACAATTCATATACTAATACAATTGTTGCAACTGCCCATCTGTATCTAGAATATAAGAGATTGATTCATACATTGTCACCTAATCCTTTAAATTAGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAA
  3   1   1         - Te5       in                         CAAO7110.3p                                                                                                             CGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACAT
  5   1   1         - Te5       in                         CAAO7110.5p                                                                                                             CGTATTCGTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACAT
  3   1   1         - Gas7 5g3  in                         XZG45740.3p                                                                                                                    GTAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACAT
  3   1   1         - HeRe 5g3  in                     EC2CAA18BA08.b1                                                                                                                     TAACAGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGCAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGCGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTAT
  5   1   1         - Egg                            TEgg093j09.p1kSP6                                                                                                                      CCGGGGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTA
  5   1   1         - Gas0      in                         dad27a07.y1                                                                                                                        CAGGGAACGCTAAAAAGCTGGACCAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCAT
  5   1   1         - Gas                            TGas110c15.p1kSP6                                                                                                                          GGGAACGCTAAAAAGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTA
  3   1   1         - Tbd1      in                         CBXT9175.g1                                                                                                                                       AGCTGGAAGAGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGCAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGCGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAAAAAAAAAAAAAA
  5   1   1         - Egg       in                   TEgg008l18.p1kSP6                                                                                                                                                TGGTAATTCAGATTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCT
  3   1   1         - Tbd1 5g3  in                         CBXT8176.g3                                                                                                                                                            TTCTTGGAGACAAATTTCCATGCAAATTGGTGGCTAAGAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGCAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCCCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGCGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGCGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAAAAAAAAAAAAAA
  3   1   1         - Egg       in                    TEgg008l18.q1kT7                                                                                                                                                                                                 GAAAATTGACTTGCCAGAGTATCAGGGAGAACCAGATGACATTTCAATTCAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas0      in                         dad27a07.x1                                                                                                                                                                                                                                                  CAGAAATGTAAGGAGGCTGCAAAACAGATTCAAGGCCCAGTTATCGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTAT
  3   1   1         - TpA  FL   in                    TTpA045l15.q1kT7                                                                                                                                                                                                                                                                     CAAAACAGATTCAAGGCCCAGTTATTGTAGAGGATACTTGCTTGTGTTTTAATGCTTTGGGAGGTCTTCCTGGACCTTATATAAAATGGTTTCTTGACAAGATAAAACCCGAAGGGCTGCCCCGAATGTTAGAAGGATTTGAGGACAAGTCGGCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTTTTTTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCACCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTTTCATCGGTATCGTGCTTTAAAAGAAATGTTTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTTTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCCCCCCAGCTTTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTCCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas       in                    TGas051m09.q1kT7                                                                                                                                                                                                                                                                                                                                                            GTTTCTTGACAAGATAAAACCCGAAGGGCTGCACCGAATGTTAGAAGGATTTGAGGACAAGTCGCCCTTTGCTCTGTGCACATTTGCTTATTTCAATGGAAATCCAGATGATAGTGTTTTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCCTCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACGTCCCTATATTGTAAAACTGTGACACGAAAAACTTGGACTTTTGTTGCTCCCCCAGCTCTGAAGAAAAGACTACCTATTGAGTGATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATA
  3   1   1         - Gas       in                    TGas107p06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGTATGCAGCTTGGTTTTTTGGTAAATATGGCACCTAATTCGGTGTTCATGCAGATATACACAATGTAAGGTTGTAATATCAGTCCAGTGAATTCAAGGGTAAATAGTGCTGAAAGTCCCTTAATAAGGTACCTAAATAAACATTTGCCTAAAAAGACTGTTAAAAAAAAAAAAAAAAA
  3   1   1         - Gas       in                    TGas107p08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGTATGCAGCTTGGTTTTTTGGTAAATATGGCACCTAATTCGGTGTTCATGCAGATATACACAATGTAAGGTTGTAATATCAGTCCAGTGAATTCAAGGGTAAATAGTGCTGAAAGTCCCTTAATAAGGTACCTAAATAAACATTTGCCTAAAAAGACTGTAAAAAAAAAAAAAAAAAA
  5   1   1         - Gas       in                   TGas107p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGTATGCAGCTTGGTTTTTTGGTAAATATGGC
  5   1   1         - Gas       in                   TGas107p08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAATCCAGATGATAGTGTTCTTCTTTTTAGAGGCAAAACTATGGGGCAGATTGTGTATCCAAGAGGCCCAAGGGACTTTGGATGGGATCCTTGTTTCCAGCCTGATGGGTTTGAACAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGAATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGCATCATTGCTAACTTTAGATGGCGATGCTAGTGGCATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGGATGCAGCTTGGTTTTTTGGTAAATATGGCACCTAAT
  5   1   1         - Neu                            TNeu002d14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAACTTATGCTGAGCTCCCTAAGGAAGTAAAGATACAATCTCTCATCGGTATCGTGCTTTAAAAGAAATGTCTGAGTATTTCATCCAAAATGGCACAGATGTTTGATGCCTAAGGTTTTCTATAAAACATCCCTATATTGTAAAACTGTGACACAAAAACTTGGACATTTGTTGCACCCCAGCTCTGAAGAAAGACTACATTGAGTATTGTGGAGAGTATCATTGCTAACTTTAGATGGTGATGCTAGTGGTATAGCCTAATAAATTTTTTAATATTTTTACATAAACTTTTCACTAAAGTTTTCATTTTATTTTTCGGCATGGGGTCAGAACAAAGGCTTGTATAGGGATCTTCAACAGTTTTGAAGAACAAGAAACACTACTTTTTATTTTGTTATATGGTATGCAGCTTGGTTTTTTGGTAAATATGGCACCTAATTCGGTGTTCATGCAGATATACACAATGTAAGGTTGTAATATCAGTCCAGTGAATTCAAGGGTAAATAGTGCTGAAAGTCCCTTAATAAGGTACCTAAATAAACATTTGCCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)