Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012072174 Xt7.1-CABE10252.3 - 113 ESTs
                                                                       .-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABE10252.3                                                                                                                                                                            GAGGGGGCAGAAGCAGCAGCTATAAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTGTAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222903                                                                                                                                                                                  GCAGAAGCAGCAGCTATAAxGxxxxxxxxGGGxxxAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATxTxTGTAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                 3     5     4     8     5    10     6    12     7    14     8    15    10    19    10    21    22    23    26    28    34    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    35    36    37    37    37    37    37    37    38    38    38    38    39    39    39    39    39    39    39    39    39    39    39    39    39    39    39    39    40    40    41    41    41    42    41    42    41    42    41    42    41    42    41    43    41    43    41    43    43    44    43    44    42    43    42    43    42    43    41    42    41    43    41    43    41    42    42    44    43    44    43    45    43    45    43    46    42    45    42    45    40    44    41    44    40    44    40    44    40    44    40    44    39    43    37    42    37    42    36    41    36    41    36    41    34    39    34    38    34    38    33    37    32    36    22    35    20    30    19    29    18    26    14    20    13    18    13    17    12    16    11    16    11    16    11    16    11    16    12    17    12    17    11    16    11    16    11    16    11    16    12    17    12    16    12    15    12    15    13    16    13    17    14    18    14    18    13    17    14    18    14    18    14    18    19    23    24    27    24    27    27    30    31    35    30    35    31    36    33    38    31    38    34    40    37    43    38    45    41    48    43    50    43    50    44    53    47    56    46    56    46    55    48    57    53    57    54    58    54    58    54    58    55    59    58    60    58    59    58    59    58    59    51    59    55    58    55    58    55    59    54    59    56    59    55    59    56    59    56    59    55    59    56    60    56    60    55    59    55    59    55    59    54    59    54    60    46    59    17    57    17    57    17    57    19    58    18    57    17    57    17    57    18    56    17    56    18    55    18    55    18    54    18    54    18    54    18    54    18    51    17    50    17    50    17    50    17    50    17    48    17    47    17    46    16    43     5    15     5     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAAGCATTTTCTATGAATAGTTTGGATCGGGTTTCTGTCAGGGAAAATGTTACTTTTATCTTCAGGCTCCTAAACTAAGATCTTGCTGACATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTACTTTAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------GC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -C----------
                                               BLH ATG      95    1094                                                                                                                                                                            
                                               BLH MIN      95     325                                                                                                                                                                            
                                               BLH OVR      95      19                                                                                                                                                                            
                                               CDS MIN      95      11                                                                                                                                                                            
                                               EST CLI      95      11                                                                                                                                                                            
                                               ORF LNG      95       2                                                                                                                                                                            
                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Sc ==== 3e-142     NP_015019.1 Glucose repressed. Utilizes NADP+ or NAD+ as a coenzyme equally well. (sold bySIGMA under the catalogue number A5550, according to A. Blomberg).; Ald4p[Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 0          NP_498081.2 ALDH1J1, ALdehyde deHydrogenase (55.1 kD) (alh-1) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 0          NP_609285.1 CG3752-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 0          XP_786787.2 PREDICTED: similar to aldehyde dehydrogenase 1A2 isoform 2 [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 0          NP_998466.2 aldehyde dehydrogenase 2 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 0          NP_033786.1 aldehyde dehydrogenase 2, mitochondrial [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 0          NP_000681.2 mitochondrial aldehyde dehydrogenase 2 precursor; acetaldehyde dehydrogenase 2;nucleus-encoded mitochondrial aldehyde dehydrogenase 2; liver mitochondrialALDH; ALDH class 2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PREDICTED - Gg ---- 0          XP_415171.2 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH77908.1 MGC80785 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001087022.1 MGC80785 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          NP_001004907.1 MGC89020 protein [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE10252.3                                                                                                                                                                                                   TAA---TGA---------------------TGA------------------------------TGA------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATG------------------------------TAG---------------------------------------------TAG---------------------------------------------------------TAA---------------------------------------------------------------ATG------------TAA------------------------------------------------------------------------ATGTGA------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   1           AbdN FL                     IMAGE:7004710.FL-MGC                                                                                                                                                                                  GGCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas130e07.FL-Sanger                                                                                                                                                                                                                                              CCCGGGGGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAAAA
  5   1   1   11    - Spl2 5g3  in                        CBSS1288.fwd AGAGGAGAAGCAGCAGGAAGAGCTGTAACAATTAAACATTACCTTGTCATGGGCCTTCCCCTTGAACTTCAGCTGCACCCCCCCCCTCTCCGCTGTTAGTGCCCGCCCATCGGTTTGGGAAACACTGCTGTAATATGATTAGACTCGGGCCATTCCACTCCCTCTTTTAGGGAGGGGGCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTA
  5   1   1   11    - Bone 5g3  in                       CBTC10681.fwd ...AGAAGCAGCAGGAAGAGCTGTAACAATTAAACATTACCTTGTCATGGGCCTTCCCCTTGAACTTCAGCTGCACCCCCCCCCCCTCCCCGCTGTTAGTGCCCGCCCATCGGTTTGGGAAACACTGCTGTAATATGATTAGACTCGGGCCATTCCACTCCCTCTTTTAGGGAGGGGGCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCC
  5   1   1   12    - Gas7 5g3  in                         XZG20022.5p ......................................................................................................CCCGCCCATCGGTTTGGGAAACACTGCTGTAATATGATTAGACTCGGGCCATTCCACTTCCTCTTTTAGGGAGGGGGCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGT
  5   1   1   12    - Gas7 5g3  in                         XZG26550.5p ......................................................................................................CCCGCCCATCGGTTTGGGAAACACTGCTGTAATATGATTAGACTCGGGCCATTCCACTTCCTCTTTTAGGGAGGGGGCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTANAGTGCCTAAGATATTATGCAGGCTGGGCTGANCAATGTCA
  3  -1   1         - Fat1      in                         CABC1643.3p                                                                                                                                                                     TTTTAGGGAGGGGGCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGGCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACT
  5   1   1         - AbdN FL                            IMAGE:7004710                                                                                                                                                                                  GGCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAAGTGGCTGAGCAGAACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTTGTGAAAGAAGCTTGGATTCCCACCCGGGTGTTTGTGGAATATCATTTCCTGGAAATGGGGTCCCCACAGCTTGGGGGCCAGCTTAT
  5   1   1         - Te5       in                         CAAO5477.5p                                                                                                                                                                                   GCAGAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGNGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGA
  5   1   1   10    - Tail 5g3  in                         CBSW1987.b1 ....................................................................................................................................................................................GAAGCAGCAGCTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACTTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTG
  5   1   1         - In54 5g                         IMAGE:8841217.5p                                                                                                                                                                                           AACAACGTATCATCCCCCGAAAATTCAAGAATTCGAATTCGTCCCTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAATGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGCTGGATTCCCACCCGGTGTTGTGATATCATTACTGGATGGGTCCCACAGCTGGTGCAGCTTATCCTCCTCCTCACATGACGTGGATAAGTAGCATTGACTGGCTCTTAACGGAGTTGGTTCGTTTATCCACAGCCAGCTGGGTAGAGCCATTGAAAAACTGACGCTTGGAACCTTGGCTGGATGAGAGTTCA
  5   1   1         - Te5       in                         CAAO8287.5p                                                                                                                                                                                                CTATAAGGCTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGGATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTC
  5   1   1   10    - Bone 5g3  in                        CBTC7616.fwd ......................................................................................................................................................................................................CTGATCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCC
  5   1   1   14    - Te5  5g3  in                         CAAO5820.5p ...........................................................................................................................................................................................................TCTGGGGCTAAGTTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGGATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAA
  5   1   1         - In62 5g                         IMAGE:8956742.5p                                                                                                                                                                                                                 GTTTTAGTTAGAGTTAGAGCTTTGCAGCTTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACTCCTCTCACTGCTCTGCATGTGCCAGCCTTGTGAAAGAGCTGGATTCCCACCGGGTGTGTGAATATCATACTGGAATGGGTCCACAGCTGTGCAGCTATCTCCTCTCCACATGGACTGGATAAGTAGCAATACTGCTCTACGAAGGTGGTCGTATCCACCAGCCAGCTGGGAAGAACATTGG
  5   1   1         - Te5       in                        CAAO12577.5p                                                                                                                                                                                                                        TTGTTGTGTTGAGCTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGT
  5   1   1         - Lun1      in                        CABD13545.5p                                                                                                                                                                                                                                    CTTTGCAGCTGAAGTTCGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCAACAAGCAGCTGG
  5   1   1         - AbdN 5g                            IMAGE:7007226                                                                                                                                                                                                                                            GCTGAAGTTCGGGCTCTCGATCTGATTAACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCCGGTTGGAGTTTGCGGACAGATCATTCCGGGGGAATTTCCCGCTACTGATGCTGGGGGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGGTGTTGGCATGAAAGGGGGTGAACAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTTGGGAAAGAAGGCTGGATTCCCACCGGGGGGGTGGGGAATATCCTTACTGGGAATGGGGGTCCCCCGCCTGGGGGCAACTTATCTCCTCTCCCATGGGACGGTGGATTAAAGTAGCCTTTTTCCGGGGCTTCTACAAAAAGGTTGGGGCCTTTTTAATCCCAAACAGG
  5   1   1   10    - Spl2 5g3  in                        CBSS1359.fwd ...........................................................................................................................................................................................................................................CTGAAGTTCGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCT
  5   1   1   10    - Ski1 5g3  in                          CABJ787.5p .............................................................................................................................................................................................................................................CTGAAGTTCGGGCTCTCGATCTGATTACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCTTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGNGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTA
  5   1   1         - Gas  FL   in                   TGas130e07.p1kSP6                                                                                                                                                                                                                                               CCGGGGGGGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGG
  5   1   1         - TpA  5x3  out                  TTpA050j16.p1kSP6                                                                                                                                                                                                                                                     GGCTCTCGATCTGATTTCACCATGGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAGCAGCTGG
  5   1   1   20    - Te1  5g   out                        CBWN4606.b1 .....................................................................................................................................................................................................................................................GGCTCTCGATCTGATTTCACCATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCC
  3  -1   1         - Lun1      in                        CABD13267.3p                                                                                                                                                                                                                                                                     TAAGGGCGAGAGGGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAA
  5   1   1   20    - Ski1 5g   ?                          CABJ2205.5p ..........................................................................................................................................................................................................................................................................ATGCTCCGGACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGA
  5   1   1         - Ovi1                                CABI14206.5p                                                                                                                                                                                                                                                                                   CATCGATTCGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGNGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGGCGAAGAGCCCAAATATTATCTTTTCTG
  5   1   1         - Mus1      in                         CABH7996.5p                                                                                                                                                                                                                                                                                    CAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGNCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCC
  5   1   1         - Ski1      in                         CABJ9008.5p                                                                                                                                                                                                                                                                                    ACAGCCTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTT
  5   1   1         - Liv1      in                         CAAR7312.5p                                                                                                                                                                                                                                                                                        CCTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAA
  5   1   1         - Spl1      in                         CABK4649.5p                                                                                                                                                                                                                                                                                        CCGAGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGA
  5   1   1         - Int1      in                        CAAP12314.5p                                                                                                                                                                                                                                                                                         CTTGGGGAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGA
  5   1   1         - Lun1                                 CABD5824.5p                                                                                                                                                                                                                                                                                         CTTGGGGAGCCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTT
  5   1   1         - Lun1      in                          CABD821.5p                                                                                                                                                                                                                                                                                             GGGGAGCTCTGCGGTAGGGTGGTTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGNGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCACAAGCAGCTGGGAAGAGCAATTTGAAAAAGTGACGCTGGGAC
  5   1   1         - Int1      in                        CAAP10077.5p                                                                                                                                                                                                                                                                                               GAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCG
  5   1   1         - Int1      in                         CAAP6459.5p                                                                                                                                                                                                                                                                                               GAGCCTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGNGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTG
  3  -1   1         - Int1      in                         CAAP5962.3p                                                                                                                                                                                                                                                                                                   CTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCACAAGCAGCT
  5   1   1         - Liv1      ?                          CAAR3714.5p                                                                                                                                                                                                                                                                                                   CTCTGCGGTAGGGTGGCTCGTATGCCACTGGGGGTACAGCTCTGCAGGTATTCCGTTGCAATCCCAACTCCAAACCCCAAGCCAGATGTGCACTTCAACCAGCTCTTTATAAACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAAACAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGC
  5   1   1         - In66                            IMAGE:8966129.5p                                                                                                                                                                                                                                                                                                                                                                                                      TCTTTATCCCTTTCAATCGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCTACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAGCAGCTGGGAAGAGCAATTTGAAAAAGTGACGCTGGAACTTGGCCGAAAGAGCCCAAATATATCTTTCTGATGCTGATTTGATTGGCCTGTGAGCAGCCACTTTGCCTCTGTTCTTACCAGGGCCATGCTGCTTGCTGCTCTCCGACCTATGTTCAGAAGTATTCTACATGAAGTGTGAAGAGCTACCAAGAGCCAAGAATAGATTGTGGGTAACCCTTGGACTTTTACCGCAG
  5   1   1         - Bone      in                        CBTC8042.fwd                                                                                                                                                                                                                                                                                                                                                                                                                  AACAACGAGTGGCATGATGCTGCCAGCAAGAAGACCTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGNGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAANCAGCAGCTGGGAAGAGCAATTTG
  5   1   1         - Ova1      in                         CABE3169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCCCCACCATCAACCCATCCACAGGAGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGACGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGCAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGNGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGACTCTCGCACCTATGTTCA
  5   1   1         - In54                            IMAGE:8946142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAGTGATATGCCATGTTGCAGAGGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGTGAGGCATTCAGATTGGGATCACCATGGAGAAGAATGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGCTGTGGAGCAGCCCACTTTGCTCTGTTCTTTACCAGGCCAGTGCTGCTGTGCTGGCTCCTCGCACCTATGTTCAGAGAATATTCTACATGAGTTTGTTGAGAGGGAGCCATACAAGAAGCCAAGAAAATA
  3  -1   1         - Int1      in                        CAAP11256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGATGCATCTCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAA
  5   1   1         - AbdN                               IMAGE:7007222                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAAAGAGGTGTTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGATAGAGCCCAAATATTATCTTTTCTGATGCTGATATTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCACGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCACGAAGATATCTACNATGACTTTGTTGACAGGAGCATACAAAGAGCAAAGAATACGATTGTGGGGGACCCCCTTTGACTTTTAAACAGAACAAGGACCCTCACGTGGGATGAGGAGCAATTTAATAAAGTTCTGGGGGTATTATAAAATCTGGAAAAAAGGAACGTGGCAAAACTCCCTCTATGGGGGGCTAACCCTGCC
  5   1   1         - Te5       in                         CAAO6458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTGCTAAACCGCCTGGCAGATCTTATTGAGAGAGACAGAGCTATATTAGCAACTTTGGAGACCTTAGACAATGGAAAACCATATGCAATTTCTTATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCT
  5   1   1         - In66                            IMAGE:8965190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCCCTTGAACACCCAGGAACCCAAAGAATTCAAATTCGTCCCCTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCTACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAGGAAGGTGCAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTATCCAGCCCACCGTTTTGGGGATGTGACTGACAAATGACAATGCTAGAGAAAGGATTTGGACCTGGTGATGCAATTTCTAAGTTAATCCATTGAAAAAG
  3   1   1         - Te5       in                         CAAO5477.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATGCGGTGGACTTGGATCTTGTAGTAAAGTGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAAACAATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATAT
  5   1   1         - In63                            IMAGE:8958609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTTTAAAAATATCTAGGACCCAAAAAAAACAAATTCGTCCACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCACGTGGATGAGGAGCAGTTTAATAAAGTTCTGGTGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACACATGACCATTGCTAGAGAGAGATTTTTGGACCTGTGATGCAATTCTAAAGTTTAAATCCATTGAGAGGTGATTGACCGAGCACACTCAATGTATGATTGCAGCTGCTGTGTTCCGAAGACATGATACGGCTCCCCTTACGTGTCTCAGTCAGTAAAACCTTG
  5   1   1         - Gas7      in                         XZG43097.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGACATGAACCCCTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAAAACAGATTTTTGGAC
  5   1   1         - Bone      in                       CBTC10134.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGACATGAACCGGTTGGAGTTTGCGGACAGATCATTCCGTGGAATTTCCCGCTACTGATGCTGGCGTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAG
  3  -1   1         - Int1                                 CAAP9394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   taagtctccccatatttcacctgttcagatgatcagaaggcaaccagaaacaaaaaacgctgagctgtgtaaagaaagttcccataatgccttgctcctgcaccaagaccagtgtacatgctcagttagtaagactatgaggaagcttcctgctgattggctcagatccacattcctaagggggggagtgagttcttggcattcttGAGGGAGGGGGGAGCAGAAGAGGGGAGAGATGAGAGAGCTGGCACAGGAAAACAAACAGACAAGAAATCCTgtcagtgcagtgtttctgtgagtgcttatggatgtatttacatagacctttctgataaagcttacttagtttttaccTTTTTTTTCTCCTTTAAACTTAATATTCCCTGTAATTGTTAACCCAGTTCCAAAAAAATGACAACTTTGGCATCTCATGGCAGCGGAATTTATACTTTGTGCTTTTATATAAATAACATTTATACCCCAAGTTTGAAAAATATAAATTTTTAGGTGTGCCTCATTTTACCTGTTTCCTTTCTATTATAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCANATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGNTTGGCAGCTGCTGTGTTCCAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGGACTGTCT
  5   1   1         - In66                            IMAGE:8965149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAATTTAAATAATTAAGGAACTAATAAATAATCAAATTCGTCCCGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCACTGCTCTGCATGTTGCCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAATCCTAAAGTTTAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGCTCACTATGTGTCTCAGTCAGTAGAGCTGGAACTGTCTGATTACTGCTATGATGTTTTTGGAGCTCAAGCCCCTTTGGTGATTCAGGGCATCAGGAATAGGAAGAGAAACCTTGTGA
  5   1   1         - Ova1      in                        CABE10252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCCTTGTGAAAGAGGCTGGATTCCCACCGGGTGTTGTGAATATCATTACTGGAATGGGTCCCACAGCTGGTGCAGCTATCTCCTCTCACATGGACGTGGATAAAGTAGCATTTACTGGCTCTACAGAGGTTGGTCGTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCANGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACC
  5   1   1         - Ski1      in                         CABJ2686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAATTCGGCACGAGGCTTTTTCAGGGTTAGAAAAGACACTTCAGCAGTTTATTAAAATCTCCCCTCATCAGCACCAAGCATTAACCTTAACAAAGGACAGTAAATGAATAGAACTCTAAAATCCATCTGCAAGACATTAATACTGTGCTAACAGCAAATATGTCAAAGCACACAGTTTTAGGGAGTTGCCCTATTTGGGCCACACACTCCGTCTCCCAGTCCTGGACATTGACGTTTTGTTGTCTTCCTTCCCCACATTCAGGTTAGTAGTTCTGCACTGAAAGGTAGGGCGTTTTTTTGTTTTTTTTTTTTACCAAAAAATCCATTTCTTCTAGTCTCATATTGTCAATGCAGATAGGCTTTGCAATAGGAATGTTGAGGGCACCTAAAGTTAATTTTTTACATGTTCAGGGAAGAAGAATTCAAAGTTGGCCTGCCTACACTGGTGAGTTACAATTCCCACAAATTATGCACTGAATCTACTGGTCTAAATGAAAAGCATTTTCTATGAATAGTTTGGATCGGGTTTCTGTCAGGGAAAATGTTACTTTTATCTTCAGGCTCCTAAACTAAGATCTTGCTGACATGAAATTACATGTGTTTTTTACTTTAAGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCT
  5   1   1         - Spl2      in                        CBSS8845.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCTTTAATCCAACAAGCAGCTGGGAAGAGCAATTTGAAAAAAGTGACGCTGGAACTTGGCGGAAAGAGCCCAAATATTATCTTTTCTGATGCTGATTTGGATTGGGCTGTGGAGCAGGCCCACTTTGCTCTGTTCTTTAACCAGGGCCAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATA
  5   1   1         - Ski1      in                         CABJ7499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTGCTGCTGTGCTGGCTCTCGCACCTATGTTCAGGAAGATATCTACAATGAGTTTGTTGAGAGGAGCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTC
  5   1   1         - Tail      in                         CBSW5373.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATACAAAGAGCAAAGAATAGGATTGTGGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTGCAC
  3  -1   1         - Sto1      in                        CABG10335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGAACCCCTTTGACTTTAAAACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTANAATGAATCTTAAAAAGTAAT
  5   1   1         - Tail      in                         CBSW6741.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAGAACAAGGACCTCAGGTGGATGAGGAGCAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTTGCAC
  3  -1   1         - Spl1      in                         CABK7666.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTCACTATANGGCGAGAGGTTTTTTTTTACCAGAAAATCCATTTCTTCTAGTCTCATATTGTCAATGCAGATAGGCTTTGCAATAGGAATGTTGAGGGCACCTAAAGTTAATTTTTTACATGTTCAGGGAAGAAGAATTCAAAGTTGGCCTGCCTACACTGGTGAGTTACAATTCCCACAAATTATGCACTGAATCTACTGGTCTAAATGAAAAGCATTTTCTATGAATAGTTTGGATCGGGTTTCTGTCAGGGAAAATGTTACTTTTATCTTCAGGCTCCTAAACTAAGATCTTGCTGACATGAAATTACATTTGTTTTTTACTTTAAGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTAAGTTCTGTAATTGATCCATATGCTTAAATCCTCTATACCCCCATAATCCTCAGAGTACAGGAAGCTGCTGGGCACCCCCATAACCCTCAGGGTAGAGGAAGCTGCTGGGCACCCCCATAACCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAACCCTCAGGGTACAGGAAGCTGCTGGGCACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAATACCCCCATAATCCTCAGGGTACAGGAAGATGCTGGGCACCCCCATAATCCTCAGGGTACAGGAAGCTGCTGGGGGGCACCCCCATAACCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAACCCTCAGGGTACA
  5   1   1         - Fat1      in                         CABC8286.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGAGGAGTTTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTG
  5   1   1         - Sto1      in                         CABG4869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAATAAAGTTCTGGGGTATATAAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTG
  5   1   1         - Ski1      in                         CABJ6530.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATCTGGAAAAAAGGAAGGTGCAAAACTCCTCTATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAACTGTGACTTTCATCATATACCAGCTGCCAT
  3   1   1         - Int1      in                        CAAP12314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGC
  3   1   1         - Lun1      in                          CABD821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGTGTAAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTCGTAAAAAAAAAACCTCT
  3   1   1         - Ski1      in                         CABJ7499.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCGAAAAAAAAAAACCTCTCGCCCTA
  3   1   1         - Ski1 5g3  in                          CABJ787.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGTGGTAACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACGTTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAA
  3   1   1         - Ski1      in                         CABJ6530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGC
  3   1   1         - Mus1      in                         CABH7996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Int1      in                        CAAP10077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGCTGCTGATCGGGGCTATTTTATCCAGCCCCCCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCNATATATTTCTGC
  3   1   1         - Ova1      in                        CABE10252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  5  -1   1         - Int1      in                        CAAP11256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATA
  3   1   1         - Spl1      in                         CABK4649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTGCTGATCGGGGCTATTTTATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  5  -1   1         - Lun1      in                        CABD13267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAAT
  3   1   1         - Te5  5g3  in                         CAAO5820.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGGTATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Fat1      in                         CABC8286.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGCCCACCGTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGC
  3   1   1         - Gas  FL   in                    TGas130e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCGAAAAAAAAAAAAAAAA
  5  -1   1         - Int1      in                         CAAP5962.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTTGGGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAG
  3   1   1         - Int1      in                         CAAP6459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATGTGACTGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATTCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAG
  3   1   1         - Te5       in                         CAAO6458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACAACATGACCATTGCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTAAGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTTNGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  5  -1   1         - Fat1      in                         CABC1643.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATGTGACTGACAACATGACCATGNCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATTTTCCCTCGTGCCGAT
  3   1   1         - Spl2 5g3  in                        CBSS1359.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGC
  3   1   1         - Ski1      in                         CABJ9008.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCCCCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   1         - Bone 5g3  in                        CBTC7616.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGC
  3   1   1         - Spl2 5g3  in                        CBSS1288.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAAGAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCGT
  3   1   1         - Bone      in                       CBTC10134.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGATTTTTGGACCTGTGATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTG
  3   1   1         - Te5       in                        CAAO12577.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGCAAATCCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGGTATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Tail      in                         CBSW6741.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTAAAGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAAAGCTTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAA
  3   1   1         - Lun1      in                        CABD13545.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTTAAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  5   1   1         - Tad5      in                          XZT6564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAATCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTG
  3   1   1         - Ski1      in                         CABJ2686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATGAAAAGCATTTTCTATGAATAGTTTGGATCGGGTTTCTGTCAGGGAAAATGTTACTTTTATCTTCAGGCTCCTAAACTAAGATCTTGCTGACATGAAATTACATGTGTTTTTTACTTTAAGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAA
  3   1   1         - Liv1      in                         CAAR7312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCATTGAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAG
  3   1   1         - Tad5      in                          XZT6564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAGGTGATTGACCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAAAAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTC
  5   1   1         - Ski1      in                         CABJ9699.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAAGTTTATAGGAGCGGGTTTCTGTCAGGGAAAATGTTACTTTTATCTTCAGGCTCCTAAACTAAGATCTTGCTGACATGAAATTACATTTGTTTTTTACTTTTAAGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAA
  3   1   1         - Tail      in                         CBSW5373.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAA
  3   1   1         - Gas7      in                         XZG43097.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAGGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAAAGG
  3   1   1         - Ova1      in                         CABE3169.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCCAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCGGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAATCCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Sto1      in                         CABG9300.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  5   1   1         - Sto1      in                         CABG9300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACAACTCAATGTATGGTTTGGCAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAAAAA
  3   1   1         - Gas7 5g3  in                         XZG26550.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCTGCTGTGTTCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCATGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTTATACATAATAAAGTCATATATTTCTGT
  5  -1   1         - Sto1      in                        CABG10335.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCCCCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATTCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Spl2      in                        CBSS8845.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACAAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Bone      in                        CBTC8042.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAGGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCCCCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAAAGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTTTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTTTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Sto1      in                         CABG4869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACATTGATAAGGCTCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAAAGCTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Gas7 5g3  in                         XZG20022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACATTGATAAGGCTCCACTATGTGTCTCAGTCAGTAAGAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCATGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCCCCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAAAGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTTATACATAATAAAGTCATATATTTCTGT
  3   1   1         - Ski1      in                         CABJ9699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTGTTTTTTTCTTTTAAGGATTAACTGCTTTAATGTTTTTGGGGCCCAACCCCCCTTTGGGGGGTTCAAGGCCTCCGGAAAAGGAAGGGACCTTGGGGAATATGGCCTTGGGGCCTATACAAAAGGGAAGAATGTCCCCCTTAAGTTTCCCCCGAAGAATTCCTAAATTGGGTGGGAAAGAAAAACCCCCGGGAAACCGGGGGGGGGGTTCCGGCCTTAAAAGTTCATATTAGCCGCTTTCAGGGGTTAGGGGCCCCCTTTTAAAACCCTTTTTTTTTTTGAATTAACAAAAAGCTTTCCTTTTTGGGAAATCGGGAAAGCCTTTTTTTTTTTTTTTTTTTTTTTTCGGCCCCCCGGGCGGATTAAAACCGGGCGGGAAAATGAATTTTAAAAAGTAAAGCCCAAACCGAAAGCCCTTAATCCTTTCCCCGGTTTTCAGAATACCCCCGGCTTTGGG
  5   1   1         - Tail      in                         CBSW4585.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAAA
  3   1   1         - Tail      in                         CBSW4585.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCTGGAACTGTCTGGATTAACTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGCGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCGTAAAAAAAAAAAAAAA
  3   1   1         - Te5       in                         CAAO8287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTTAAACCCCTTGAAGTTTTTGGGGCCCCACCCCCCCTTGGGGGGTTTCAGGCCCCCCGGATTGGGAGGGGACTTTGGGGATTTGGGCCTTGGGCCCTTTCCGAAGGGGGGGAGGTCCCCCCTTAGGTTCCCCCCGGGGATTTCTTAAATGGTTGGGGAAGAAAAACCCCCGGGGAACCGTGGGGGGGGGTTTGGCCTTTTAAATTCCTTTTTGCGGCCTTCCGGGGTTTGGGGCCCCCCTTTTAAACCCCTTTTTTTTTTGGAATAACAAAAAGCCTTTCTTTTTTGGAAATTTGGAAAGCCTTTTTTTTTTGCCCCCCCGGCCGGTTTAAACCCCGCCGGTAAAAGGATTTTTAAAAAGTAAGCCCCCCCCGGAAGCCC
  5   1   1         - Panc      in                        CBTA1652.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCTATGATGTTTTTGGAGCTCAAGCCCCCTTTGGTGGATTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATATCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGTAAAAAAAAAAAAAA
  5  -1   1         - Spl1      in                         CABK7666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGATCCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTAAGTTCTGTAATTGATCCATATGCTTAAATCCTCTATACCCCCATAATCCTCAGAGTACAGGAAGCTGCTGGGCACCCCCATAACCCTCAGGGTAGAGGAAGCTGCTGGGCACCCCCATAACCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAACCCTCAGGGTACAGGAAGCTGCTGGGCACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAATACCCCCATAATCCTCAGGGTACAGGAAGATGCTGGGCACCCCCATAATCCTCAGGGTACAGGAAGCTGCTGGGGGGCACCCCCATAACCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAACCCTCAGGGTACAGGAAGCTGCTGGGCACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAATACCCCCATAATCCTCAGGGTACAGGAAGATGCTGGGCACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAACCCTCAGGGTACAGGAAGCTGCTGGGCACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAACACCCCCATAATCCTCAGGGTACAGGAAGCTGCTAAATACCCCCATAATCCTCAGGGTACAGGAAGATG
  3   1   1         - Bone                                CBTC6478.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAAGGCATCAGGAATAGGAAGAGAACTTGGCGAATATGGACTTGAGGCATATACAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAAAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT
  5   1   1         - Bone                                CBTC5416.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAAGTGAAGAATGTCACCATTAAGATTCCCCAGAAGAATTCCTAAATGTGTTGTGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACACTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACAAAATAAAGTCATATATTTCTGCNNNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAGGAAAAAAAAAANNGGGGGGGGGGGGAAGGG
  3   1   1         - Panc      in                        CBTA1652.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAATTCCTAAATGTGTTGGAAAGAAAAACCACTGGGAAACTGTAGGGTTGGTTCTGGCTTTATAAGTTCATATTAGCTGCTTTCAGAGTTTAGTGGCCACCTTTTAAAACCCTTTTATGTCTTGAATTAACAAATAGCTTTACTTTTCTGTAATTCTGTAATGCTTTTTTTTTTTTTTTTTTGCACACAGAGCAGATTAAAACCGTGCAGTAAAATGAATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTAATCCTATACACGGTTTTCAGAATACCCCAGGGTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACAATGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCGGT
  3   1   1         - Tail 5g3  in                         CBSW1987.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTGGGGCCCCCTTTTTAAACCCTTTTTTGTTTTGAATTAACAAAAAGGTTTACTTTTTTGGAATTTTGGAAAGGCTTTTTTTTTTTTTTTTTTTTTGGCCCCCCGGGCGGGTTAAAACCGGGCCGTAAAAAGAATTTTTAAAAGTAATGCCCCAACCGAAAGCCCTTTATTCTTTTCCCGGTTTTTCGAATTCCCCCGGGTTTGGGTTGCCCGGCCTCAATGTGATTTTTGCCCCCAAAAACCCTCAAGGGGGTTTGGGCTCCCAAATTTTCAAGAAAGTTTTGTTTAACTTC
  3   1   1         - Bone 5g3  in                       CBTC10681.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTAAAATGATCTTAAAAAGTAATGCCCAAACAGAAAGCACTTATTCCTATACACGGTTTTCAGAATACCCCAGGCTCTGTGTTGCCAGGCATCAATGTGATATTTGCCCCAAAATACCATCAAGTGGCTTTGGACTCCAAACTATTCAAGAAAGTTTTGTTAAACTTCACACTGGAATTTCTTCTGGCTTCAAACTGTGACTTTCCATCATATACCAGCTGCAATAGAGGCACTTCTAATACATAATAAAGTCATATATTTCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)