Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:7021699.5                      76 END     1           1        1                RAB5B, member RAS oncogene family [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABD10418.5                           6 END     4           6       80                Unknown (protein for IMAGE:6871480) [Xenopus laevis]
     3   2.0    0Xt7.1-XZT11393.5                            2 END     1           1       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012073170 Xt7.1-CAAM6262.3.5 - 63 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAM6262.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTACACCAGCATGTGCGTGCTCTACACAATTTAGTGAAAGCAGCACAAAGTTTGGATGAGATGTCTCAGACCATCACTGATCTGTTAAATGAACAAAAGGCATCTAATAGTCAGCTGTCCCCACAATGTATAACTACGCAAAGGATAGACAGTGCAACAGAAGCTACAACTACTACCTCATCCAAAACTCCTTTATCACTCAGTCTTCAGGGACCCATTTGTCCTGCTGTTAATGCTCCCGGGCCTTTGGAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTTGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTG
                                                  Xt7.1-CHK-1008224744                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCATGTGCGTGCTCTACACAATTTAGTGAAAGCAGCACAAAGTTTGGATGAGATGTCTCAGACCATCACTGATCTGTTAAATGAACAAAAGGCATCTAATAGTCAGCTGTCCCCACAATGTATAACTACGCAAAGGATAGACAGTGCAACAGAAGCTACAACTACTACCTCATCCAAAACTCCTTTATCACTCAGTCTTCAGGGACCCATTTGTCCTGCTGTTAATGCTCCCGGGCCTTTGGAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTTGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAAxTTGAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     3     5     4     5     4     5     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     6     6     6     6     6     6     6     7     7     8     7     8     7     8     8     9     8     9     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    11    10    11    10    11    10    11     8     9     8     9     8     9     8     9     8     9     7     9     8     9     9     9     9     9     9    10     9    10     7     8     8     9     7    11     7    11     7    11     7    11     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     5    10     5    10     4    10     4     9     4     9     4     9     4     9     3     8     3     8     3     8     4     8     4     8     4     8     4     8     4     8     5     9     5     9     5     9     6    10     7    11     7    11     7    11     8    12     8    12     8    12    10    13    11    13    12    15    14    16    14    16    14    16    14    16    15    16    15    17    15    17    15    17    13    17    14    18    14    17    17    21    20    24    21    24    22    25    22    25    22    25    24    25    26    26    26    26    26    26    25    25    27    27    27    28    27    30    28    30    27    29    29    29    29    30    29    31    31    32    32    33    33    33    34    34    34    34    34    34    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    35    37    37    37    37    37    37    35    36    33    34    33    34    33    34    32    33    30    32    30    32    30    32    30    32    29    30    29    30    29    30    29    30    28    30    28    30    28    30    28    30    28    30    27    29    27    29    27    29    27    28    27    28    26    28    25    28    25    27    25    27    22    26    20    25    19    24    11    12    11    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9    11     9    11     8    11     7    10
  5   1   2  SIG                                      Xt7.1-CAAM6262.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTACACCAGCATGTGCGTGCTCTACACAATTTAGTGAAAGCAGCACAAAGTTTGGATGAGATGTCTCAGACCATCACTGATCTGTTAAATGAACAAAAGGCATCTAATAGTCAGCTGTCCCCACAATGTATAACTACGCAAAGGATAGACAGTGCAACAGAAGCTACAACTACTACCTCATCCAAAACTCCTTTATCACTCAGTCTTCAGGGACCCATTTGTCCTGCTGTTAATGCTCCCGGGCCTTTGGAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTTGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTG
  5   1   2  SIG                                      Xt7.1-CAAP8631.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATACACTAGAGGAACTGCATTTACATTAGGTATATATATCTATGAGACCATGGCAAATAAGTATGCTTGATATCTGGACTCTTGTATACATTTAAAGATTTCTTTAAATGGATACAAGAGTGCATTTCAAGAATCAAGTGCATTCGGTATTTTTTAATTTAGTTTAAATGTAGTTTCTTTAGATATGATAGAATAATCTGCTGACAGTATTAGGTTTCATTTTGACCATTATCTTACATGGCCGAGAGATGCTTTTTATTGGTGAAGCCTACTTCTTCTCTGATCTTGAAAGCACAATAGTAAAATTCAACCATGCAAACTAGGGGACAGATATGTTAATGGTCATTATGTGGCGATCTTTGAACGGTACTTATGCTTTTTGTTTACGAGTAGCACTGTTAATAGGTGATGGAGATTGGCGAAACATTGTCACAAAGGCAGGGAAATATTTACACATATTCTTAATTGTAATTATTACAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGAGATATATTAACTGTAGAATGGTTATACTTTCTTGTTCCATGGCACTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTGATATCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTTAAAGATTTCTTTAAATGGATACAAGAGTGCATTTCAAGAATCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTTTAATTTAGTTTAAATGTAGTTTCTTTAGATATGATAGAATAATCTGCTGACAGTATTAGGTTTCATTTTGACCATTATCTTACATGGCCGAGAGATGCTTTTTATTGGTGAAGCCTACTTCTTCTCTGATCTTGAAAGCACAATAGTAAAATTCAACCATGCAAACTAGGGGACAGATATGTTAATGGTCATTATGTGGCGATCTTTGAACGGTACTTATGCTTTTTGTTTACGAGTAGCACTGTTAATAGGTGATGGAGATTGGCGAAACATTGTCACAAAGGCAGGGAAATATTTACACATATTCTTAATTGTAAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---TA-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -C----------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Cs ---- 3e-007     AAX84194.1 cytospin A [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 2e-010     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] -----------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bb ---- 1e-010     BAC16746.1 myosin heavy chain [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 3e-021     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-021     NP_497706.1 protein kinase beta like (3E511) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-022     AAH75407.1 Myosin, heavy polypeptide 2, skeletal muscle, adult [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 4e-023     XP_787230.2 PREDICTED: similar to Centrosome- and Golgi-localized PKN-associated protein (CG-NAP) [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 2e-025     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-025     NP_001014553.1 CG15792-PC, isoform C [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-026     AAA49915.1 nonmuscle myosin heavy chain b [Xenopus laevis]  -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 2e-026     NP_001084034.1 nonmuscle myosin heavy chain b [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 1e-122     XP_697697.1 PREDICTED: similar to Rb1-inducible coiled coil protein 1 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_033956.1 RB1-inducible coiled-coil 1 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_055596.2 Rb1-inducible coiled coil protein 1 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_001232350.1 PREDICTED: Rb1-inducible coiled coil protein 1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAM6262.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------ATGATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------ATG------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TAA------------TAA------------------------------------------------------------------TGA---TAA---------------TAG---------------TAA------------TAA------------------------------------------------------------TAA------------TGA------------------------------------------------------------TAA---------------------------TAG---------------TGAATG---------------------------------------------------------------------------------------------------------TAA------------------------------------------TAA------------------------------TAG---------------------------------------------------------------------------------------------------TGA---------------------------ATG------------------TAG---------------------------------------------TAA---------------------------ATG---------------------------------------------------------------------------ATGTAG---------------------TAA------------------------------------------TGA---------ATG------------------------------------------------------------ATG---ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2  SIG                                      Xt7.1-CAAM6262.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTACACCAGCATGTGCGTGCTCTACACAATTTAGTGAAAGCAGCACAAAGTTTGGATGAGATGTCTCAGACCATCACTGATCTGTTAAATGAACAAAAGGCATCTAATAGTCAGCTGTCCCCACAATGTATAACTACGCAAAGGATAGACAGTGCAACAGAAGCTACAACTACTACCTCATCCAAAACTCCTTTATCACTCAGTCTTCAGGGACCCATTTGTCCTGCTGTTAATGCTCCCGGGCCTTTGGAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTTGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTG
                                                  Xt7.1-CHK-1008285494                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGCATGTGCGTGCTCTACACAATTTAGTGAAAGCAGCACAAAGTTTGGATGAGATGTCTCAGACCATCACTGATCTGTTAAATGAACAAAAGGCATCTAATAGTCAGCTGTCCCCACAATGTATAACTACGCAAAGGATAGACAGTGCAACAGAAGCTACAACTACTACCTCATCCAAAACTCCTTTATCACTCAGTCTTCAGGGACCCATTTGTCCTGCTGTTAATGCTCCCGGGCCTTTGGAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTTGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAAxTTGAAAAAA
  3  -1   2       ext Lun1      in                        CABD12893.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAACTACAGGCTCTATTCCGACTCTTAACAGAGCTTGTAGAACGAATCAAGATTGTGGAGGCTCTTAGTACTGTTCCTCAAATGTACTGCTTAGCAGTAGTTGAAGTGGTGAGAAGGAAAATGTTCATAAAACACTACAGAGAGTGGACAAATTCATTAGTAAAAGATGGAAAATCTCTTTATGAAACAGAGAAGATTAAAAGGGAATCTTTTGGAAAGCTTTTTAGGAAATCTTATTTACGAAATAGGCTCTTTAGAGGACTTGACTCTTGGCCACCATCATTCTGTACTCGTAAGCCAAGGAGATTTGACAGTGAACTTCCTGATATCTCTGTAAATGACCTTCGGTTTTTGCAGTGTATTTGCCCTCCAGAAGTCCAGCTTTTCCTCAGGGTTCCCTTGCTTTGTGATTTTGAGCCTCTACACCAGCATGTGCGTGCTCTACACAATTTAGTGAAAGCAGCACAAAGTTTGGATGAGATGTCTCAGACCATCACTGATCTGTTAAATGAACAAAAGGCATCTAATAGTCAGCTGTCCCCACAATGTATAACTACGCAAAGGATAGACAGTGCAACAGAAGCTACAACTACTACCTCATCCAAAACTCCTTTATCACTCAGTCTTCAGGGACCCATTTGTCCTGCTGTTAATGCTCCCGGGCCTTTGGAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCC
  5   1   2       ext Ova1      in                         CABE7267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGATTTTGAGCCTCTACACCAGCATGTGCGTGCTCTACACAATTTAGTGAAAGCAGCACAAAGTTTGGATGAGATGTCTCAGACCATCACTGATCTGTTAAATGAACAAAAGGCATCTAATGGTCAGCTGTCCCCACAATGTATAACTACGCAAAGGATAGACAGTGCAACAGAAGCTACAACTACTACCTCATCCAAAACTCCTTTATCACTCAGTCTTCAGGGACCCATTTGTCCTGCTGTTAATGCTCCCGGGCCTTTGGAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTTGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATT
  5   1   4      seed Fat1      in                         CABC6950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGAGCTGTCTCCAGACAGCATTGATGCTCATACGTTTGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTCGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAANATGAAGAANAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTTAGAGCAACGCA
  5   1   3        nb Hrt1      in                         CAAQ1874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGATTTTGAAACGATTCCACATCCTGGCACTGAACAATCACTTAAACAGGGTTCTTTGGACATGGACTCTTTGGCAGATAGTCCTGAATCTGATTTTATGTCTGCAGTCAATGAGTTTGTTATTGAAGAAAATCCTATTTCACCAAATATAAGTGATACACAAAGTCCAGAAATGATGGTTGAGTCCCTATATTCATCTGTTATTAATGCAATTGACAATAGAAGAATGCAAGATACAAAAAGCAAAGTAAAGGATGAAAACATATCTTCCAGAGTTTGTCTGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGANAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGGAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTA
  5   1   3        nb Lun1      in                         CABD4465.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGAAAAATGTAAAATTCTTGCACATGAATCTCAAACCAGTTTGCGTAATTTTAAGGAGGATCTTTCTTACTTAAAAATACTTGTGCAAAGAGAGCAAAAGAACTTTGCCAGTGCTATAAAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGGTCAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAA
  5   1   2       ext HdA       in                  THdA018e12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCGGGAATCAGTTTCTGCAAATATTTATGATACAGTTGATAAAGTGAAACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTANCACAGCAAGAAGTCATGANATGTCAAATTAATAA
  5   1   2       ext Brn3      in                         CAAK8137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTGTCTATTGAAACAGCATTAAAGGAAAAACATTTAGAAGAACTTCAGGTATTAGAACAATCTTATCAGAAAAGACTGCAGCTTTCAAAGGAACAATTTGATGAAAATGAGAAACAACTGAAAAGTGACCTTGCAAAACTAAAAGAACATTTGAAAAATAGAGATAATGAATTTGCATTGATCAGGAATGAAAATGAAACTTTTCTATGTTTACAGAGTGAGCATAATGAGAAAATCATAAGTCTAGAAAATACAATGAAGGAGCAAGCATGTGAAATTCAGCAACTAAGACAATATCGGGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGANAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAAC
  5   1   3        nb Egg       in                   TEgg035m04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAGCCGCTCTAGAGGATATTAGAAAACTTCATGCTGAAAATGAAGAAAAGCTCAGGCTTCTTAAGGAAGATCTTATGATATTAGAGCAAACGCATTTAAAAGAGCTTGAAGATAATTTAAAACTCAGGCATGCACAAGAGATGGAAAGTTTGACATCTGACCATAACCATTCTCAAGAAAGGGTCAAACAAGATCATAAACGTATGGTTGACCAGTTGGTAGAATCTTATAATACAACAATTCATGAAAAAGACAGTAGGCTACAAGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGCACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTA
  3   1   3        nb Lun1      out                       CABD10418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CANGAAAAAGACCTTAGAGTTTCTGAACTTTCTGACAATAGATGTAAATTAGAAGTTGAACTGGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACACNAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAG
  3   1   3        nb Brn3 FLt3 out                        CAAK3641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTTGAACTGCATTAAAAGAAGCAGAAATCGATGAAATAAAATTATTACTAGAAGAATGCAAAGTACAACAGCAGGAAGTCATGAAATGTCAAATTAATAAGAAAACCGAAACTTGGAAAAGGAGATATTGAGGTTGAATAGCTTGATTCGGGTGCAGGATGATAAACAAGAACAGGGACTAGTGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGAC
  3  -1   3        nb Ovi1 PIPE out                         CABI423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTCCTATAGGGCGAGAGGCGGAACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGA
  3   1   3        nb Egg                             TEgg035m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTGAAGCATTGTTGTCAGCTGAAAAAAATCTGTGCATTTCAGAACTTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAAAAAAAAAAAAAAA
  3  -1   2       add Te1       in                         CBWN9201.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTCCAGCTTGAATGGCTGCCCCCGTGGCTACGCGGCAGCTTGTTATCTAAATTATAGTGGTGTTGCTGTGGCAGACACACCAGTTTTGCCGGTGCAGGGCAGCAGTGCATTATATTTTTATTACTTTAAAGCTCTTTCATTTTTTAGTGTTACTGTTCCTTTAACACAAGGGATTTCAGAAGTAAATAGGTTAATTTAAACCAGGTGCAGATAATAGCTGCTTAGGTAAGACAATTATACAATTAAGTTATAGAACTTGCACCTTAAAAAACAAAGGAAAAGTGAAAGTTGTCCTTTCAGAATGTTTGTATTTATATATATTTTTTTTACCAGTATGCAGTGTTAATCAATCAAACTCTTCTATCCTTTTGACCTCTCTTAAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTAC
  5   1   2       ext Spl2      in                        CBSS1404.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTAAATAGACATGAAACTGAGACCAGTCTATTTCAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTG
  3   1   3        nb Egg       in                    TEgg035m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGAAGAAATCAGTAGTCTGACACGTGCACATAAGCAAGCATTAGAAACAGAGTGTGGACTATGTCAGCAAGTTAATGAATTAAGAAGTAGATTAGATGAAAATGTAAAAGCGCTTGAGAAACAAACAGAACTCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Hrt1      in                         CAAQ1874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAACAGACTCCCAAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCT
  5   1   2       ext HdA       in                  THdA026i05.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGAAAAGACTTTAAATGAGCAGAAAATGAAATATGAGACTGCTATTCAGAAGCTTGAAGAAGAGCAAGAACAAATTTTGCTTGCACAAAAACAAGAAAAGGAGTTGCTCCTTCAAACATTTGCACATGAGAAAGAGGAAGCTGTTAAAAAGTTTAAGGCTATTGAACAAGAACTATTAGAAAAAGTATGTCAAGTTGAACAGCAAGTAAACCAGAGCTCTACTGAATTTGCAGTGCCAGAAAATGCCCCTAGCTTGGTCTATAAGCTTCAAGAACAGCTTCAAAAAGAGAAGCAGTCCTTCACAGAGCAGCTTGAACACCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACAGCATGATGGCTGTTCATGATCTTACATTGTC
  5   1   3        nb Tad5      in                         XZT10554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCCAGGAAAGGAAAAGGAATGAGGAGATGCAAAGTCTTAAGATTTCACTGATTGCAGAACAACAGACAAACTTTAACACAGTTTTGACAAGAGAAAGAGTGAAGAAAGAAAACATTATTAGTGAGATCAATGAGAAATTAAAGATGGTTACACAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTANACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAAACAGAAAGTATAACCATTCTACA
  3  -1   2       add Kid1      out                        CABA5873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATAAATACGGTAGTTCAAATATAACACTAAAGCTTTTATGAAACAGATACTTGTTGCAAAATATCTTTATTCTGGGGGACATTTTATTTTTACTGCTTATTTATTTTGCTCTTGGAATGATCTCTGTGAAATATTTGCTTTAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCAGTAAGTACAAACTCGCTGATTGTAGTGTGTTCTAGGAGAAGGGATTTACAACATGGTGTACTTAATGTAATTCTTTATTCTTCTTGCTCTGGCTTATTGAAAAGTCCATACACTGACTTTTCCAGGTAATGTCAAAGTTTGTACTGAAAGGACTCAGTCAGTGGAGGCACCATAAAATGGCCTAccttaaaggacatgtaaacccctcacaaaaaatctaatcagtgaacagcctttttaaagtctttaaatacctgccactcctgttatttaaaaggttaataggctgcagcatcgccttaatcacttgggattccttttcctcctctaaccccctactttaggaattgacttttgctcttggctaactgagcatgctcagttcttctcggctcagattaccagacacacacttcagtctagcagcccatgaggagatggcactgctaggttctatagaaacgctattctagctgtgcactctgctgg
  5   1   2       ext Ovi1      in                        CABI12501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATCGATTCGCAACAGCAGGACAGAGATAAAGATTTAATTGAAACACTGTCTGAAGACCGAGCTCGTTTGCTTGAAGAAAAGAAAAAACTTGAGGAAGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTT
  5   1   2       add Limb      in                       CBSU10142.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGACGCGTCCGGGNGTAAACATTTATTAACCCGCATTAGTAAAATACACTAGAGGAACTGCATTTACATTAGGTATATATATCTATGAGACCATGGCAAATAGTATGCTTGATATCTGGACTCTTGCATACATTTAAAGATTTCTTTAAATGGATACAAGAGTGCATTTCAAGAATCAAGTGCATTTGGTATTTTTTAATTTAGTTTAAATGTAGTTTCTTTAGATATGATAGAATAATCTGCTGACAGTATTAGGTTTCATTTTGACCATTATCTTACATGGCCGAGAGATGCTTTTTATTGGTGAAGCCTACTTCTTCTCTGATCTTGAAAGCACAATAGTAAAATTCAACCATGCAAACTAGGGGACAGATATGTTAATGGTCATTATGTGGCGATCTTTGAACGGTACTTATGCTTTTTGTTTACGAGTAGCACTGTTAATAGGTGATGGAGATTGGCGAAACATTGTCACAAAGGCAGGGAAATATTTACACATATTCTTAATTGTAATTATTACAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGT
  5   1   2       ext Int1      in                         CAAP1495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAGTTGCCAGGCTACACAGTTCTAATGTTGCCATGTTAGCTCAGGTGACTGTGGCCTCTGAACCTAGTGGAGCCTCTGCACCTGACTTTCCCTCTGAAATCGATAGACCAAACTTTGATGCCACAGTCTTTGAGGAAGAGAAATTGGAACCTAGTATTGAAACCAGCATGATGGCTGTTCATGATCTTACATTGTCAGAAGAAAAGCAGAAGATAATGCAGCTTGAAAGAACTTTGCAGCTAAAAGAAGAAGAAAATAAACGTTTGAATCAAAGATTGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCANATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTTGAATGTGGACCNAAGAGGAGTG
  5   1   2       add Tad5      in                           XZT118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTCTTTCTCATTCATTTGATTGGGAAATGTGTTTGTGACACAAAAGGAAGCAACCGCAGGCAGGGCATGGTGCTTAGAATGCAATGATTCTCCCATACAAAAGTGAAGCATTCAAATAAGCCATGCGCCATTATCCCAAAGATAAATTCATGGGATAGATTTCCTTATAAAACCATTTATATATAAAACCACTCACCCACCCACTGAATGTAACTACAGTTCGTAACAGATTACTTTAACTTGTAGAGTTCTAATATATGCTGTCTTTTTCCCTAGATGTCTCAAAGCATGTCTTCAGTATCTTCAAGACATTCAGAAAAAATTGCTATTCGAGACTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTNGTGTAAATTTACTTTTTTTA
  3  -1   3        nb Sto1      in                         CABG1264.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCCAGGTTGGAGACTTAGTACTTATTATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCCTCAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAA
  5   1   3        nb Fat1      in                          CABC816.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATCTTGGATGAGCGTCATGATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCCTCAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTTGTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAAATG
  5   1   3        nb Gas7      in                         XZG59060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAATTATGTGTTGTTTACTGTCAGCCCAACTTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTNCAGACAAANAAAAGAATAGATATCCNACAGAACTCATTTCATTTCTTT
  5   1   2       ext Fat1      in                         CABC1146.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGTACTTCTTGCATTCGGAATCTCTTTCTTCACTAGATCTTAAACCAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAANAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATG
  5   1   2       add Fat1      in                         CABC7320.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGATTCAATTCGGCACGAGGCTTTTTCATACCGTTGAACATACTTTGCATCTGATTGACTGACTTTTTTTTCTTTGTTTTAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTTATGTAAAGAAATCATATTGATAAATTGTATTTTATGGGT
  3   1   3        nb Lun1      in                         CABD4465.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAG
  3   1   3        nb Gas7      in                         XZG63490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACTTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTC
  5   1   3        nb Gas7      in                         XZG63490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGTGCCATGGAACAAGAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACTTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAAAAAAAAGG
  3   1   2       ext HdA       in                   THdA026i05.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATTTAAAGTACCCCTGGGTACTAGTTTTACCGGGTCAAAGCAGTGCCATGGACAAGAAAGTATACCCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCGAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAACAATAAAGATTTAACCTTAAAAAAAAAAAAAAAAGCG
  5  -1   2       ext Lun1      in                        CABD12893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAAAAGTATAACCATTCTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTT
  5   1   1       add Te1       in                         CBWN9201.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATCGATTCGATCGTCGACCCCGCGTCCGCAGTCTCTGGCCACAGTACCTGTTCAGAAGGNCAAACAGCAGGTCTGCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTG
  3   1   3        nb Lun1      out                        CABD1764.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCA
  3   1   3        nb Te3  5g3  out                        CAAM6262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTG
  5  -1   3        nb Sto1      in                         CABG1264.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGTTAATATATCTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACGATGTAGACTTTTAAA
  5   1   2       ext Gas7      in                         XZG28246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGT
  3   1   4      seed Fat1      in                         CABC6950.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTATCATTTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGC
  3   1   2       ext Int1      in                         CAAP1495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGT
  3   1   2       ext Ovi1      in                        CABI12501.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGT
  3   1   2       ext Brn3      in                         CAAK8137.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCGAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGT
  3   1   2       ext Gas7      in                         XZG28246.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGT
  3   1   3        nb Gas7      in                         XZG59060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTAAGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCGT
  3   1   2       add Limb      in                       CBSU10142.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTTCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGT
  3   1   2       ext HdA       in                   THdA018e12.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGGTAAAAAAAAAAAAAAAAAGCG
  3   1   2       add Fat1      in                         CABC7320.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGNTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGTGAAAAAAAAGCCTCTCGC
  5   1   3        nb Kid1      in                         CABA6185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCAAATCAGAGGATTCTGCATATCTGCCCCANGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATGTACATTAACCCTA
  3   1   3        nb Kid1      in                         CABA6185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTNTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTT
  3   1   3        nb Tad5      in                         XZT10554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCCCAGTTTTTAAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAACAGGTTCATATGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAATGACATGTAGACTTTTAAAACAATAAAGATT
  3   1   2       ext Fat1      in                         CABC1146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTACTNTGAAATGTGGACCAGAGGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGNTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGTGTAAAAAAA
  3   1   2       add Tad5      in                           XZT118.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCAAGGGGAGTTGATTTTTCCAAAGGGTATAAATGGTGGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACAGTGTAGACTTTTAAAACAATAAAGATTAAAC
  3   1   3        nb Te3       out                        CAAM9602.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTG
  3   1   2       ext Spl2      in                        CBSS1404.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGGACTAGTTCTAGATCGCGA
  3   1   3        nb Fat1      in                          CABC816.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGTGT
  3   1   2       ext TbA       out                   TTbA068c18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATTTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTTTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTTTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCCAATAAAATAAGGGAAATTGAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       ext Ova1      in                         CABE7267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTAGCTTGTACTTAAATGTGNAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTTTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGTGT
  3   1   2       ext Ski1      in                         CABJ8684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGTGT
  5   1   2       ext Ski1      in                         CABJ8684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTAAATGTTTGAAAATTTGTGTTTTACAAACAGGAACCTGAACTGTATATATGAAAAGTCAAAGGATCCTGCATAATTTACTTCATGCATCTAAGTTATGTGAAAAGTATGTTATGGTAATGTTTTCCAATAAAATAAGGGAAATTTGTGTAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAP8631.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAATACACTAGAGGAACTGCATTTACATTAGGTATATATATCTATGAGACCATGGCAAATAAGTATGCTTGATATCTGGACTCTTGTATACATTTAAAGATTTCTTTAAATGGATACAAGAGTGCATTTCAAGAATCAAGTGCATTCGGTATTTTTTAATTTAGTTTAAATGTAGTTTCTTTAGATATGATAGAATAATCTGCTGACAGTATTAGGTTTCATTTTGACCATTATCTTACATGGCCGAGAGATGCTTTTTATTGGTGAAGCCTACTTCTTCTCTGATCTTGAAAGCACAATAGTAAAATTCAACCATGCAAACTAGGGGACAGATATGTTAATGGTCATTATGTGGCGATCTTTGAACGGTACTTATGCTTTTTGTTTACGAGTAGCACTGTTAATAGGTGATGGAGATTGGCGAAACATTGTCACAAAGGCAGGGAAATATTTACACATATTCTTAATTGTAATTATTACAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGAGATATATTAACTGTAGAATGGTTATACTTTCTTGTTCCATGGCACTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAA
                                                  Xt7.1-CHK-1008285492                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTAGAGGAACTGCATTTACATTAGGTATATATATCTATGAGACCATGGCAAATAAGTATGCTTGATATCTGGACTCTTGTATACATTTAAAGATTTCTTTAAATGGATACAAGAGTGCATTTCAAGAATCAAGTGCATTCGGTATTTTTTAATTTAGTTTAAATGTAGTTTCTTTAGATATGATAGAATAATCTGCTGACAGTATTAGGTTTCATTTTGACCATTATCTTACATGGCCGAGAGATGCTTTTTATTGGTGAAGCCTACTTCTTCTCTGATCTTGAAAGCACAATAGTAAAATTCAACCATGCAAACTAGGGGACAGATATGTTAATGGTCATTATGTGGCGATCTTTGAACGGTACTTATGCTTTTTGTTTACGAGTAGCACTGTTAATAGGTGATGGAGATTGGCGAAACATTGTCACAAAGGCAGGGAAATATTTACACATATTCTTAATTGTAATTATTACAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGAGATATATTAACTGTAGAATGGTTATACTTTCTTGTTCCATGGCACTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTG
  5   1   2   10  ext Int1 5g3  in                         CAAP8431.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAATACACTAGAGGAACTGCATTTACATTAGGTATATATATCTATGAGACCATGGCAAATAAGTATGCTTGATATCTGGACTCTTGTATACATTTAAAGATTTCTTTAAATGGATACAAGAGTGCATTTCAAGAATCAAGTGCATTCGGTATTTTTTAATTTAGTTTAAATGTAGTTTCTTTAGATATGATAGAATAATCTGCTGACAGTATTAGGTTTCATTTTGACCATTATCTTACATGGCCGAGAGATGCTTTTTATTGGTGAAGCCTACTTCTTCTCTGATCTTGAAAGCACAATAGTAAAATTCAACCATGCAAACTAGGGGACAGATATGTTAATGGTCATTATGTGGCGATCTTTGAACGGTACTTATGCTTTTTGTTTACGAGTAGCACTGTTAATAGGTGATGGAGATTGGCGAAACATTGTCACAAAGGCAGGGAAATATTTACACATATTCTTAATTGTAATTATTACAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGAGATATATTAACTGTAGAATGGTTATACTTTCTTGTTCCATGGCACTGCTATCAATTCTCTGGCCACAGTACCTGT
  5   1   4   10 seed Int1 5g3  in                         CAAP8631.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAATACACTAGAGGAACTGCATTTACATTAGGTATATATATCTATGAGACCATGGCAAATAAGTATGCTTGATATCTGGACTCTTGTATACATTTAAAGATTTCTTTAAATGGATACAAGAGTGCATTTCAAGAATCAAGTGCATTCGGTATTTTTTAATTTAGTTTAAATGTAGTTTCTTTAGATATGATAGAATAATCTGCTGACAGTATTAGGTTTCATTTTGACCATTATCTTACATGGCCGAGAGATGCTTTTTATTGGTGAAGCCTACTTCTTCTCTGATCTTGAAAGCACAATAGTAAAATTCAACCATGCAAACTAGGGGACAGATATGTTAATGGTCATTATGTGGCGATCTTTGAACGGTACTTATGCTTTTTGTTTACGAGTAGCACTGTTAATAGGTGATGGAGATTGGCGAAACATTGTCACAAAGGCAGGGAAATATTTACACATATTCTTAATTGTAATTATTACAGCTTCTGGCTCATCAAGAAGACCCTGGGTTTTGGGAAAAGTAATGGAAAAGGAGTATTGTCAGGCAAAAAAGGCGCAAAACAGATTTAAAGTACCCCTGGGTACTAAGTTTTACCGGGTCAAAGCAGAGATATATTAACTGTAGAATGGTTATACTTTCTTGTTCCATGGCACTGCTATCAATTCTCTGGCCACAGTACCTGTTCAGAAGGCCAAACAGCAGGTCTCCTTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAAGATTCTGCATATCTGCCCCA
  3   1   4      seed Int1 5g3  in                         CAAP8631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCATGCACTGCTATCATTCTCTGGCCCAGTACTGTTCAGAGGCCAAACAGCAGGTCTCCTTTGATACTAAGGTTGGAATAGCAGTTAGTCCTCACTGGTGTTGTAAATTTACTTTTTTTAAGGTTCATGTTGTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTTAACCCAAAGTACTTTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTCCTCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTG
  3   1   2       ext Int1 5g3  in                         CAAP8431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCATGTGNTAGAAATGTAAATCAAATCAGAGGATTCTGCATATCTGCCCCAGTTTTTAACCCAAAGTACTNTGAAATGTGGACCAAGAGGAGTTGATTTTTCCAAAGGGTATATATGGTGTTCATGCTGACTTTTAACATGCTTCCTGCCTGTTAACTATAAATTAGCTTGTACTTAAATGTTGAATGTTAGTTACTATAATTACCAGCATTTGTCTTTTTGTGAAACATTTATCTAAAGTACTTGCATTCTTCAACTCTTCCTTTATAATCTGTATAAATCTGACAGCTATTTAAAATAAGGACTGTTTATGGCATGCTGATAATCATCATTTAATTTAATATGAATTTGCCTCAAGACAAAAAAAAGAATAGATATCCAACAGAACTCATTTCATTTCTTTTCAAAGGCTTGTTAATGTTTATAAACCATTTGACAGGCTGGTCACTGCAGTTTTCCAATGCACTTTCAACTGATTTCTTGTGGACATACTCAAGGGAAGAATGTATACAGCACCAAGTATATAGGCTGTGCTAAAGCATTCCCAACGATACAGAAGTCTTCTATTATGTTAAAGAAATCATATTGATAAATTGTATTTTATGGTTGAGTTTCATGCAAAAAAAGGTTCATTGTACATTAACCCTACCGAAGTAACAAATTATTGTATTGCAAAAGACATGTAGACTTTTAAAACAATAAAGATTTAAACCTGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)