Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 88%

 1012073037 Xt7.1-IMAGE:7028930.5.5 - 63 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths      2     2     2     2     4     4     7     7     7     8     7     8     8     9     8     9    26    27    26    27    35    38    38    41    39    42    43    47    44    47    46    49    46    49    46    49    47    49    48    51    48    51    47    52    49    53    49    53    49    53    48    52    48    52    49    53    50    54    50    54    50    54    54    58    54    58    56    61    56    61    56    61    57    62    55    62    57    62    57    62    58    61    56    61    56    61    57    61    57    61    57    61    53    61    57    61    48    60    47    56    47    51    46    49    36    44    17    33    17    25    17    21    17    20    17    20    17    20    17    20    13    20    13    20    13    20    13    19    12    18    12    18    12    17    13    17    12    17    12    17    12    17    12    17    12    13     6     9     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     5     5     5     4     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATGAACAATCCATCTCTGGGGGCAACAGGCTGCTGCACCAAGGGAACCCACCAACCTTCAGTTTTAGCTCCTCTGTATTTATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGTTTGAATATACTTCCCATAAACAGGGAATGCAATAAAAATCATT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------TA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                               BLH ATG     125     371 
                                               BLH MIN     125      42 
                                               BLH MPR     116      42 
                                               BLH OVR     125      90 
                                               CDS MIN     125      64 
                                               EST CLI      94      64 
                                               ORF LNG     125       1 
                                                                                                                                                                                                 PROTEIN --- Ce ---- 1e-019     NP_491127.1 thioredoxin-like protein (31.1 kD) (1D801) [Caenorhabditis elegans] =========================================================================================================================================================================================================
                                                                                                                                                                                           PREDICTED - Sp ==== 9e-022     XP_787070.1 PREDICTED: similar to Thioredoxin (ATL-derived factor) (ADF) (Surface associated sulphydryl protein) (SASP) [Strongylocentrotus purpuratus] ==========================================================================================================================================
                                                                                                                                                                                                       PROTEIN --- Bb ---- 2e-023     AAK72483.1 thioredoxin [Branchiostoma belcheri] ===================================================================================================================================================================================================================================
                                                                                                                                                                                                 PROTEIN === Dm ==== 4e-022     NP_523938.2 CG5495-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================
                                                                                                                                                                                                    PROTEIN === Mm ==== 2e-023     NP_035790.1 thioredoxin 1; thioredoxin [Mus musculus] ==========================================================================================================================================================================================================================
                                                                                                                                                                                                    PROTEIN === Sc ==== 2e-024     NP_011725.1 thioredoxin; Trx2p [Saccharomyces cerevisiae] ======================================================================================================================================================================================================================
                                                                                                                                                                                                    PROTEIN === Hs ==== 8e-025     NP_003320.2 thioredoxin [Homo sapiens] ==================================================================================================================================================================================================================================================
                                                                                                                                                                                                    PREDICTED = Dr ==== 9e-026     XP_695692.1 PREDICTED: similar to Thioredoxin (ATL-derived factor) (ADF) (Surface associated sulphydryl protein) (SASP) [Danio rerio] ==========================================================================================================================================
                                                                                                                                                                                                    PROTEIN === Gg ==== 3e-028     NP_990784.1 thioredoxin [Gallus gallus] =================================================================================================================================================================================================================================================
                                                                                                                                                                                                    PROTEIN === Xl ==== 2e-047     AAH84818.1 LOC495354 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================
                                                                                                                                                                                                    PREDICTED = ?? ==== 2e-047     NP_001088487.1 hypothetical protein LOC495354 [Xenopus laevis] =============================================================================================================================================================================================================================
                                                                                                                                                                                                    PREDICTED = Xt ==== 6e-056     NP_001011127.1 hypothetical LOC496541 [Xenopus tropicalis] =================================================================================================================================================================================================================================
                                               Xt7.1-IMAGE:7028930.5.5               TAG------------------------------------------------------------TGA---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TGA---------------------------------------------------TGA------------------------------TGA---------------------------------ATGTGA---------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TAG---------------------------------------------------------------------------TAG---------------------------------------------------------------------------TAG---------------TGA---------ATG------TGA------TAA
                                                                   ORF                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                      ]
  3   1   3        nb Sto1      in                         CABG6799.3p                                                                                                                                                                                                                                                                                                                                                                                  CTGGCAAACAGGTGGAGCGGTTCAGTGGTGCTGATATAAAGAAACTGAAAGAAACAATCAAAAGGTTATGCTGAATCATCATTGCTTACAAAATCTTTAAAAACATATATTTTTTTCTATTATTCTGAAAAGACCTGATTTCTTACAAAAATAATGCATGACTTACAGTCTACCAAGCATCTAAACTGAATCTAATGTGATTTTTAATACTTTTTGTACAACAGACTTTATGTGCAACTACTGCTGCAATAAAAGCTCTACACATACAAAA
  5   1   3        nb Sto1      in                         CABG6799.5p                                                                                                                                                                                                                                                                                                                                                                                  CTGGCAAACAGGTGGAGCGGTTCAGTGGTGCTGATATAAAGAAACTGAAAGAAACAATCAAAAGGTTATGCTGAATCATCATTGCTTACAAAATCTTTAAAAACATATATTTTTTTCTATTATTCTGAAAAGACCTGATTTCTTACAAAAATAATGCATGACTTACAGTCTACCAAGCATCTAAACTGAATCTAATGTGATTTTTAATACTTTTTGTACAACAGACTTTATGTGCAACTACTGCTGCAATAAAAGCTCTACACATACAAAA
  3   1   3        nb HeRe      in                     EC2CAA46AA09.b1                                                                                                                                                                                                                                                                                                                                                                                   GGGCAAACAGGTGGAGCGGTTCAGTGGTGCTGATATAAAGAAACTGAAAGAAACAATCAAAAGGTTATGCTGAATCATCATTGCTTACAAAATCTTTAAAAACATATATTTTTTTCTATTATTCTGAAAAGACCTTATTTCTTACAAAAATAATGCATGACTTACAGTCTACCAAGCATCTAAACTGAATCTAATGTGATTTTTAATACTTTTGTACAACAGACT
  5   1   3        nb HeRe      in                     EC2CAA46AA09.g1                                                                                                                                                                                                                                                                                                                                                                                    GGCAAACAGGTGGAGCGGTTCAGTGGTGCTGATATAAAGAAACTGAAAGAAACAATCAAAAGGTTATGCTGAATCATCATTGCTTACAAAATCTTTAAAAACATATATTTTTTTCTATTATTCTGAAAAGACCTTATTTCTTACAAAAATAATGCATGACTTACAGTCTACCAAGCATCTAAACTGAATCTAATGTGATTTTTAATACTTTTTGTACAACAGACTTTATGTGCAACTACTGCTGCAATAAAAGCTCTACACATAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tbd1                                 CBXT1240.b1                                                                                                                                                                                                                                                                                                                                                                                                   CGGTTCAGTGGTGCTGATATAAAGAAACTGAAAGAGACAATCAAAAGGTTATGCTGAATCATCGTTGCTTACAAAATCTTTAAAAACATATATTTTTTTCTATTATTCTGAAAAGACCTGATTTCTTACAAAAATAATGCATGACTTACAGTCTACCAAGCATCTAAACTGAATCTAATGTGATTTTTAATACTTTTTGTACAACAGATTTTATGTGCAACTACTGCTGCAATAAAAGCTCTACAC
  3   1   2       add HeRe 5g3  in                     EC2CAA43DH06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAAAAGGTTATGCTGAATCATCATTGCTTACAAAATCTTTAAAAACATATATTTTTTTCTATTATTCTGAAAAGACCTTATTTCTTACAAAAATAATGCATGACTTACAGTCTACCAAGCATCTAAACTGAATCTAATGTGATTTTTAATACTTTTTGTACAACAGACTTTATGTGCAACTACTGCTGCAATAAAAGCTCTACACATACAAAAATGTTTAAATGTGTCAGTTTTTAGACTAAATTGTTTGATCTTTAGTGCATGTGTGGGTCCAAAACCCAAAGAGAAATATATATGAACAATCCATCTCTGGGGGCAACAGGCTGCTGCACCAAGGGAACCCACCAACCTTCAGTTTTAGCTCCTCTGTATT

In case of problems mail me! (