Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM7918.5                           19 END     14         12       77                Unknown (protein for MGC:146503) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAM5515.5                            6 END     2           1       33                Unknown (protein for MGC:146503) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 202.0    0Xt7.1-CAAK8421.3                            2 PI      100      1308     1413                Unknown (protein for MGC:146503) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012072853 Xt7.1-CABI14225.3.5 - 113 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABI14225.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTCTGAATCCAGGAAAGATTCCTCCTCTGACGTCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAATCGATGCCCACCCCCATAAACTCTAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGACCTTTAAAGGCTATTTTTTTTTTCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222914                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCCAGGAAAGATTCCTCCTCTGACGTCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCAxCxxTxAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATxCxxxxGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATxxxACxxxxxxCTTTAAAxxxxxxCCCACCCCCATAxxxxxTAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAxCTTTAxxxxxTATTTTxxxTTxCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTxxGxxTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     5     6     6     6     6     6     6     6     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     8    10     8    10     9    11     6     8     6     8     6     8     6     8     6     8     6     8     8    10     8    10     7    10     7    10     8    11     9    12     9    12     9    11    10    11    10    11    10    11    10    12    10    14     8    12     8    13     8    13     9    16    10    16    10    16    10    16    10    16    10    16     9    15     9    15     9    14     9    14     9    14     9    14     9    15    10    16    11    16    12    17    12    17    13    18    13    18    13    18    13    18    13    18    13    18    13    18    13    18    14    19    14    19    14    20    15    20    15    20    16    21    16    21    13    22    13    22    13    22    13    22    14    23    14    23    14    22    14    22    13    21    13    21    13    21    14    22    14    19    14    19    14    19    14    19    14    19    15    20    16    21    16    21    14    20    13    18    13    18    11    16    10    15    11    16    11    16    11    14    11    14    11    14    11    14    11    14    11    12    11    12    11    11    11    11    11    11    10    11    11    11    11    11    10    10    10    10    12    12    13    13    13    13    13    13    13    13    12    13    12    13    12    12    11    12    11    11    11    11    11    11    10    11    10    11    11    12    11    12    11    12    10    11    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    10    10    10    10    10    11    10    11    10    11     9    10     9    10     9    10    11    12    11    12    11    12    11    12    11    13    10    12    11    12    11    12    12    13    12    13    13    14    15    16    16    17    16    17    16    17    16    17    16    17    16    17    15    16    15    16    15    16    14    15    14    16    14    17    15    18    14    18    14    18    14    18    14    18    14    18    15    20    15    23    15    23    15    23    15    24    15    24    15    24    14    25    14    25    15    25    15    24    16    25    15    24    15    24    15    24    15    24    10    24     9    23     9    23     9    22     9    23     9    24     9    24     9    24     9    23     9    24     9    24     9    24     9    24     9    23     9    23     9    23     9    22     8    20     8    20     8    20     8    20     9    21     9    21     9    21    12    23     9    25     9    25     9    26     9    26     9    26    11    32    14    38    15    41    15    42    25    43    17    44    18    45    18    46    19    48    20    49    20    48    20    47    20    47    19    47    21    47    21    47    21    41    21    41    23    43    24    45    24    45    24    45    25    45    25    45    26    46    26    46    26    46    26    46    26    46    26    46    26    46    26    46    40    45    29    45    29    45    40    45    40    45    39    45    40    45    36    44    38    44    40    44    39    44    40    43    39    43    39    43    39    43    39    43    38    43    38    43    39    43    36    43    38    42    38    42    37    42    36    41    35    40    35    40    35    39    34    39    35    39    34    39    34    36    28    33    30    32    28    32     5    11     6     7
  5   1   2  SIG                                     Xt7.1-CAAL22741.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGTTTACGCATTATTTAGCTTTGTGTTCAGCAGCTCTCCAGTTTGGAATTTTAGCCAGTTATTTATGAATTTATTAAATGGTATAACTAAAAATGTGTTCTCGCCTGATATTGGGAATTCCTTTAGGCAAGAGAAAATGTGCCGTCATCCGAACACTCTGAATCCAGGAAAGATTCCTCCTCTGACGTCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAACAAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTT
  5   1   2  SIG                                     Xt7.1-CABI14225.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCTTTAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAM7034.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGTCCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCGTTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGCAGAAAGCAAGGAGAGGAAGCCGATGATGAGAGAAGTGACTTATTAGTGAGGCCGGGCCATGAAACTGATAGTGAAATGACTTCCCATTATTGCTCAGCGTTGCCTTCGACGCACATCGAACTATGGAGAGCCACGAGATGTTCAGTGAAACTCGAAAGAAAGTTCT------------------------CACGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAGAAGCACAAAACAAACTGTACATGGAGTTGTTCAGCGATAGCTAGACACGTACACAGTGCAGATTATATTATGGAGACTAAGATCAAAAAAATAAAATGTATAATAAGGCTTGCAGTCTCTCCCTGGCATAGGCCTTTCCTCTCTGTGTGTTTGTGTATATCTACCGAACAGATGGCACCAAGTGGAACACGTTTTCAATGTACTAAAATTCCTCTTCCTTCTTTTTCTTCCCTTGCCCACCTATTCTATGGTCTAGTATCTCTGGATCTCTTAGCCAATTTCTCCTCTCTGCTTTTGCACTAACCGAGCATGTTGTATCCCACAGCAATACCCCTCCCACCCACCTCTAAACCATGTTGTTAGCACAAAGGGTTTACTTCTGCCATTGCTGAAACAAGACCTTTTTTATACTGATGTCAACACAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAACAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCTCCCCACAGTTGCAGTTGAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTTTATTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCCACAGTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G-G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----GT-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T-----
                                                                       ...PROTEIN --- Sc ---- 1e-021     NP_011082.1 Protein with role in bud emergence; Bem2p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 7e-024     FAA00122.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-045     NP_608396.2 CG1412-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-055     NP_498877.3 C04D8.1 [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 2e-092     XP_001198090.1 PREDICTED: similar to KIAA1424 protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_695143.1 PREDICTED: similar to Rho GTPase activating protein 21, partial [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 0          XP_897172.2 PREDICTED: Rho GTPase activating protein 21 isoform 2 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_065875.2 Rho GTPase activating protein 21; Rho-GTPase activating protein 10 [Homosapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_418602.2 PREDICTED: similar to KIAA1424 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH76778.1 Arhgap21-prov protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI33059.1 Unknown (protein for MGC:146503) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001090761.1 Rho GTPase activating protein 21 [Xenopus (Silurana) tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABI14225.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAG---------------------------------------TAA------------------------TAG------------------------------------------------TAG------------------------------------------------------------------------ATG------------------------------------TAA---------------------TAG------------------------------TAA------------TGA------------------------------------------------------TAG------------TAA---ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------TAA------------------------------------------------------------------------------TGA---------------------TAA------------------TAA---------------TAAATG---------------------------------------------TAG---------TAGTGA---------------------------TAA------ATG---------TAA------------------TGA------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2  SIG                                     Xt7.1-CAAL22741.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGTTTACGCATTATTTAGCTTTGTGTTCAGCAGCTCTCCAGTTTGGAATTTTAGCCAGTTATTTATGAATTTATTAAATGGTATAACTAAAAATGTGTTCTCGCCTGATATTGGGAATTCCTTTAGGCAAGAGAAAATGTGCCGTCATCCGAACACTCTGAATCCAGGAAAGATTCCTCCTCTGACGTCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAACAAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTT
                                                  Xt7.1-CHK-1008277496                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACGCATTATTTAGCTTTGTGTTCAGCAGCTCTCCAGTTTGGAATTTTAGCCAGTTATTTATGAATTTATTAAATGGTATAACTAAAAATGTGTTCTCGCCTGATATTGGGAATTCCTTTAGGCAAGAGAAAATGTGCCGTCATCCGAACACTCTGAATCCAGGAAAGATTCCTCCTCTGACGTCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAACAAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCT
  5  -1   2       ext Neu                            TNeu133e14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGTTTACGCATTATTTAGCTTTGTGTTCAGCAGCTCTCCAGTTTGGAATTTTAGCCAGTTATTTATGAATTTATTAAATGGTATAACTAAAAATGTGTTCTCGCCTGATATTGGGAATTCCTTTAGGCAAGAGAAAATGTGCCGTCATCCGAACACTCTGAATCCAGGAAAGATTCCTCCTCTGACGTCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCCGTATCTGCAAAAGGACAAGAAAGAGCAAAGCGGCCCCCGG
  5   1   4      seed Brn4      in                        CAAL22741.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCCGTCATCCGAAGACTCTGAATCCAGGAAAGATTCCTCCTCTGACGTCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGT
  5   1   2       add Tad5      in                         XZT14965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTTAAGTTATCTTTTAGTATGTTATAGAATCTCCATTTCATTTTTTATTGTTTTTCCAGCTATTAAAAGGGGTCAGTGACCCCGGCAGCCAAAAAAAACCCAAAACTATTGCTCTTTGAGGCTACAGTTTCATTATTATTCTTTGTAACTACTTTCTGTTCATATCCCTTTCTATTTATGTTCCAGTTTCCTATTTTAGCCATTGCTTGGTTGCTAGGGTAATTTGGACACATCTGCTGCTGAATAAAAAAAATCTAAATCATTTaaaaaccacaaacaataaaaaatgaagaccagttgcaaaatgtttcagaatagcactctctgcaacatactaaaagttcatttaaaCAGCCCCTTTAAGAAGCACAAAACAAACTGTACATGGAGTTGTTCAGCGATAGCTAGACACGTACACAGTGCAGATTATATTATGGAGACTAAGATCAAAAAAATAAAATGTATAATAAGGCTTGCAGTCTCTCCCTGGCATAGGCCTTTCCTCTCTGTGTGTTTGTGTATATCTACCGAACAGATGGCACCAAGTGGAACACGTTTTCAATGTACTAAAATTCCTCTTCCTTCTTTTTCTTCCCTTGCCCACCTATTCTATGGTCTAGTATCTCTGGATCTCTTAGCCAATTTCTCCTCTCTGCTTTTGCACTAACCGAGCATGTTGTATCCCACAGCAATACCCCTCCCACCCACCTCTAAACCATGTTGTTAGCACAAAGGGTTTACTTCTGCCATTGCTGAAACAAGACCTTTTTTATACTGATGTNCACACAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACT
  3   1   4      seed Brn4      in                        CAAL22741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTT
  5   1   2       ext Brn3      ?                         CAAK12754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAACAAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCT
  3   1   2       add Brn2      out                       CAAJ23580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTTAAACAGCCCCTTTAAGAAGCACAAAACAAACTGTACATGGAGTTGTTCAGCGATAGCTAGACACGTACACAGTGCAGATTATATTATGGAGACTAAGATCAAAAAAATAAAATGTATAATAAGGCTTGCAGTCTCTCCCTGGCATAGGCCTTTCCTCTCTGTGTGTTTGTGTATATCTACCGAACAGATGGCACCAAGTGGAACACGTTTTCAATGTACTAAAATTCCTCTTCCTTCTTTTTCTTCCCTTGCCCACCTATTCTATGGTCTAGTATCTCTGGATCTCTTAGCCAATTTCTCCTCTCTGCTTTTGCACTAACCGAGCATGTTGTATCCCACAGCAATACCCCTCCCACCCACCTCTAAACCATGTTGTTAGCACAAAGGGTTTACTTCTGCCATTGCTGAAACAAGACCTTTTTTATACTGATGTCAACACAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGGTATGGTCTATTAGTTTTTCTAGTCATAAGCATTAGCCATGTGTCTATAAGGGGTGCGGCATGGGGCTAAGCACTTTTAGATCAAATAACAAAATGGGGGAAACAAAAACAAAAAAAAAATACATTTTGAGTT
  3   1   2       add Tad5      in                         XZT14965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCCCCTTTAAGAAGCACAAAACAAACTGTACATGGAGTTGTTCAGCGATAGCTAGACACGTACACAGTGCAGATTATATTATGGAGACTAAGATCAAAAAAATAAAATGTATAATAAGGCTTGCAGTCTCTCCCTGGCATAGGCCTTTCCTCTCTGTGTGTTTGTGTATATCTACCGAACAGATGGCACCAAGTGGAACACGTTTTCAATGTACTAAAATTCCTCTTCCTTCTTTTTCTTCCCTTGCCCACCTATTCTATGGTCTAGTATCTCTGGATCTCTTAGCCAATTTCTCCTCTCTGCTTTTGCACTAACCGAGCATGTTGTATCCCACAGCAATACCCCTCCCACCCACCTCTAAACCATGTTGTTAGCACAAAGGGTTTACTTCTGCCATTGCTGAAACAAGACCTTTTTTATACTGATGTCAACACAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGGTATGGTCTATTAGTTTTTCTAGTCATAAGCATTAGCCATGTGTCTATAAGGGGTGCGGCATGGGGCTAAGCACTTTTAGATCAAATAACAAAAGGGGGGAAAC
  3   1   2       add Int1      out                        CAAP7873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAGAAGCACAAAACAAACTGTACATGGAGTTGTTCAGCGATAGCTAGACACGTACACAGTGCAGATTATATTATGGAGACTAAGATCAAAAAAATAAAATGTATAATAAGGCTTGCAGTCTCTCCCTGGCATAGGCCTTTCCTCTCTGTGTGTTTGTGTATATCTACCGAACAGATGGCACCAAGTGGAACACGTTTTCAATGTACTAAAATTCCTCTTCCTTCTTTTTCTTCCCTTGCCCACCTATTCTATGGTCTAGTATCTCTGGATCTCTTAGCCAATTTCTCCTCTCTGCTTTTGCACTAACCGAGCATGTTGTATCCCACAGCAATACCCCTCCCACCCACCTCTAAACCATGTTGTTAGCACAAAGGGTTTACTTCTGCCATTGCTGAAACAAGACCTTTTTTATACTGATGTCAACACAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAACAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGGTATGGTCTATTAGTTTTTCTAGTCATAAGCATTAGCCATGTGTCT
  5   1   2       add HdA                            THdA051b22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTACATGGAGTTGTTCAGCGATAGCTAGACACGTACACAGTGCAGATTATATTATGGAGACTAAGATCAAAAAAATAAAATGTATAATAAGGCTTGCAGTCTCTCCCTGGCATAGGCCTTTCCTCTCTGTGTGTTTGTGTATATCTACCGAACAGATGGCACCAAGTGGAACACGTTTTCAATGTACTAAAATTCCTCTTCCTTCTTTTTCTTCCCTTGCCCACCTATTCTATGGTCTAGTATCTCTGGATCTCTTAGCCAATTTCTCCTCTCTGCTTTTGCACTAACCGAGCATGTTGTATCCCACAGCAATACCCCTCCCACCCACCTCTAAACCATGTTGTTAGCACAAAGGGTTTACTTCTGCCATTGCTGAAACAAGACCTTTTTTATACTGATGTCAACACAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAACAAAAACAAAAAAAAATGCACTGTAAATTTTTCTGTTCAGCGTATTTTAAACAGATCGATGCTACTTTCTTAAAGTCTCTCTGCCATTTCTTGTTATTTCTGAAGCAGACCCTGAGGAGAGATAGCATGGTATGGTCTATTAGTTTTTCTAGTCATAAGCATTAGCCATGTGTCTATAAGGGGTGCGGCATGNGGCTAAGCACTTTTAGATCAAATAACAAAATGGGGGA
  5   1   2       ext Brn3      in                         CAAK2259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 NNCGTCCGGGACATCNGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTTAAAAAAAAAAAAAAAA
  3   1   2       ext Brn3      in                         CAAK2259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGGCGAAATGGGAGGCCTCTATCACACAGTGATGTCACTAGTGGATTCTATGATGTCAGTGATGGACGGCTGGAACTGTAGGAAGAAGGAGGACTGCTGTCCCCATTGTAGCTGCCTTGTCTGCAGAAATCCCCGTTTTTTGTAAATGAACAATTT
  5   1   2  SIG                                     Xt7.1-CABI14225.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCTTTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008277498                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACTGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTxxxTxCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTxxTTTTTTxxTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGAxxxxxAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg                            TEgg140h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCGATCCGATTCCTTCGGCCAGCATCTTGGAAGTGAACTCAGAGACTGAAAGATCCAAATCTTGTGATGAGGGACTTGATGACTACTAGGACGAGGGGAAACTAAGCCTGAAGCAAGGTTCCAGCCTTAGAGGAATCAAGGCAAGAGAAAATGTGCCGTCGTCCGAAGACTCTGAATCCAGGAAAGATTCCTCCTCTGACGGCTTCAGTGACTCAAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGATAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGGTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAACGACAAGAAAGAGCACAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTGTAATACATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACGACATCCGACCGTGAATTCCTCTTTCTAGCAGAAGATCGAGATGATATGATATCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCCCGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCT
  5   1   2       ext Te3       in                        CAAM16194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATAAGGAAGGCTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGT
  5   1   3        nb Te4       in                         CAAN2881.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTCTGTATTTTCGGCAGCTTACTACTGAGAAAGGAAAGAGAGTGAGCGGGAGCATGCGGCCCTGGAAACAGATGTACGTTGTCTTGCGTGGCTCAGCGCTGTATTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTG
  5   1   2       ext Gas       in                   TGas051k13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTTTTTGCAAAAGGACAAGAAAGAGCAAAGCGGCCATTCCTCAGCGCAGTCTGACGAGGAGCAGCTAATAGGCATAAATGGATGTTTAATAGATATATCATACAGTGAAACCAAGAGAAAGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCAAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTT
  5   1   3        nb Brn3      in                         CAAK7110.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAATGTGTTCCGTCTGACAACATCCGACCGTGAATTCCTCTTTCGAGCAGAAGATCGAGATGATATGTTAGCTTGGATTAAAGCTATACAGGAAAATGGCAATCTCAATGATGAGCAAACCGATCAAGCAAGCAGAGTGCTTATTAGCAAGAGAATCAAAGAATATAATACAATGATGAGCTCCTCCAGCAACAAATCTGAACAGTCTCCAAAACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAA
  5   1   3        nb Neu                            TNeu133l09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACAAATACTGAACAGTACTCCAATACCGTCACGGCAGACTTTGAGCATCCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAGAGAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAATAAAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAGATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTG
  5   1   2       ext Gas       in                   TGas102b17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGCAGCCATTCCGTGCCACTAAACCCGAAGGCAGGCTTCAAAGGGCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTGGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCGCGGCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTATAGAAGATAGAGGGGTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCGAGAAGAGCTCAACAAAGGAGGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTGATAAGCAGTCTACTGAAATCCTTTTTTCCGGAGATTGCCAGACCCTCTGTGCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAGAACTCTAAAAAGACTGAGATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCT
  5  -1   3        nb Egg                            TEgg135m04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTAAACCCGAAGGCAAGCTTCAAAGTCCCCACTCTCCAAAACAGGAATCTGAGAGAAGGTTGTTCAGCAAAGATGATATTAGTCCACCTAAAGACAAAGGCTCATGGCGAAGAATCATGAAAAAGCCCTTTGAGAAAAAGCCAACCACTGGTGGGACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Brn3      in                         CAAK7110.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTTTGGTGTGAGGCTGGATGACTGCCCCCCTGCTCACAACAACAAGTATGTCCCCTTGATAGTTGATGTATGTTGCAAGTTAGTAGAAGATAGAGGGCTTGAAACCACTGGTATCTATAGAGTTCCTGGTAACAATGCTGCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGTCCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGC
  5   1   3        nb TpA                            TTpA009d20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACA
  3  -1   0       chi Lun1      in                        CABD14313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGCAGTGATTTGCCAAAGGCAGGCTCTGAAATACGACGTGAAAGTGAAATTAGGGCTTTTGCGTCTTGGGACTCAGGTTTTCAAATGCACAAGCCAAATGAGATCAGCATGAATGTTTAGTGCCTCTGTTTAGGATATAGAATTATGTAGAACAACCCTAACCCCCCCCCCCCCCCCCCAATAGATCCTTGTTCTTTGAACAGGTCTTTAAATGTCAGTGTCTCTGTTTTTATTTTGAAGAACAGGGTTCCTTGCCATTCCTATCATTGAGCTGGTTCTGCCTACAATTCACAGCATCCTTTCATGGCGGTGGCTTTCTGTGGTGCAGCTTGCATCTTTGTGAGCTATAACTATCCCCTTTGTTTTCTTTTGCTTTGACACATTTTGTTCTGTGCTTGTCCTTTCCATGATGCGCAGCATTAGTTGTTACTGTAGTGCCTTCTGCCTTTGTGTGACATTTACCCTTTATCTTTTGCTTCTTCACAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCA
  5   1   3        nb Gas8      in                          st20c20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTA
  5   1   2       ext HdA       in                  THdA026d14.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCCAATGGAAGAAAGCATGTCTGACTCANGAACTATGCTTAGCACTTCATCCCAAGCCTCTGC
  5   1   2       ext Egg       in                   TEgg060l19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGTCCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAA
  5   1   4      seed Ovi1      in                         CABI4794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCANAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTA
  5   1   3        nb Ski1      in                         CABJ1113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCANAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGC
  5   1   3        nb Neu                            TNeu138a13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAACATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCGTCCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCGATTACTCTACAACATCATCAAC
  5   1   2       ext Brn3      in                         CAAK5575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCGTTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACTGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCANAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGAC
  5   1   3        nb Te5       in                         CAAO4730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTGGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAA
  5   1   3        nb Gas       in                   TGas102b11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAAGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCGTTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACTGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCGTTGCT
  5   1   2       ext Egg       in                  TEgg074c19.p1kSP6v                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCGTTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACTGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTC
  5   1   3        nb Eye       in                         CCAX2234.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCAATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAG
  5   1   3        nb Int1      in                        CAAP13714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTANAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGGAACGTTTACGTACTAGCACATCTGAACT
  5   1   2       add AbdN                               IMAGE:7023316                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGANACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGGCTGGGAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAAGCCAAGTGTCCTTCTTCAGGACTCTTCATTTTCCCGACTGGCTTTGCCCCGGGAANCGTTTTAACGTACCTAAGCACCATCTTGAA
  5   1   3        nb Neu                            TNeu101h03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCACTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAACGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACAT
  5   1   3        nb Te3                                  CAAM2423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATCAGCCCACAGGTCCAGTCTGTGGCAGAAAGCAAAGGAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACTGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGA
  5   1   3        nb Gas7      in                         XZG35778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAGGAAGCCGATGATGAGAGAAGTGAACTTATTAGTGAGGGCCGGCCAATGGAAACTGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCGTTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCGACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCCGCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTG
  5   1   3        nb Eye       in                         CCAX2624.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGGATAGTGAAAATGACTTCCCCATATTTGCTTCAAGCATTGCTTTCGACAGGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCT
  5   1   2       ext Liv1      in                        CAAR13203.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTA
  3   1   3        nb Egg       ?                     TEgg022f08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCTTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCAAAAAAAAAAAAAAAAAA
  5   1   2       ext Ovi1      in                        CABI14225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTC
  5   1   2       add In66                            IMAGE:8963024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTGTTCTGCTGAGAGCAAAAACTGATGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCTCACAGTTGCAGTGAATAGCTTCTAGTGATTACATGTATATCTTGTGCCTGAACTTTATTTGTATTTTTTTTTTTCAGCTTTTAGGCTGGATTCATCATAGCCTGTGACGTCTCACAGGAGCTAGCTGCAGCCAGACGACCATGTCATGACGGACTACCTGCTCGATATTTTGTTTTTCCCCTTTTGAATGCAGT
  5   1   3        nb Brn2                                CAAJ24057.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCGACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGG
  5   1   3        nb Egg       in                   TEgg024d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTAC
  5   1   3        nb Neu                            TNeu017p21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCGACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTNTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTA
  5   1   3        nb Neu       in                   TNeu073h07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAA
  5   1   3        nb Ova1      in                         CABE2548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAAC
  5   1   3        nb Tad5                                 XZT37334.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCTGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGA
  3   1   3        nb Te3       out                        CAAM5515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTAC
  3   1   3        nb Eye       in                         CCAX2624.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACAC
  5   1   2       ext Brn1      in                          CABL603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAA
  5   1   3        nb HdA       in                  THdA027m05.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCCGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGAATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAAC
  5   1   3        nb Gas7      in                         XZG61781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGGAAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCATTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATA
  5   1   3        nb Tad5      in                         XZT60586.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTA
  3   1   3        nb Te3  5g3  out                        CAAM1503.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACAC
  5  -1   2       add Lun1      in                        CABD14313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGG
  3   1   2       ext Egg       in                    TEgg074c19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTTTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTTTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCAGGTAAAAACACTGGAAATAAAAGTCTTTGGTGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas       in                    TGas051k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCAATTCGAGAAAAAAA
  3   1   2       ext Ovi1      in                        CABI14225.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTCAGCCCTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  3   1   3        nb Te5       in                         CAAO4730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTCNAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGG
  3   1   3        nb Egg                             TEgg049f04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACCGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAGAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGAAAGAACACTGGAAATAAAAGTCTTTGGTGATCAACAAAAAAAAAAAAAAAAA
  3   1   3        nb Te3       out                        CAAM1973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCATTCATAGGCCCTGTGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATG
  3   1   3        nb Te3  FL   out                       CAAM16400.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATG
  3   1   3        nb Gas7      in                         XZG61781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCATTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCTTTT
  3   1   3        nb Brn2 5g3  out                       CAAJ11850.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  3   1   2       ext Liv1      in                        CAAR13203.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGG
  3   1   3        nb Ski1      in                         CABJ1113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATG
  3   1   3        nb Brn2      out                       CAAJ17030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  3   1   2       ext Brn3      in                         CAAK5575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCTTT
  3   1   3        nb Brn2      out                       CAAJ24058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGAT
  3   1   2       ext Brn1      in                          CABL603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTNTTTTCTCTTTTNTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  3   1   3        nb HdA       in                   THdA027m05.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTTTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTTTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTTTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGAAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Int1      in                        CAAP13714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAG
  3   1   2       ext Egg       in                    TEgg060l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCAACAAAAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                         XZT60586.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAAAAAAAAAAAAAAAGG
  3   1   3        nb Neu       in                    TNeu073h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAGTCTTTGGTGATCTTTAAAAAAAAAAAAAAAAA
  3   1   4      seed Ovi1      in                         CABI4794.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATTGACAGAATTAACTGTTTTGTTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATC
  3   1   2       ext HdA       in                   THdA026d14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATTGACAGAATTAACCGGTTTGTTTTTTTTTGGTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATTTGAACAATTAATTTGGAGATAAATTTTTTTTTGTACACACTGCTAGTCGTGTTTGGTACTTCATTATTTGCCACTATAACACCCATCCTTTTGAGTTAGCTCCAATGTCAGGGATTTGCAGCCTGAGTTTTTACCCAGAATCCCTTGCTAGGTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGGTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTTTGAATTCATCCGGTTCGGTAGGGGGCCATATTGTTACACGCTAATTTGGGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTTTGTAACGTTTGATCCGTGATCCATTTTTGTCCAGTTTTACAGATTTTAACAGGGGGATTTCGAGGTTCCATTCCTACGCATTCCAGTCAGATTTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTTTGTAAGATACAGTAACTTAAATGTATATACTAAATGGGTATTTTTTTTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTTTTTTATTGCAAAGGAATATAATTTTGCATGAAGTCCCAATAAAATTTTGTACCATGCCTGTGGGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTTTTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3  -1   2       add TpA       in                   TTpA049g04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTTTTGCTTGTTATAATTTTTTTTTAGTGGAAGTTCCCACAAAATCTGAACCATTAATTTGGAGATAAATTCTTCTTTGTACACACTGATAATCGTGTTTGCTACTTCATTAACTGCCATTATAACACCCATCCTTCTGAATTAGCTCCCATGTCAGGGATCTGCAACCTGAATCTCTACCCAAAATCCCTTGGAAACTGTTTTCCTATTAAGGGATGATGGGAGTTTCCCCGTTGGGAAAACCAAGCGCTTTAAATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCGTCCGGTTCGCTAGGGTGCCTTTTTGTTACACGCTAATTCGAAAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGAGAACCATTTTCCTCCATTTTTAAAAATTTTAACAGGGGGATTCCCAACTTCCATTCCTACCCTTTCCAGGCAGATCTCCCAGTTTTATACCCAAACTTTTAAAACCGCTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGAAAGAAACACTCACTTAAATGTATATACGAAAGGTGTGTCTTTTCTTC
  5  -1   2       add TpA       in                  TTpA049g04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTGCCAGTTTATTGCCATGGAATGTATTCCGCTAAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTATGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGGTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCAAGTAAAAACACTGGAAATAAAAGTCTTGGT
  3   1   3        nb Ova1      in                         CABE2548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  3   1   3        nb Gas8      in                          st20c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTTTTTTTNGTTTTTTCTCNTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTNGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACG
  3   1   3        nb Gas       in                    TGas102b11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGAAAAAAAAAAAAAAAA
  3   1   3        nb Te3  5g3  out                        CAAM7918.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTTNTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCTTT
  3   1   3        nb Brn2 5g3  out                       CAAJ20335.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCTTT
  3   1   3        nb Gas7      in                         XZG35778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCTCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTTGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGG
  3   1   2       ext Gas       in                    TGas102b17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGAAATAAAAAAAAAAAAAAA
  3   1   3        nb Te3       out                        CAAM5044.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  3   1   3        nb Te3       out                         CAAM752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  3   1   2       ext Te3       in                        CAAM16194.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  5   1   3        nb Tad5                                 XZT45064.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Sto1      in                         CABG9694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTG
  5   1   3        nb Sto1      in                         CABG9694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg024d07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTTTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGGAAAAAAAAAAAA
  3   1   3        nb Te4       in                         CAAN2881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGAATCCCTTGCTAGCTGTTTTCCTTTTAAGGGATGATGGGAGTTTTCCCGTTGGGGGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTTTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTTCCCGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTTGTCCAGTTTTACAGATTTTAACAGGGGGATTTCGAGCTTCCATTCCTACGCATTCCAGTCAGATTTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACCGTAACTTAAATGTATATACTAAATGGGTATCTTTTCTTCAGATACCCGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGGGAATTGGTTTCTTTTTTTGCAAAGGAATATAATTTTGCCTGAAGTCCCAATAAAATCTTGTTCCATGCCTGTGGGCAGCCCCCCCCCGTAAAAACCCTGGAAATAAAAGTCTTTGGGGG
  5   1   3        nb Gas                            TGas027f20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAACCCCAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGG
  5   1   2       ext Tad5                                 XZT43032.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAAAAACCCAAAAAAACGTTAACTGTGAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGTGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTATCTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACACCCACGTAAAAACACTGGAAATAAAAGTCTTTGGTGATCTTTTTTTTTTTTTTTTCCATAAATACATTTATCTTGCCCTTTATTCCCAGTAACCAGAAAGGAAGGAAGGAAGTTAAGGACAGTGGCACGTAGGTGGATTATGACATTTAACCCTGCATGTTTTTTTAGGAGCCCAAACAAATAGAAAAACACCCAAATTCACATTGTCCCCCATATCTTGCCTGAAATCAATAAAGGGGAACTCTACCCAAACGCAACTT
  3   1   3        nb Eye       in                         CCAX2234.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGGGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTTTGTAAGATACAGTAACTTAAATGTATATACTAAATGTGTTTTTTTTCTTCAGATACCAGATTTGATATAAATGTTGTACAATAGGCATGTAGATAGTGAATTGGTTTCTTTTATTGCAAAGGAATATAATTCTGCATGAAGTCCCAATAAAATCTTGTACCATGCCTGTGAGCAGCACCCCCACGTAAAAACACTGGAAATAAAAGTTTTTGGTG
  5   1   2  SIG                                      Xt7.1-CAAM7034.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGTCCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCGTTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGCAGAAAGCAAGGAGAGGAAGCCGATGATGAGAGAAGTGACTTATTAGTGAGGCCGGGCCATGAAACTGATAGTGAAATGACTTCCCATTATTGCTCAGCGTTGCCTTCGACGCACATCGAACTATGGAGAGCCACGAGATGTTCAGTGAAACTCGAAAGAAAGTTCT------------------------CACGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGT
                                                  Xt7.1-CHK-1008277502                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGTCCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCGTTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGCAGAAAGCAAGGAGAGGAAGCCGATGATGAGAGAAGTGACTTATTAGTGAGGCCGGGCCATGAAACTGATAGTGAAATGACTTCCCATTATTGCTCAGCGTTGCCTTCGACGCACATCGAACTATGGAGAGCCACGAGATGTTCAGTGAAACTCGAAAGAA------------------------TTTCGACACGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACAC
  5   1   4      seed Gas7      in                         XZG39451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTATATCTAGCATGCAAGAAGAGCTCAACAAAGGAAGCACAGACATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGTCCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGTATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCATGCACTTTCATAAA
  5   1   3        nb Te5       in                        CAAO10126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTGATATCCAAGATGATAAATGGCGTGACCTGAATGTAATAAGCAGTCTACTGAAATCCTTTTTCCGGAAATTGCCAGACCCTCTGTTCACTAATGAAAAGTACAATGATTTTATTGAAGCAAACAGAACGGAAGACCCAGTAGAACGACTGAAAACTCTAAAAAGACTGATATTGGATTTACCAGACCATCATTATGAAACACTTAAATACTTGTCTGCACATCTGAAGGCCGTGGCAGAGAACTCTGAAAAAAACAAGATGGAACCCCGAAATTTGGCGATCGTGTTTGGACCAACACTTGTTCGGACATCGGAAGACAACATGACGCACATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCCTGAAGCTCATGCACTTTCATTAAAAGATGCTGATCACATTAA
  5   1   2       ext Te3       in                        CAAM15761.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGGTCACACACATGCCTGACCAGTACAAAATAGTGGAAACCCTGATTCAGCAACATGATTGGTTTTTCAGTGAAGAAAGTGCAGATGAGCCAATTACAGCTGTACAGGAGGAAAGCACAGTAGAGTCTCAGCCAGTGCCAAACATAGATCATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTANCACATCATCAACTATATACATCGTTGGGGTAGACCAAAATCTGATCAGCCC
  5   1   2       ext In63                            IMAGE:8959674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAGGATACATTTACTCCCCAACATTGGAAGGACTGGACTTTCTCCAGGAGACGTATCAGATTCGGCTAGTGACTCGGCAAAATCTAAGGGTTCTTGGGGCTCTGGGAAAGATCAGTATAGCAGAGAGCTGCTAGTGTCTTCTCTGTTCGCTGCAGCCAGTCGCAAGAGAAAGAAACAAAGGGATAAACCCCAGCCAAGCAGTTCAGAAGATGAGCTTGATAATGTATTTTATCAAAAGGAGCTATTGCAAGTAGAGTTTCAGAGGCCAGACAAACAAAATGTTGATAAGGATGTGGACCTGAAAGCCAATGCACTTTCATTAAAAGATGCTGACAACATTAAGGGCACAAATATAATTAAGGAAGATAAGCTAGAAAAAGACATAATGCATTCTGAAGCCACTTCTCCTTGCCCCCCAAAGCTTTCAGAACCCCCTATAGTGAATCATAGGCTACCACCAGATGACAAAAACATCCCACAAATAAGCTTCCAAATGGAAGAAAGCATGTCTGACTCAGGAACTATGCTTAGCACTTCATCCCAAGCCTCTGCGCAAAGGTCAAAACCCAAAGTGGTTAGTCCTGAATTGAAAGGCAGTGATTTCCTAACAGCGGATGTGAGCTCCATCACCTCCGATTACTCTACAACATCATCAACTATATACATCGTTGGGTTAGACCAAAATCTGATCAGCCCAGAGGTCCAGTCTGTGCAGAAAGCAAGGAGAGGAAGCCGATGATGAGAGAAGTGACTTATTAGTGAGGCCGGGCCATGAAACTGATAGTGAAATGACTTCCCATTATTGCTCAGCGTTGCCTTCGACGCACATCGAACTATGGAGAGCCACGAGATGTTCAGTGAAACTCGAAAGAAAGTTCTGCTG
  5   1   2       ext Te3       in                        CAAM14191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTTTCGACACGCAACATCGGAGCAAAGTGGAAGAGCCAACGAGGAATGTTCAAGTGAACTCAGAAGGAAGTCCCAGCTGCACAGAAGGGAGTATAACTCCAAGGATGGACAGACGAAGATTTAGCTCTCATAAACTTATTGAATGTGACACTTTATCGAGAAAAAAATCCATACGACAAAAGACAGATAGTGAATGTTCTGCTGAGAGCAAAAACGAGGAAACCCTGTCAGATGCGCAGGAGGCGGTGAAGAAAGGTAGGTCCCTAAGCATTGGGGACACCACAACCAATAATGAGCCTGAAGAGCCGGCCTGGAGAATTAAGATAACAGAGAGGCTGAAACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGACAGCGCCCCGCCTGACGA
  5   1   2       ext Te3       in                        CAAM14247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACTGCGCCTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGGTTTTTTCTCTTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAG
  3   1   3        nb Te3  5g3  out                        CAAM7034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTAAAGCATCTGCAGATGACATGTTTGGAATAGGAAGTCAAAAAGCACAGGCTGCCGAGACCCGAAAGAAGAAAAACATTCGGAGGAGGCACACACTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCGACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCCGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACAC
  3   1   2       ext Te3       in                        CAAM14191.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGCACACACTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTAC
  3   1   3        nb Te5       in                        CAAO10126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTAC
  3   1   4      seed Gas7      in                         XZG39451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGGGGGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTGGGAGATAAATTCTTCTTTGTCAAAAAAAAAAAAAAAAGG
  3   1   3        nb Te3  5g3  out                         CAAM469.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACAGAGAGACTTTGCTGAAATCAGCGTTTTAAATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACAC
  3   1   2       ext Te3       in                        CAAM15761.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGCTTGGAAAATCAATGAGCCAAGTTCTAAGGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTCTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACAC
  3   1   3        nb Te3  5g3  out                        CAAM4356.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAGCTGAACTTTCTGCTGTGGATCGCTTGAAGCCAAAGTGTCCTTCTCAGGACCTCTCCATTTCCGACTGGCTTGCCCGGGAACGTTTACGTACTAGCACATCTGAACTCAGCATGGTGGAACCTGAAGAGAAACGCATTAGTGACGCCACCAGTCAGAAGGAGCCAGCCTCTCCCAGTCCTCCGCCGGCATCATCTCCCTCCCAAGTAAGCACAGCCATCGTTACTGCTGGAAGCGAAAGCCCATCCCAAGGAACAGCGCCCCCGCCTGACGATCAAATGAACGGCGACAGCTTCCAGAGCAAAAACAAAAACAACTTCAGTCCTGCTGTCGATGCCCACCCCCATAAACTCTTTGGTACTCAAGTCGTCAGATCTCGATTTTACCAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTTTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTAAGGGAAGTTCTCCCAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGT
  3   1   2       ext Te3       in                        CAAM14247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTACCTTTAAAGGCTCCCCACAGTTGCAGTTGAATAGCTTCTAGTTGATTTACATGTATATCTTGTGCCTGAACTTTATTTTGTATTTTTTTTTTCAGCCTTTTTAGGGCTGGATTCATTCATAGGCCCTGTGGAACGTCTTCACAGAGCTTAGCTGCAGCCAGACGAACATGTCATTGACAGAATTAACTGTTTTGTTTTTTTTTGTTTTTTTCTCTTTTTTTTAATGGAAGTTCTCACAAAATCTGAACAATTAATTTGGAGATAAATTCTTCTTTGTACACACTGCTAGTCGTGTTTGCTACTTCATTATCTGCCACTATAACACCCATCCTTCTGAGTTAGCTCCAATGTCAGGGATCTGCAGCCTGAGTCTCTACCCAGAATCCCTTGCTAGCTGTTTTCCTATTAAGGGATGATGGGAGTTTACCCGTTGGGAGAACCAAGCGCTTCAGATCCCTGGCCCCAAGTAAAAGTGCCTCATTCTGAATTCATCCGGTTCGCTAGGGTGCCATATTGTTACACGCTAATTCGAGAAAAAAAAACCCAAAAAACGTTAACTGTGAAACAAGTCTGTAACGTTTGATCCGTGATCCATTTTCGTCCAGTTTTACAGATTTTAACAGGCGGATTCCGAGCTTCCATTCCTACGCATTCCAGTCAGATCTCCCAGTTTTATACGCAAACTTTTAATACCGTTTTGAGTTTTATGTGACTTGAATTTTTAATCTTTCTGTAAGATACAGTAACTTAAAGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)