Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI6723.3                           18 END     1           1        5                (no blast hit)

 This cluster: approximate FL confidence score = 87%

 1012072811 Xt7.1-CABE10050.3 - 53 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABE10050.3                     AAATTTTACCCAAGAGCATCTTCATCATCATCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225447                           TACCCAAGAGCATCTTCATCATCATCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTGAAAAAAAAAAAAAAAAA
                                                      consensus depths                          4     9     4     9     6     9     8     9    12    13    14    15    15    16    16    16    16    16    16    16    15    16    17    17    18    18    20    20    20    20    21    22    21    22    22    22    22    22    22    22    21    22    21    22    22    22    22    22    22    22    23    23    22    23    23    23    23    23    24    24    24    24    25    25    25    25    26    26    26    26    26    26    31    31    31    31    31    31    30    32    33    34    33    34    35    36    36    37    36    37    37    39    38    39    41    42    44    45    44    46    39    41    42    44    43    44    42    43    42    42    40    41    40    42    41    42    40    41    39    40    40    41    40    41    38    41    40    41    38    41    38    42    38    40    37    39    38    39    36    38    36    37    35    36    35    36    34    36    33    36    31    32    31    32    29    31    29    31    30    31    28    31    23    31    23    31    24    30    23    30    22    29    23    29    24    29    23    29    21    29    22    29    22    29    24    29    23    29    22    29    23    29    22    29    22    29    21    27    21    27    21    27    20    26    20    26    17    25    16    23    16    23    14    21     5     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G---G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------A---
                                               BLH ATG      55     335                     
                                               BLH MIN      52      43                     
                                               BLH MPR     -11      43                     
                                               BLH OVR      55      52                     
                                               CDS MIN      55      22                     
                                               EST CLI     -10      22                     
                                               ORF LNG      55       1                     
                                                                                                                 PROTEIN --- Sp ---- 6e-011     NP_001001768.1 hairy and enhancer of split [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                            PROTEIN --- Dm ---= 6e-012     NP_524504.2 E(spl) region transcript mgamma CG8333-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Ci ---- 2e-013     BAE06387.1 transcription factor protein [Ciona intestinalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                      PROTEIN --- Bf ---- 3e-014     AAQ93670.1 hairy D protein [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PROTEIN --- Gg ---- 8e-014     NP_001005848.1 c-hairy1B [Gallus gallus] ---------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN === Dr ==== 2e-014     NP_571684.1 hairy and enhancer of split related-7 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Hs ---- 3e-015     NP_115969.1 hairy and enhancer of split 7; bHLH factor Hes7 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Mm ---- 2e-015     NP_149030.2 hairy and enhancer of split 7 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN === Xl ==== 1e-076     BAB78542.1 HES-related 1B [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN === ?? ==== 1e-076     NP_001082175.1 HES-related 1B [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PROTEIN === Xt ==== 1e-100     CAJ82070.1 Helix-loop-helix DNA-binding domain protein with Hairy Orange domain, similar to hes7 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE10050.3                                                                            ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGA---------ATG------TAA---------------------------------ATGATG---------------------------TAG---------------------TGA---------ATG------TGA---------------------------------------------------------------------------------------------------------------ATG------------------TAG---------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------ATG------TGA---------------------TGA------------------------TGA------------ATG------------------------------------------------------------TAA
                                                                   ORF                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Egg  FL                     TEgg019e05.FL-Sanger                    CAAATTTTACCCAAGAGCATCTTCATCATCATCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAAGGAGGGTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5x3  out                  TEgg034a21.p1kSP6 TCACATTCCTGCACAGAGGGGGCAAATTCTACCCAAGAGCATCTTCATCTTCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCCACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTC
  5   1   2       bld Gas  5g3  in                   TGas081d23.p1kSP6         CCGGGGGGCAAATTCTACCCAAGGGCATCTTCATCTTCATCTTCATCTTCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAA
  5   1   2       bld Egg  5g                        TEgg119a06.p1kSP6           AGGGGGCAAATTCTACCCAAGGGCATCTTCATCTTCATCTTCATCTTCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGG
  5   1   2       bld TpA  5g3  in                   TTpA054g22.p1kSP6                 AGGGGGCAAATTCTACCCAAGAGCATCTTCATCTTCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAAATACCTTGGAGACTTGGAGACCTTTGGTATGATGACATTCCACCATGGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTT
  5   1   2       bld Egg  5g3  in                   TEgg041m22.p1kSP6                  GGCAAATTTTACCCAAGAGCATCTTCATCATCATCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGA
  5   1   2       bld Gas1 5g                          NISC_mq04f03.y1                  GGCAAATTTTACCCAAGAGCATCTTCATCATCATCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAA
  5   1   2       bld Egg  FL   in                   TEgg019e05.p1kSP6                   GCAAATTTTACCCAAGAGCATCTTCATCATCATCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTG
  5   1   2       bld Egg  5g3  in                   TEgg041n24.p1kSP6                   AGTTCTTTTGGGCAGAGCATCTTCTTCATCATCCTCCTCGTCGTCATCTTCCAACGATGAATGGACCTAGTGATGTCGCACCCATGGCAAGCGCATTTAAAGCTGCTGAATCCATTGGTGGAGATGATGCTGCGGGATAGGATAAGCGACACCCTGGACAAGCTGAGAATTTTCCTTTCTCTGGCCTTGATAAGCGAGAAACTATCCAATCCCGGGGTGGATAACGCTGATATCCTACAGTGCACGGTCCATTTCCTCCCTTCCCTGACGCTTGTCGCACAGGATGGGGACGTAAGCAATTGACGGTATCGATCGGGGGTCCACCATTGCCTGGAGGACCCCTTGCACTTCCTGAACTCTAAACCCGACCTCCTCGTTGCAACCGACGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGTAGTCCCACCGACACTCCAGAACCCACTCCTTCCATTGGGTACCAAGACTCATCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAATTCTCTCCCCAGACCTTCCCGACCTGGAGACCTTGGGTATGATGACTTTC
  5   1   2       bld Gas  5g3  in                   TGas131f09.p1kSP6                   GCAAATTTTACCCAAGAGCATCTTCATCATCATCATCATCATCATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAAAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCCCCATGGGAGGGGGAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGG
  5   1   2   10  bld Ova1 5g3  in                         CABE1427.5p ...........................................................CATCATCAGTCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCAGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGCCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGCTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCGTTGGGTACCGAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGAAGGGCAGCTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCAT
  5   1   2   10  bld Ova1 5g3  in                         CABE1235.5p ............................................................CATCATCATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTTCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCCAAGCTCTTG
  5   1   2   10  bld Ova1 5g3  in                        CABE11335.5p ...................................................................ATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAAACGTTT
  5   1   2   10  bld Ovi1 5g3  in                         CABI7866.5p ...................................................................ATCAGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCA
  5   1   2       bld Ova1 5g3  in                        CABE10545.5p                                                                       AGACCATGAAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTA
  5   1   2       bld Neu5      in                          ANHP639.5p                                                                               CAGGGAGCGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTT
  5   1   2       bld Ova1      in                         CABE4319.5p                                                                                      CGAGTGAAGTCAGACCCATGGAAGCGCATAGAAAGCTGCTGAAGCCATTGGTGGAGAGGAGGCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAATAGCCTCCAGGCTTGAATTATGGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTA
  5   1   2       bld Ova1      in                        CABE10050.5p                                                                                                                                                   GCGGCGGGAGAGGATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGG
  5   1   2       bld Egg       out                  TEgg034a20.p1kSP6                                                                                                                                                               GATAAACAACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCA
  5   1   2       bld Gas8      in                          st69p14.5p                                                                                                                                                                      CACAGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCT
  5   1   2       bld Gas8      in                          st70p14.5p                                                                                                                                                                         AGCCTGGAGAAGCTGAGAATTTTCCTTTCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCNCCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCT
  3  -1   2       bld Ova1      in                         CABE2199.3p                                                                                                                                                                                                    TCTCAAGCCTTGAAAAGCGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATA
  5   1   2       bld Neu5      ?                          ANHP2755.5p                                                                                                                                                                                                        ATTTTCATGTCATGGAGAAACTAAAGAATCCCAAGGTGGAGAAGGCTGAGATCCTAGAGTGCACGGTCCAGTTCCTCCAGTCCAGTAAGCTTGTCCCACAGGATGGGGACGTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTA
  5   1   2       bld Gas       in                   TGas091n15.p1kSP6                                                                                                                                                                                                                                                                                                                      GTAGGCAATAAAGGGTATCAGTCGGGGTTCCAGCATTGCCTGGAGACAGCCTTGCACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTA
  5   1   2       bld Ova1      in                         CABE3951.5p                                                                                                                                                                                                                                                                                                                                                                            CACTTCATGAACTCTAAACCCGACCTCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTT
  3   1   2       bld Egg  FL   in                    TEgg019e05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                     TCAACGTTGCAACCAAGGACTTCCTCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAAGGAGGGTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTAC
  3   1   2       bld Ova1      in                         CABE3951.3p                                                                                                                                                                                                                                                                                                                                                                                                                             TCTCCCACCAGTTGTCCTCCTATAAGCCACCTGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGC
  3   1   2      seed Ova1      in                        CABE10050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTG
  3   1   2       bld Egg  5g3  in                    TEgg041m22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTGTCCTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg041n24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTCGGCGACCTCGGGTATGATGACTTGCCGCCCAGGAAGGGTGCATAAATAGCCTCCAGGCTTGAATTATGTGGGCTTTGCCAGAGTCCTCAGGCAACAGGGGATGGTACAGAAGAGACTTTATTAGGAAACTCTTTATCCCTGACAAGAAAATCTGCAGAGCCGTTGAGCTGAACCCAAAGGTCTTGAGATACAACGAATCTGTGGGTGTATAATAAAGTGTAAATAAGGAGGGTTTGAGCACATTACATGAGTATGGGAGACTTCCGTGTCCCTACAGATCTGTATATATGGTGTACATAATGTCTAGAATGTTGCGTATTTTGGATGAGGAGATCGAGTCCCGCAGGCACAGAGGAGGGGGAGCCTTGGAAAGGAGCAGCAATGCCCAAACGAAGCCTCTTATATAGAAGCTTCTGAGACGTGGGGTCAGTTTCCCACA
  3   1   2       bld Gas       in                    TGas091n15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTATGGAAATAAAACCCTTACTGTCCTGAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5g3  in                    TGas131f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGCCTGGAGTCCCACCGACACTCCAAAACCCACTCCTTCCATTGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTTCCTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                        CABE11335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTCNTTCCATTGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCT
  3   1   2       chi Gas  5g3  in                    TGas081d23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAATGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGAGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCGAAAAAAAAAAAAAAAA
  5  -1   2       bld Ova1      in                         CABE2199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATA
  5   1   2       bld Gas7      in                         XZG30730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGTACCAAGACTCAGCACCACATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGAGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGGATTCTGTAAATAANACCTTTACTTGTCCCTGAAA
  3   1   2       bld Ova1      in                         CABE4319.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTATCTTCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTG
  3   1   2       bld Ova1 5g3  in                         CABE1235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCAACACCATCTCCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTG
  3   1   2       bld Ovi1 5g3  in                         CABI7866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGTCAGCCCCACAAAGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCC
  3   1   2       bld Ova1      in                         CABE2584.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTG
  5   1   2       bld Ova1      in                         CABE2584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACTCTGGTTGATGGGCAGTTCTCTCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCCTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st70p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTNTCACGCAGGCACAGAAGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTCCAGCATGAT
  3   1   2       bld Ova1 5g3  in                        CABE10545.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCAGACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTG
  3   1   2       bld Gas8      in                          st69p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCTTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAAGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTCCAGCATGATGAT
  5  -1   2       bld Ova1      in                         CABE2849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCCAGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCGTTACTTGTCCTGAAAAAAAAA
  3  -1   2       bld Ova1      in                         CABE2849.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTGAAAAAAAAA
  3   1   2       bld Neu5      in                          ANHP639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACCTGGAGACCTTGGGTATGATGACTTTCCACCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTG
  3   1   2       bld TpA  5g3  in                    TTpA054g22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGTATGATGACTTTCCACCCATGGAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1 5g3  in                         CABE1427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGAAGGGTAAGAGAATATCCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCGCCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCTCCATGGGAGGGTGAAAGCATAGCCTTGGAGCCCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAGCCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATCATAAGGAGGGTTTGAGCTCATTTCATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTAGGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTG
  3   1   2       bld Ova1      in                         CABE5481.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTGAC
  5   1   2       bld Ova1      in                         CABE5481.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGGGTAAGAGAATAACCTTGGAGACTTGGAGACCTTGGTTATGATGACATTCCACCATGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCACCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCACCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGCGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAATGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTCTGAGAGTGGGGTCAGTTTCCCACACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTGACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG30730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGAGGGTGAAAGAATAGCCTTGGAGACCTTGGGTAGGATGACTTTCCCCCATGGGAGGGTGAAAGCATAGCCTTGGAGACCTTGGGTATGATGACTTGCCCCCATGGAAGGGTGCAAAAATAGCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAACTGGCGATGCTACAGAAGAGACTTTATTAGGAAACTATTTTTCCATGACATGAAAATCTGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATACAACGTATCTGTGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCCCATTACATGAGTATGGGAGACTTCCGTGTCCCTATAGACTGTATATATTGTGTACATAAAGTATAGATTGTTGTGTATTTTGGATCTGGAGCTTGTGTCACGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGATGCATTTTATATAGAAGCTTTTGAGAGTGGGGTCAGTTTCCCCCCCTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCCTCTGTCACTTACCTTCCAGCATTGATTGGATTCTGTAAATAAAACCTTTACTTGTCCTGG
  3   1   2       bld Gas7                                 XZG20292.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTCCCCCCTGGGGGGGTGAAAGCATAGCCTTGGAGACCTTGGGTTTGATGACTTGCCCCCCTGGAAGGGGGCAAAAATAGCCTCCCGGCTTGAATTTTGGGGCTTTGCCAGAGTTTTCAGGCAACTGGGGATGCTACAGAAGGGACTTTTTTTGGAAACTATTTTTCCCTGACATGAAAATTTGCAGAACCGTTTTGCAGAACCCAAAGCTCTTGGGATACAACGGATCTGGGGGGGTAAATACCGGGTAAATAATAAGGGGGGTTTGGGCCCCTTCCCTGGGTTTGGGGGGCTTCCGTGTCCCTTTAGACTGTATATTTTGGGTACATAAAGTATAGATTGTTGGGTATTTTGGATTTGGGGCTTGTGTCCCGCCGGCCCAGAGGGGGGGGGGCCTTGGAAAGGGGCCGAAATGCCCAAATGATGCCTTTTTTTTAGAAGCTTTTGGGGGGGGGGTCAGTTTCCCCCCCTGTGGG
  3   1   2       bld Egg                             TEgg007b07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGTGCAAAAATACCCTCCAGGCTTGAATTATGGGGCTTTGCCAGAGTCTTCAGGCAAATGGCGATGCCACAGAAGAGACTTTATTAGGAAACTATTTCTCCATGACATGAAAATATGCAGAACCGTTTAGCAGAACCCAAAGCTCTTGAGATTCAACGTATCTGGGTGTGTAAATACTGTGTAAATAATAAGGAGGGTTTGAGCACATTACATGAGTATGGGAGACTTCCGCGTCCCTATATACTGTATATATAGTGTACATAATGTATAGATTGTTGTGTATTTTGGATTTGGAGCCTGTGTCTCGCAGGCACAGAGGAGGCGGAGCCTTGGAAAGGAGCAGAAATGCCCAAATGACGCATTTTATATAGAAGCTTCTGAGAGTGGGTGTCAGTTTCCCATCACTGTGAGGCTCAGAGCTTATGTATTTAGTATCTGTATATTTATTCATCTGTCACTTACCTTCCAGCAAAGATAGGACTCTGTAAATAAAACCTTTACAAGTCCTGAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)