Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM7091.5                            8 END     5           3       83                Unknown (protein for MGC:145416) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012073165 Xt7.1-TTpA026a15.3.5 - 129 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA026a15.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTAACACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAACGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
                                                  Xt7.1-CHK-1008222622                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAACGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAxAxxACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTxxxxAGCCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     6     6     6     6     6     6     7     7     8     8     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     8     9     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    10     9    10    10    11     9    10     8    10     9    10     8     9     7     9     7     9     7     9     7     9     7     9     7    11     7    11     7    12     7    12     7    12     8    12     8    12     8    12     8    12     8    12     7    11     7    11     7    11    11    11    11    11    11    11    12    12    13    13    13    14    13    14    13    14    13    14    13    15    13    15    13    15    13    16    12    14    12    13    12    13    11    14    12    14    12    14    12    14    11    14    11    14    12    14     8    13     8    13     8    13     8    12     9    13     9    13    10    14    10    14    10    14    11    15    11    15    10    16    11    16    11    16    11    15    11    15    11    15    11    15    11    15    14    19    14    19    14    19    15    20    17    21    17    21    17    22    18    23    19    23    19    23    21    24    20    22    21    23    20    23    21    22    22    23    22    23    22    23    21    23    21    23    21    23    21    22    20    21    18    21    20    21    19    21    18    22    19    23    21    23    19    20    19    20    18    20    17    19    17    19    17    19    19    21    19    21    19    21    18    21    19    21    20    22    21    23    21    24    22    24    22    25    23    26    23    25    23    26    24    27    24    29    24    30    25    31    28    32    30    35    31    35    34    40    36    39    35    38    32    35    31    35    31    35    30    35    29    35    28    34    28    34    29    35    28    36    29    37    31    40    32    42    34    44    34    45    37    48    39    51    39    51    39    49    39    50    39    50    40    51    42    52    42    54    44    60    44    59    46    61    46    63    44    63    46    64    46    65    43    63    44    64    46    66    47    66    47    67    45    66    48    69    48    69    46    69    47    71    49    71    47    71    49    71    51    71    49    72    47    72    49    72    48    72    49    72    49    72    46    70    41    67    37    57    37    58    36    58    36    58    33    50    33    50    28    49    27    48    28    48    26    48    31    46    24    46    27    47    27    47    25    47    27    49    27    49    27    49    27    49    24    46    24    46    24    46    24    46    20    45    21    44    20    44    13    34    16    31     8    17     8    15     8    14     8    14     8    13     8    13     8    13     8    12     8    12     8    12     8    12     8    12
  5   1   2  SIG                                    Xt7.1-TTpA026a15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATTTAACACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAATGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAO7742.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACAACACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCTCTGAAAACCTCTCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCTCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGACAATTAAGTGAAGAGATTGCTGACAGACATCTACTTGCAGATCTAGTCCAATTGTGGGGAACGAGCTTACTCGAGACCTCAGACGTGGTGTGAAAAGTGCAGCTTAGTCTTATGGACATATGTGCATCAGTGGAGAACATATGTGGCCTCAATGTGGTGAATCAATAGGGGTGATACT------------GAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTT
  5   1   2                                           Xt7.1-ANHP1637.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTCCCCGGAGAATTTGTATCAAACTGGAAACACTGGTGTCCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTT------------------------------------------------------------------------------------------------------------------------------------------------CTTGCATTACTTTCTCCCTGAAGGGCAGTATGGGTACACAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-XZG35833.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAACTATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTATATATGTTTTGTGTGTTTACTCGCACAGGCTGCTTTTAGAGAACAGTTAGAAATGCTTACAAAACTAGTTAGGTTATAGACAGAGGAATTTCTACTGTAAAAAGTCAACAAAAAACAAGATATTTTTCAGTGTAAGTGGTGGCTGATTTGCTTTGCTCAGCCAGCAGCAATAAAATGAATGAAAGCAAAAACCTGGTTGGTTGCTGACATTTTTTTACTACTAGGTAAAAATCTGAGCTGTGTTAGTAACCAAGCCCAAGACTGTTTAGCAATGTGATGTACCCATGCCTGAACATGCATTAATTTCATAAATATGCTTTCAACTGCAACACTGAGGAGGATGCAAGGCTATTTTATTCAAAGTTAAAAGGCTGTCACCTTTTTGTGTGAAAACAAAATAAGGTATTGGACTAGCTGTGAACCTGGCCAGACATGGAAGGAGCATCTGCACCAAGAGAAGGAAGTTTGTTGGAAGTGGCTGCATTTGTTATAGTGCTATGTCATATTACAAGAGTGCCCTCTGCTGTTCTGTTCAGTGCAGGAAAGGTACAGCCAGAACAGCAAAAGTTGAAGTTATTGATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACAAGAACACCACCGGGCAGACCAGCCCCAAATTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCTGCTTTTAGAGAACAGTTAGAAATGCTTACAAAACTAGTTAGGTTATAGACAGAGGAATTTCTACTGTAAAAAGTCAACA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------G--T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     A-T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bb ---- 4e-013     BAC06835.1 Bb-cadherin [Branchiostoma belcheri] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                    PREDICTED - Bf ---- 3e-019     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 4e-031     BAB40596.1 Ci-META1 [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 6e-046     NP_610575.1 CG12908-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 5e-051     NP_506228.1 NIDogen, basement membrane protein NID-1 (174.4 kD) (nid-1) [Caenorhabditiselegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 2e-060     XP_791550.2 PREDICTED: similar to nidogen (enactin) [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 5e-143     XP_699006.1 PREDICTED: similar to nidogen 2 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_032721.2 nidogen 2 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 0          XP_421471.2 PREDICTED: similar to osteonidogen [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_031387.2 nidogen 2; osteonidogen [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH84089.1 LOC495003 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI29004.1 Unknown (protein for MGC:145416) [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          NP_001090732.1 hypothetical protein LOC100036716 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA026a15.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------TGA---------------------------------ATG------------------------------------------------------------------TGA------------------------------------------------------------TAG---TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------TAA------------------------TGA------ATG---------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2  SIG                                    Xt7.1-TTpA026a15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAATTTAACACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAATGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276072                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAATGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Neu                            TNeu061f06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAATGTAATTCCAGCAAAATTCTTTGGTGCTCCCACAAAGGAACAATCGCTTGAAAATTCACATACAGGTTTCCCAGAACACAGAATATTTGAAAAGAATGAAAGTGAAGACAGTATTGATTACCCAGAGTCCTTTTATGAGGAGAATGAAGATGATCTGGAAGATAATACAAGTGATGCCACACCAACACATAATGCACACCAAAAAGTTGATTCAGACACTGGAAATCAGGGATACTTGGACATAGATCAGGCTTCCAAACTGACCCATGCAGATGTTGAACAGGAAGCTACATCATCTGTTGTGCTTTCCTCTTACATCAGAATCCTGATTGGACACCCTACAAACTCAGTGAATCTGATACTGACAGAGATGGGCCATTGCAGGAACCTCAAGTCAGACAGGGAGGATACAGATTTGACAAGGGGAGACACATTACTGACTGAAGAGCTGCCATCCCATAAGCACATAATTTAACACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTT
  5   1   2       add Gas7      in                         XZG60379.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAGATGGGCCATTGCAGGAACCTCAAGTTCAGACAGGGGAGGATACAGATTTGACAAGGGGAGACACATTACTGACTGAAGAGCTGCCATCCCATAAAGCACATAATTTAACACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAACGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCC
  5   1   2       ext Gas7      in                          XZG6146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGCTGCCATCCCATAAAGCACATAATTTAACACCTCAAAATTCTGAAGATCTCTCAATATATCCTGAAAGTGAAGTTCTCGTGGGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAATGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTTA
  5   1   3        nb Gas0      in                         dad30a06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAACGGAGTACATTGTTGGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACGTGTCAACTTCATTGCTGCCGATTTACACGCATATTTTGTGGCAAATGATGGATTTTTTTTCACAGCAATGAGCCACTTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATCTCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTC
  5   1   4      seed Gas7      in                         XZG27892.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGAACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTG
  5   1   3        nb Neu                            TNeu005o08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCATTTTACCCGGGNAAAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACT
  5   1   3        nb Tad5                                 XZT48247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACATCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAAACAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTAT
  5   1   3        nb TbA       in                   TTbA035d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAAC
  5   1   2       ext Gas7      in                         XZG24397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGAC
  5   1   2       add Tbd0      in                       IMAGE:6977236                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAAAGGGGAAATTATGTTCCATTACAGTGTCATGGCCAGCACTGGCCATTGGTGGGTGTGGGGGACAATTAGGTGAAGAA
  5   1   2       ext Ovi1      in                        CABI13698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAAGAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAANAGCGCCAGCAGCTACACCCA
  5   1   2       add Gas7      in                         XZG42442.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGGAAAGCTTTATTTTCTTGCAACAATATGATTTGTAAAGTTTTTTTTAC
  5   1   2       add AbdN                               IMAGE:7006196                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAAGAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACAACACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCNCTGAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAATTAGGTGAAGAGATTGCTGGAACAAGACACCACCTGGCAGACCAGGCCCAATTTGTGGGGAACAGAGCCTACTTCGAAAACTCAAAAAATTTGTGAAAAGTGGAAACCAAATTCTTATTGAGCATTATGGGGGGGAAACCAGGTGGAGAAACATTATGTGCCCCCAGGGTGAATCAAAATGGGGACCTCCAGTCCCCCCAAGTGCCCTGGGGAAAAAAGGGGCCTAATTGGCCGGGGGGTGGGGGGTAAAAAAAAGGGAGAAAGAAAATTTGC
  5   1   2       add In60                            IMAGE:8949496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTACACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAATGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAGACAGAGCCTACTCAGAGACTCAGACAGTGTGTGAGAGTGAGCAGAGTCTATGAGCATATGGTGGGAAACAGTGAGACATATGTGCTCATGTGATCATATGTGACTTCAGTCTCTCATGCCATGGAACATGCTATGCTGGTGTGTTGGATAAGAGGATGATAT
  5   1   2       add HdA       in                  THdA014p04.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGCTGTGGGACGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAAGAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACAACACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTANGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAANGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCA
  3   1   2       add Gas7      in                         XZG60379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTACACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCAGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAAAAAAAAAAAAAGG
  5   1   2       ext TpA       in                   TTpA078j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGNTCAGCAGATTGGCTACTTACCCACTCACGGCACAAGGCTCCCATAAGAAAAAGCAGGACACTGCTGTCACTTCA
  5   1   3        nb Gas7      in                         XZG61800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGGCACAGGCTCCATAAAGAAAAAGCCAGGACACTGCTGTCACTT
  5   1   3        nb TbA       in                   TTbA060d12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCANGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGT
  5   1   3        nb Gas       ?                    TGas118l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACAACACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCT
  5   1   3        nb HdA                            THdA041m16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACCCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTACACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCAGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGANACTATCATTAACACAGGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGC
  5   1   2       ext Ovi1      in                         CABI2340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGC
  5   1   3        nb Gas       in                   TGas105k05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCCGATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATGATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTG
  5   1   2       ext TpA       in                   TTpA013i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTNNATGACACATCGGCCT
  5   1   3        nb Gas7      in                         XZG54689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCTGGCAGACCAGGCCCAAATTGTGGGGAAACAGAGCCTACTCGGAGACCTCAGACAGTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGACCTGTACTGGACAGA
  5   1   3        nb Gas8      in                          st77b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAANAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGT
  5   1   3        nb Gas8      in                          st79b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGTGAGANGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCNACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAANGGCNCAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTATAACCANGTGCAGAACCGGANACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTANCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGNACAGACTGGAACAGAG
  5   1   3        nb Gas8      in                          st78b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGTGAGAGGTGGAAGCAGAGTCTTATTGAGCATTATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCC
  5   1   2       add In62                            IMAGE:8956316.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCCAGATGTTCAACGCCCTATGAAGCCCTTTTATTAATCGTCCCGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACACATCGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAACAAGTCTGTTGGGCTGATGCAGGAACCAGAAGCTTGAATGCATTTGTAGGACGACAGGCGACGGGTCATACACGAGTAACTTGAATTATACTTTTAGATGTTGTGGTGTATGCAAATACTTCTATCCACAGGACCTGAGGAAGGAATTGGGGTATAAAAT
  5   1   3        nb Gas8      in                          st18k10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATGGTGGGAAACCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTT
  5   1   3        nb Neu       in                   TNeu072g23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGGTGGAGAACATTATGTGCCTCAGTGTGATCAATATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGATAAATTGAAGGATCTATAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCATGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGATGGCTTATCCATTGACTACCTTCGCATGACAATGTTTTGGACAGATAGC
  5   1   2       add In63                            IMAGE:8959159.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAAATAATTGGTGACTTCAGTTTCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAGTCTTGTGGGCTGATGCAGGAACCAGAGCTTGAATGCATTTGTCAGACGGACAGGCGACGGTCATACGAGTACTGATTATCCTTTATGTTGTTGTGTATGCAAATACTTCTACCACCAGACTGGAGAGATGGTAATGCTACAGAACTGGTATTGGTGAAGATACTTTCTGACAGCGATTCCATTCTCCTATGGAAATT
  5   1   3        nb Gas8      in                          st56p03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATGGTGACTTCAGTCCTCTCCAGTGCCATGGAAACAGTGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACANAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCNACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCANAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACNAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGNAACAGAGAGGCTCCAA
  5   1   3        nb TpA       in                   TTpA026a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCCTTCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTG
  5   1   2       ext Tbd1      in                        CBXT16301.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCTATTGCTGGTGTGTGGATAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTA
  5   1   3        nb HdA                            THdA019k05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAAAGAAGGAAGAGAAATTGAAGGATCTAGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGGTATATCCCTTACAAGGACACTGGGCACATTGTT
  3  -1   3        nb Gas7 5x3  out                        XZG41633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTTCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGTTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGC
  5   1   3        nb Gas8      in                          st38o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCA
  5   1   3        nb Gas8      in                          st39o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTC
  3   1   2       ext Ovi1      in                        CABI13698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTT
  3   1   3        nb Gas  5x3  ?                     TGas118l21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTAAAAAAAAAAAAAAAAA
  3   1   3        nb Neu       in                    TNeu072g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       in                    TGas105k05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                         st104n16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCNGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGAT
  5   1   3        nb Gas8      in                         st104n16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGGCCTAGACAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAA
  3   1   3        nb Gas8      in                          st38o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGANTGAGAGTGCGCGNTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCNTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTGGCTCCAAAGAGATG
  3   1   3        nb Gas8      in                          st39o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGAGTGCGCGGTTGGACNGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTG
  5   1   3        nb Gas7      in                         XZG26166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCGGTTGGACGGCACTGAGAGGAAGGTTCTGTTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCTAAGCGTGTTGGCAAGCTTGGCT
  5   1   2       ext TpA       in                   TTpA004o24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCATTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCAGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTACAAGAAAAAACAAAAAACTTTTTAACTTGTTTAA
  3   1   2       add Tbd0      in                       IMAGE:6977236                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGGGGACCAAAACCTTTGGGGGGCCCTTTTCCCCCAAAAACGGGGTTTTTTAAACCTTTTTGTAGATACCCCTTTTTTTCTCCCAAAAACAAAAAGTTTTTTGTTTTGGGGGCTTTGAATGGCCCGGGAAACCCCCAAGGAAAAGGCTTTGGAAAAGCGCATTTTTGGTTCAGGAACGGGGAACCAAGGGGGCGAAACGGGGTTTCCATTACCAGGAGGTTAACCTTGAAAATTTTTCCCTTTTTTAAGGGGGTTGTTTGGGGGTATGCCAAAAATTAATTTTCTAACCCACACCAGAACTGGGAGGAAGGGGATTGGGGGTAAATATTCCCTTAAACAAAAGGGACCCTGGGGGCACAATTTGTTTGAAAGAATAACCTTTCCTGGAGCAGGCGATTCCCATTTTTTATGGGAAGTAACAAGCCTGTGTACCCATACTGCCCTTTCAGGGAGAAAAGTTAATGCAGAAATAAGCTGCAGAGTGGAAAATTTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGGAATCAGCACAAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTGCACAGATAAATCCAATAAATCCATCCCGCCGGNGGNGGGGGGGGGNGGCGGGGCGGGGGGTGCGCGGGGTGTGCGTGGGCGTGGGGGAGTGGCTGTCGGGGGGTCGGTCG
  3   1   3        nb Gas7      out                        XZG19091.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas8                                 st107k19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCCTCGAGCCNTCACTGTGGATGCGGTTAGAGGGANCCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTNTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTNTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAANTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGAT
  3   1   3        nb Gas8      in                          st18k10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATG
  3   1   3        nb Gas8      in                          st56p03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTGGCTCCAAAGAGATG
  3   1   3        nb Gas8      in                          st77b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTGGCTCCAAAGAGAT
  3   1   2       ext Gas7      in                          XZG6146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTCCCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAN
  3   1   3        nb Gas8      in                          st78b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTGGCTCCAAAGAGA
  5   1   3        nb Gas                            TGas120c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGAT
  3   1   3        nb Gas8      in                          st79b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTNTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGANTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTGGCAAGCTG
  5   1   3        nb Gas7                                 XZG10321.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGGACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTT
  5   1   2       ext Gas7                                 XZG62211.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAGTACATAAG
  3   1   3        nb Gas0      in                         dad30a06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTGCTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCAAATGCCACAGTTTTTTTAAA
  3   1   3        nb Gas8                                  st80b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNCCAAACAAGTCNTGTTGNGCTGATGCAGGAACCAAGAAGCTTGAATNCATTTTGTCAGACGGAACAGGGCGNCGGGTCATACAGAGTAACTTGAANTATCCTCTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTANCAAGGNCACTGGGCACATTGTTGAAGAATNCCNTCCTGAGCAGCGATCCCATCTCTCTGGAGTAACAGNCTGTGTACCCATAGCTGCCCTTCAGGGAGAAACNTAATGCAAGAATAAGNTGCAGAGTGGAAATTCATTCTGATGGAAGATTTTTCTCCT
  3   1   2       ext Ovi1      in                         CABI2340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCTGTTGGGCTGATGCAGGACCCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAA
  3   1   2       ext Egg  FL   out                   TEgg056h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA       in                    TTpA013i02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add TpA       out                   TTpA042m24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAGACAATATCAGAACTCCAGTCTTGTTATTAAATATATTAATATATGTTAAGTTTAACAGACAACGTGCTTATCATCAAACACAAAGCAGGAAAACGAAGACATTAACGTGTGTGTTTATTTTGGAACTTTAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCTTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTGCTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAAGGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGAAAAAAAGGTGGTCaaaataagaaaaaaaaaaaaaaaaaaccaaaacaaaaaaaaacagaaaaaaacaaaaaaTCCATATCTTATTAGTAAAAAAAAAAAAAAAAAA
  3   1   3        nb TpA       in                    TTpA026a15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAAA
  5   1   3        nb TbA                            TTbA058d12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGACTCCAGAACCTTGTATGCATTTTGTCAAACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCCATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACA
  5   1   3        nb TbA                            TTbA058d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACAT
  5   1   3        nb Neu                            TNeu041k14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTGAATGCATTTTGTCAGACGGAACAGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGNGCCTTTTTTATATA
  3   1   3        nb TbA       in                    TTbA035d01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTTTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGGGCCTTTTTTATATATTTTTTTTCTTTTCCAAGGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATGGCAACAAACAAGTACATAAGGTGGTCGGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTGTTAACAAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu040m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGCGGAACAGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGT
  3   1   2       ext Tad5      in                         XZT69028.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACGCGTCCGGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAGG
  3   1   2       ext Gas7      in                         XZG24397.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGGCGACGGGTCATACAGAGTAACTGAAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  5   1   3        nb Gas7                                 XZG44517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTT
  5   1   2       ext Tad5      in                         XZT69028.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAGGG
  3   1   2       ext Tbd1      in                        CBXT16301.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG54689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAGG
  3   1   4      seed Gas7      in                         XZG27892.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTCTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAGG
  3   1   3        nb Gas7      in                         XZG26166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCTTCCC
  3   1   2       ext TpA       in                    TTpA004o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG61800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  5   1   2       add Limb      in                        CBSU6646.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTTTAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  3   1   2       add Limb      in                        CBSU6646.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTTTAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTG
  5  -1   3        nb Hrt1      out                        CAAQ6906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTTTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCCCAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTTTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTTTTGGCAAGCTTGGCTCCAAAGAGATGTGCCCCATGTACAGAGATCGCCCATGCCCCAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGGGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCCCATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  3   1   2       add TpA                             TTpA042l24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAACAAGGACACTGGGCACATGTGAAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA       in                   TTpA078j14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAGAAAAAAAAA
  5   1   3        nb Tad5                                 XZT49229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTG
  3   1   2       add Gas8      out                         st70g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTNTTGGGTCCTTCCGNATATAGNTNTTNTNTNATNTGNTNATNAGNTAAAAAAAAAACTTGTGTATTTCNGGGNGAAAGTAATGCNAGAATAAGCTGCNGAGTGGAAATTCNTTTTGATGGAAGNTTTTTCTCCNTGCTGCNGTTAAAGGGNTGGCAAAGAATCAGCNCAAATNCTACTTGGNAACTGCAAAGAAAAGCTTTATTTTCTTGCNACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTGGCTCCAAAGAGAT
  3   1   3        nb Gas8      in                         st112h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCTTCCTGAGCAGCGATNCCATCTNTATGGAGTAACAGCTGTGNACCCATACTGCCCTTCNGGGGGAAAGTNATGCNAGNATNAGCTGCNGNGNGGAAATTCNTTTTGNTGGNAGNTTTTTNTCCNTGCNGCNGTTAAAGGGNNGGCAAAGAATCAGCCCAAATNCTACNTGGNAACTGCNAAGNAAAGCTTTATTTTNTTGCNACAAATNTGATTTGNAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACNGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCCAGCGNGTTGGCNAGCTTGGCTCCAAAGNGATGTGCCNCATGTACAGNGATCGCCCNTGCCCCNGNTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTCACAGA
  5   1   3        nb Gas8      in                         st112h10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACNGCCCTTCAGGGAGAAAGTAANGCAAGAATAAGCTGCAGAGTGGAAATTCAGTTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAANATAAAAAAATAACCCCAAGCGTGTTGGCNAGCT
  3   1   2       add HdA       in                   THdA014p04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACGGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       add Gas7      in                         XZG42442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCCCAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCCCATGTACAGAGATCGCCCATGCCCCAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAAGGGGGCCTTTTTTAAATATTTTTTTTCTCTTCCAAGGTAGCTTTTAATATTTTATCAACCCCCATTACTTTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGGGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCCCAGATAAATTCAATAAATCCATTTCTTTTTCGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGAGG
  5   1   2       ext Tad5                                  XZT5923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext Gas7      in                         XZG45306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  5   1   2       ext Gas7      in                         XZG45306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTNAAAAAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   3        nb Egg                             TEgg021g10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCGTAAAATAAAAAAATAACCCCAA
  3   1   3        nb Gas8      out                         st71g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAAAGGGATGGCAAAGNATCNGCCCAAATNCNACTTGGAAACCGCNAAGAAAAGCTTTATTTTNTTGCCACNAATATGATTTGTAAAGTTTTTTTTACCNCAAAATTTTTTTTNNTACTGTCTTTTTACAGAAATTATTCAGCTGTAAAATAAAAAAATAACCCCAAGC
  3   1   3        nb TbA       in                    TTbA060d12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACGAGATAAATTCGAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAAAAGC
  5   1   2       ext Tad5                                 XZT36411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5  -1   3        nb Neu                            TNeu012a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTCTTTTTCTGTAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas7                                 XZG37044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAGG
  5   1   2  SIG                                      Xt7.1-CAAO7742.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACAACACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCTCTGAAAACCTCTCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCTCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGACAATTAAGTGAAGAGATTGCTGACAGACATCTACTTGCAGATCTAGTCCAATTGTGGGGAACGAGCTTACTCGAGACCTCAGACGTGGTGTGAAAAGTGCAGCTTAGTCTTATGGACATATGTGCATCAGTGGAGAACATATGTGGCCTCAATGTGGTGAATCAATAGGGGTGATACT------------GAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTT
                                                  Xt7.1-CHK-1008276070                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACAACACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCTCTGAAAACCTCTCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCTCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGACAATTAAGTGAAGAGATTGCTGACAGACATCTACTTGCAGATCTAGTCCAATTGTGGGGAACGAGCTTACTCGAGACCTCAGACGTGGTGTGAAAAGTGCAGCTTAGTCTTATGGACATATGTGCATCAGTGGAGAACATATGTGGCCTCAATGTGGTGAATCAATAGGGGT------------------------AACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAA
  5   1   4      seed Te3       in                         CAAM4071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGTCACCCAGAACAGGAAAATGATTTTGAAAGAAAGCAGATTGATGCTGATCCTGGACTCCAAACTGATGTGTTTTCCTTTAACCCTGTGGGCAAGGAGACATGTGAGAGGAACCACGGGAGATGTTCTAGGTTTGCTTTTTGTGCCGATTACTCTGCTGGCTTCTGCTGTCATTGCCAGGAAGATTATTATGGCAACGGAGTACATTGTTTGCCAAGAGGGGCTCCACACCGTGTGAATGGTAAAGTGAGCGGAAACATCCTGGTCGGTCAAACACCTGTCAACTTCATTGCTGCCGATTTACACGCATACATTGTGGCAAATGATGGAAGAGCGTACACAGCAATCAGCCACGTTCCTGATCCTGCATCCTGGTCTTTAACACCTCTTGCTCCAATTGGGGGACTCTTTGGCTGGCTTTTTGCTTTGGAAAAACCAGGCTTTCAAAATGGTTTTAGCTTTACCGGTGCCAAGTTTGTACACAACATTGATGTCACATTTTACCCGGGAGAAGAAACTGTTCATATTACTCAAACAGCAGATGGCTTTGATTCTGAGGGTTATATGAATGTAAAGACAGCAATTCAGGGCAAAATTCCATATATCCCAGAGACATCGACCATCAAGCTGTCTCCTTATACTGAACTGTATCAATACTCTGGCTCAGTTGTAACTTCGACAGCCTACAGGGAATACACAGTCATCTCAGAATCAAACGAAGAACAAAAACTGTCTTACCGGTTACGGCAAAATGTCACTTACCAAGAGTGCAGCCATTCCCAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGC
  5   1   2       ext HdA       in                  THdA026o22.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTCCCGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGGTTGGTGTGTGG
  5   1   3        nb Te4       in                         CAAN8635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGAAACAGCCTGTTAGTGCTCAAAAGCTTTATGTTGATCGTGTCTTTGCCCTTTACAATAAAGAAGAGAAGGTCCTTCGTTATGCAGTTACAAACTACATTGGATCTCTGCATGATTCGACTGGACAGGACGATCTCACAGTTAACCCGTGCTATGATGGTACCCACTTGTGTGACACAAGAGCTAAATGCCAGCCTGGTAGTGGTCTAGAATACAGTTGTGTTTGTGCGTCTGGATACCAAGGGGATGGAAGAGATTGCACTGATGTAAATGAATGTGAAGTTGGCTTCACCCGGTGCGGCCAGAACACTGTTTGTGTCAACCTCCAGGGGAGTTACCGTTGTGAGTGCGCCAGTGGTTTCACTTTATCTGGAGACGGGCACAACTGCATCTTGGCTTCACTAATAAACCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGNGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGAC
  5   1   2       ext Te3                                  CAAM9113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGACGGGCACAACTGCATCTTGGCTTCACTAATCTTTCCATGTGAAGATGGAAGTCATACATGTAACAGAGACACATCACGCTGTGTTCCGCGTGGAGATGGTGTATTCACATGTGAATGTTTCCCTGGATTTAACAAGAGTGGAGAAGACTGTGTTGATGTTGATGAATGCACTGAGCACAGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTA
  5   1   2       ext In62                            IMAGE:8955741.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGGATGTTGATGAATGCACTGAGCACTTGATGTCATCCAGATGCCTCATGTACCAACACCCTGGGCTCTTTCTCCTGTCGGTGTAACAGTGGTTATGAAGGAGATGGCTTCCAGTGCACTCAAATCTTAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAAGAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTACTGGAACAAGAACAACACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCTCTGAAAACCTCTCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTGCACCCAAGAGGCCCTCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGACAATTAAGTGAAGAGATTGCTGACAGACATCTACTTGCAGATCTAGTCCAATTGTGGGGAACGAGCTTACTCGAGACCTCAGACGTGGTGTGAAAAGTGCAGCTTAGTCTTATGGACATATGTGCATCAGTGGAGAACATATGTGGCCTCAATGTGGTGAATCAATAGGGGTGATACT
  5   1   2       ext Egg       in                   TEgg006m22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAAGCGCCAGCAGCTACACCCAAGGGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCAGAGTGTGATGTAGAGGGAAATTATGTTCCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAGAGATTGCTGGAACAAGAACACCACCGGGCAGACCAGCCCCAAATTGTGGGGAAACAGGTCCTGAACCCCTGAAAACCCCCTGTTTAGAAAGGCGCCAGCAGCTGCTTGGACAGCTACACCCAAGAGGCCCCCGTCCAGCTGTGGGACAGTTTGTACCTGAGTGTGATGCAGAGGGAAATTATGTTTCATTACAGTGTCATGGCAGCACTGGCCATTGTTGGTGTGTGGACAAATTAGGTGAAG
  5   1   2       ext Tad5      in                         XZT25672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAACAGAACCTGGAATGACTCCAGCATGTATACCGACAGTGGCACCTCCAACCATGCATCCAACTCCGCGTCCTGATGTGACCCCTCCTGCAACTGGCACCTTCCTCTTGTATGCTCAGGGTCAGCAGATTGGCTACTTACCACTCAACGGCACAAGGCTCCATAAGGAAAAAGCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCCTTACAAGGACACTGGGCACATTGNTTGAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTG
  5   1   2       ext Te5       in                         CAAO7742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACTAATACTACTTGGAAACTG
  3   1   2       ext HdA       in                   THdA026o22.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGCAGGAACCAAGAAGACTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAAGCG
  3   1   4      seed Te3       in                         CAAM4071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  3   1   3        nb Te4       in                         CAAN8635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  5   1   2       ext Tad5                                 XZT72953.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te3       out                        CAAM2595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  3   1   2       ext Te5       in                         CAAO7742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  3   1   2       ext Tad5      in                         XZT25672.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCCCAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTCCCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCCCATGTACAGAGATCGCCCATGCCCCAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGGGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCCCATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGGGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCCCAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  3   1   2       ext Egg       in                    TEgg006m22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTATAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te3  5g3  out                         CAAM737.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGT
  5   1   2                                           Xt7.1-ANHP1637.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTCCCCGGAGAATTTGTATCAAACTGGAAACACTGGTGTCCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTT------------------------------------------------------------------------------------------------------------------------------------------------CTTGCATTACTTTCTCCCTGAAGGGCAGTATGGGTACACAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276064                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGAGAATTTGTATCAAACTGGAAACACTGGTGTCCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTA------------------------------------------------------------------------------------------------------------------------------------------------CTTATTCTTGCATTACTTTCTCCCTGAAGGGCAGTATGGGTACACAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas                            TGas059n11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTCCCCGGAGAATTTGTATCAAACTGGAAACACTGGTGTCCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAACAAGTCTGTTGGGCTGATG
  5   1   4      seed Gas       in                   TGas059n09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATTTGTATCAAACTGGAAACACTGGTGTCCCAGGACACTGCTGTCACTTCATGGTTCTATAGTGGTTGGTATTGACTATGACTGCCATGAGAAAATGGTGTACTGGACGGATGTTGCAGGTCGTACAATCAACCGCGCAAGCTTAGAACCAGGTGCAGAACCGGAAACTATCATTAACACAGGGTTGATGAGCACAGAGGGCTTAGCCATTGACTACCTTCGCAGGACAATGTTTTGGACAGATAGCGGCCTAGACAAGATTGAGAGTGCGCGGTTGGACGGCACTGAGAGGAAGGTTCTATTTGACACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTG
  5   1   2       ext Neu5                                 ANHP1637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTATTCTTGCATTACTTTCTCCCTGAAGGGCAGTATGGGTACACAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAACCCCAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTaaaanaaaaaaaaaaaaaaaaaaaaaanaaaaaaaaaaaanaaa
  3   1   4      seed Gas       in                    TGas059n09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-XZG35833.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAACTATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTATATATGTTTTGTGTGTTTACTCGCACAGGCTGCTTTTAGAGAACAGTTAGAAATGCTTACAAAACTAGTTAGGTTATAGACAGAGGAATTTCTACTGTAAAAAGTCAACAAAAAACAAGATATTTTTCAGTGTAAGTGGTGGCTGATTTGCTTTGCTCAGCCAGCAGCAATAAAATGAATGAAAGCAAAAACCTGGTTGGTTGCTGACATTTTTTTACTACTAGGTAAAAATCTGAGCTGTGTTAGTAACCAAGCCCAAGACTGTTTAGCAATGTGATGTACCCATGCCTGAACATGCATTAATTTCATAAATATGCTTTCAACTGCAACACTGAGGAGGATGCAAGGCTATTTTATTCAAAGTTAAAAGGCTGTCACCTTTTTGTGTGAAAACAAAATAAGGTATTGGACTAGCTGTGAACCTGGCCAGACATGGAAGGAGCATCTGCACCAAGAGAAGGAAGTTTGTTGGAAGTGGCTGCATTTGTTATAGTGCTATGTCATATTACAAGAGTGCCCTCTGCTGTTCTGTTCAGTGCAGGAAAGGTACAGCCAGAACAGCAAAAGTTGAAGTTATTGATG
                                                  Xt7.1-CHK-1008276074                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAACTATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTATATATGTTTTGTGTGTTTACTCGCACAGGCTGCTTTTAGAGAACAGTTAGAAATGCTTACAAAACTAGTTAGGTTATAGACAGAGGAATTTCTACTGTAAAAAGTCAACAAAAAACAAGATATTTTTCAGTGTAAGTGGTGGCTGATTTGCTTTGCTCAGCCAGCAGCAATAAAATGAATGAAAGCAAAAACCTGGTTGGTTGCTGACATTTTTTTACTACTAGGTAAAAATCTGAGCTGTGTTAGTAACCAAGCCCAAGACTGTTTAGCAATGTGATGTACCCATGCCTGAACATGCATTAATTTCATAAATATGCTTTCAACTGCAACACTGAGGAGGATGCAAGGCTATTTTATTCAAAGTTAAAAGGCTGTCACCTTTTTGTGTGAAAACAAAATAAGGTATTGGACTAGCTGTGAACCTGGCCAGACATGGAAGGAGCATCTGCACCAAGAGAAGGAAGTTTGTTGGAAGTGGCTGCATTTGTTATAGTGCTATGTCATATTACAAGAGTGCCCTCTGCTGTTCTGTTCAGTGCAGGAAAGGTACAGCCAGAACAGCAAAAGTTGAAGTTATTGATGCAGGAA
  5   1   4      seed Gas7      in                         XZG35833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACAGCTTGTGAATCCTCGAGCCATCACTGTGGATGCGGTTAGAGGGAACCTGTACTGGACAGACTGGAACAGAGAGGCTCCAAAGATTGAATCTTCGTTTGTAGACGGATCAAACAGGAGGATTCTGGTTAATGACAACATCGGCCTTCCCAACGGTTTAACCTTTGATCCCTTCTCCAAACAAGTCTGTTGGGCTGATGCAGGAACCAAGAAGCTTGAATGCATTTTGTCAGACGGAACAGGGCGACGGGTCATACAGAGTAACTTGAATTATCCTTTTAGTGTTGTTGTGTATGCAAATTACTTCTACCACACAGACTGGAGGAGGGATGGGGTAATATCCCTTAACAAGGACACTGGGCACATTGTTGAAGAATACCTTCCTGAGCAGCGATCCCATCTCTATGGAGTAACAGCTGTGTACCCATACTGCCCTTCAGGGAGAAAGTAATGCAAGAATAAGCTGCAGAGTGGAAATTCATTTTGATGGAAGATTTTTCTCCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAA
  3   1   4      seed Gas7      in                         XZG35833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTTGCTGCAGTTAAAGGGATGGCAAAGAATCAGCACAAATACTACTTGGAAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTTAAAAAAAAAAACAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTCCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAAATATAGGAAACTTTGTGCCATACCAAAACTTCACAGATGAAATGGATTTATTGAATTTTTTTTCTGTATATATGTTTTGTGTGTTTACTCGCACAGGCTGCTTTTAGAGAACAGTTAGAAATGCTTACAAAACTAGTTAGGTTATAGACAGAGGAATTTCTACTGTAAAAAGTCAACAAAAACCAAGATATTTTTCAGTGTAAGTGCTGGCTGATTTGCTTTGCTCAGCCAGCAGCAATAAAATGAATGAAAGCAAAAAAAAAT
  3  -1   2       ext Te1       in                         CBWN5804.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTTTTTAACTGCAAAGAAAAGCTTTATTTTCTTGCAACAAATATGATTTGTAAAGTTTTTTTTACCTCAAAATTTTTTTACTACTGTCTTTTTACAGAAATTATTTAGCTGTAAAATAAAAAAATAAGCCTAAGCGTGTTGGCAAGCTTGGCTCCAAAGAGATGTGCCACATGTACAGAGATCGCACATGCCACAGATTTTTTTAAAAAAAAAAAAAAAAAAACTTTTTAACTTGTTTAATATTTGTAACTTGAGTTTTTTTTCAATGGTGCCTTTTTTATATATTTTTTTTCTCTTCCAATGTAGCTTTTAATATTCTATCAACCCACATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAACTATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTATATATGTTTTGTGTGTTTACTCGCACAGGCTGCTTTTAGAGAACAGTTAGAAATGCTTACAAAACTAGTTAGGTTATAGACAGAGGAATTTCTACTGTAAAAAGTCAACAAAAAACAAGATATTTTTCAGTGTAAGTGGTGGCTGATTTGCTTTGCTCA
  5  -1   2       ext Te1       in                         CBWN5804.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTACTGTATACTGTGAACAAATATGGCCAGAAACTGCATACATCGCAACAAACAAGTACATAAGGTGGTCCGTTTGTGAACTATAGGAAACTTTGTGCCATACCAAAACTTCACAGATAAATTCAATAAATCCATTTCTTTTTCTGTATATATGTTTTGTGTGTTTACTCGCACAGGCTGCTTTTAGAGAACAGTTAGAAATGCTTACAAAACTAGTTAGGTTATAGACAGAGGAATTTCTACTGTAAAAAGTCAACAAAAAACAAGATATTTTTCAGTGTAAGTGGTGGCTGATTTGCTTTGCTCAGCCAGCAGCAATAAAATGAATGAAAGCAAAAACCTGGTTGGTTGCTGACATTTTTTTACTACTAGGTAAAAATCTGAGCTGTGTTAGTAACCAAGCCCAAGACTGTTTAGCAATGTGATGTACCCATGCCTGAACATGCATTAATTTCATAAATATGCTTTCAACTGCAACACTGAGGAGGATGCAAGGCTATTTTATTCAAAGTTAAAAGGCTGTCACCTTTTTGTGTGAAAACAAAATAAGGTATTGGACTAGCTGTGAACCTGGCCAGACATGGAAGGAGCATCTGCACCAAGAGAAGGAAGTTTGTTGGAAGTGGCTGCATTTGTTATAGTGCTATGTCATATTACAAGAGTGCCCTCTGCTGTTCTGTTCAGTGCAGGAAAGGTACAGCCAGAACAGCAAAAGTTGAAGTTATTGATGCAGGAAGTGG
  5  -1   0       add In66                            IMAGE:8962268.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTACTAGTAAATTCGACTGGGTAGTACAGCAGCTGTTAGCAATGGAAGTACCATGCTGACATGCATACTCATAAATAGCTTCACTGCAACATGAGAGATGCAGCTATTTATTCAAAGTAAAGCTGTCACTTTTGTGTGAAAACAAATAAGTATGGACTAGCTGTGACCTGCCAGACATGAAGGAGCATCTGCACAAGAGAAGGAAGTTTGTTGGAAGTGGGTGCATTTGTTATAGTGCTATGTCATATTACAAGAGTGCCCTCTGCTGTTCCGTTCAGTGCAGGAAAGGTACAGCTAGAACAGCAAAAGTTGAAGTCATTGATGCAGGAAGTGGCTTTCAGTGCTTCTCTGTTCAGTTCTTTTGCTTCTGACACAGAGCAAGGGAGTAGCAGGAGACACTTTCTGCATCAGTAACGCATTTTTGCTATTCTGTCTGGCCCCCTGCTTGGACAAAACAGTACAGGGCACTCCTGTAATACATTCATAATTTTATAATTGTTGCTTATATGTTCTCATTAAATGCATTAGTACCAAAGGGATTAGTATGTGAAGGGACTAAACTAAAGCACATTGTTAATTGTGATCTTTGTATGGTACAGATTGAATGCCCTACAACATAGTATAAATAAATAGGCTATATGTTAATGCCCGGTAAAGACTATGGGGTATATTCATCATGCTGTGCACAAAGTGGAGTAAAACATTACCAATGAAGTTGCTCATAGCAGACAGATGGTTTGGTTTTCTAACTGTTAGGCTAATGCCACACGAGGCGCAGGGCCGAAATCCAAAGGCTAAGCGGAAAAGCGCCCGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)