Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012073187 Xt7.1-TNeu112i23.3.5 - 119 ESTs
                                                                       ...-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu112i23.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008222769                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           4     6     8    12    16    20    19    21    19    21    21    22    22    22    23    24    21    24    22    24    23    25    22    25    24    26    23    26    26    26    23    26    25    26    25    26    26    27    25    27    24    27    26    27    26    27    27    28    27    28    27    28    27    28    27    28    27    28    27    28    27    28    30    31    30    31    30    30    30    30    29    30    29    30    29    30    29    30    28    29    29    30    29    30    29    30    28    29    27    29    26    28    26    27    25    27    24    25    17    22    19    22    19    22    19    21    19    20    18    18    19    20    18    19    19    19    18    18    17    17    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    16    15    16    15    16    14    16    11    12    11    12    11    12    10    12    10    12     9    11     9    11     9    11     9    11     9    11     8    11     9    11     9    11    10    12     9    11     9    11     9    11    10    12    10    12    10    12    10    12    11    13    11    13     8    13     7    15     8    15     8    14     9    13     9    13     8    12     8    12     7    12     9    11     9    11    10    12    10    11    12    12    12    12    11    11    10    10    12    12    12    12    13    14    15    16    17    17    17    17    17    17    17    18    18    18    18    18    18    18    19    19    19    19    19    19    19    21    20    21    20    21    20    21    20    21    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    17    18    17    19    17    20    17    20    17    20    17    20    18    21    17    21    18    21    17    20    16    19    16    19    17    20    17    20    17    21    17    21    13    19    15    19    16    20    16    20    16    20    24    33    22    31    22    36    21    36    21    36    20    36    21    38    21    40    21    40    21    42    20    41    20    48    21    47    22    49    44    48    46    52    47    53    48    55    49    55    49    54    50    56    50    55    50    54    49    54    53    55    53    55    51    56    52    55    52    55    52    54    48    55    49    55    52    55    55    55    54    55    48    55    54    55    53    55    52    56    54    56    49    56    50    56    49    56    40    57    32    55    31    55    31    55    34    55    30    54    26    54    27    54    27    54    27    54    27    54    26    53    27    52    22    53    23    54    31    53    22    53    22    53    22    52    21    52    21    52    20    52    21    52    24    46     5     9     3     4
  5   1   2  SIG                                    Xt7.1-TNeu112i23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCAGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                            Xt7.1-CABJ781.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGCTGCCTGAGGAAACGCATCGCCACCGCGGTCGCTGGGGAATAATTCACTAAACTCATTATCTCCTTTTCTCTTCCCCTTTAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGTAAGTTATTTTCAATGCCATGTATAAGCCATTCAGACATACTTTCAAGAAATATCTAGGGCAGCAGATATGTCGGTCTTCTCTCCAAACCTTCAAGTTCAAGTATCCAAGTGGGGTGTCCGTTAGTTACAACAAGGTTACAGACTGGTCCCCATTCTGATTTGGCCAACCCCCATAGTTAGATTGATGGTGGCTAAGGGAAACTTGNGAAGACCTCAGCAATAAGGGGCATACTCTTCACTAGTAATACAATCAGCTGACTGCAGTAACAATCTGGGGCATTTGTGCCATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTGGNAAAAGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --G--T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---C--T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------AC-
                                               BLH ATG     168    1384                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN     168     197                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR     168      53                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI      16      36                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG     168       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 4e-030     NP_508865.1 friend leukemia integration 1 like (XF694) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bb ==== 3e-037     BAE46385.1 Ets1/2 [Branchiostoma belcheri] ==========================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 6e-053     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 1e-057     BAE06419.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 5e-082     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---= 5e-132     NP_001018874.1 hypothetical protein LOC326672 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 0          NP_035939.2 E26 avian leukemia oncogene 2, 3' domain [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 0          NP_005230.1 v-ets erythroblastosis virus E26 oncogene homolog 2; Oncogene ETS-2; v-ets avianerythroblastosis virus E2 oncogene homolog 2; v-ets avian erythroblastosis virusE26 oncogene homolog 2; human erythroblastosis virus oncogene homolog 2 [Homosapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 0          NP_990643.1 v-ets avian erythroblastosis virus E26 oncogene homolog 2 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          AAH77264.1 LOC397877 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 0          NP_001081505.1 X1-c-ets-2b protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu112i23.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAG---------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TGA------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TAA---------------------TAA---------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGA---------------------------------TAA------------------------------------------------------TAG---------------------------------ATG------------------------------------------------------------------------------------TGA---------------------TGA---------------------------------------ATG------------------------TAA---------------------------------------TGA---------ATG------------------------------------------------------------TAA------TAG------------------------------------------------TGA---------------------TAA------------ATG------------------------------TGA------------ATG---------ATG------ATG------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2  SIG                                    Xt7.1-TNeu112i23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCAGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008276828                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg092o24.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCCCGCAGTACAGGAGCACAGTCTGCAGCAAGCTCCGGATTGGGAGCATTTGTACAGTCAGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTTTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGCTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGATAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   0       chi Tad5      in                         XZT55236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGAATATAAGAATATTCCGTAGATATTTTTTTATTTCAAATATATCAAAATTAAGACCAAGGGGAAACCAAAGCCAAAGCCCAAGACCCATTTTTTTTTCTTTATATTTTCTCTTGACAAATTCTTTTATATCAAACTAAATATTTTTTTTCCTCTGTTAAGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAGTAAGTCACATTTGTCCCATTTAACACAATAATCGGCCGGTCATTGTGCCGGCTGATGTAGCGTGACGGCCTCTACAGAGCATGGCAGGCAATGACAGTAATGTGACCGGATGCAGCTGTCTTGTAGCAATGTTCTGTTGCGCTGATTTATGTCCCATTGTGGCAGTTGGTATCGGTCATCAACTGACTGAGCATAGTTGGTAGTGTTAATCCCAAATTAAGTTGCATTGTCTGTATAGAAGATTTCCGTAGAGCCTTGCCTTTAATGCTGTTCTTCTATGGTTTCTGTAGACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAGAATGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTCCCGCTGATCCCTGCA
  5   1   2       ext Egg  FL                        TEgg092o24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGCTGGATACATGAGCTCACTCTGCAGCAAGCTCCGGATTGGGATCATTTGTACAGTCATCGGCAGCGGAAAAATGGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAAGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCTCCTGTGGATTGTTTGAGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCTATGACCGAGTTTGGAATTATGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACATACGAATGCTCAAGCACCAGTTTGCCTTCGACAATGTCATCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAACAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGAGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAA
  5   1   2   14  ext Te4  5g3  in                         CAAN8343.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCATTTGTACAGTCAGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTATGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGANAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGGAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGAC
  5   1   3        nb Neu  5g                       TNeu067j24.p1caSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGTCAGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAGACGGACAGGGGGGCTTAGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAGCGTGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTGCCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGT
  5   1   2       ext Gas  5g3  in                   TGas130p21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTCAGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAGAATGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCT
  5   1   3        nb Egg  5g                        TEgg117h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGCGGCAGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAA
  5   1   3        nb Gas  5g                        TGas007p12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGCGGCAGCGGACTAAGGGCGACTGCAGCGCAAACGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTNGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTANGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTG
  5   1   3        nb Gas  5g                        TGas097d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGCGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGG
  5   1   3        nb Gas  5g                        TGas141a23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTT
  5   1   2   10  ext Bone 5g3  in                        CBTC4187.fwd .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGAGAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCTGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAGAATGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGANAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATNCAGTAAAAGCCCAGGAGTCATACATTGACCAT
  5   1   2       ext Gas  5g3  in                   TGas106m15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACTAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCT
  5   1   2       ext Gas  5g3  in                   TGas123o22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGACTAAAGGCGACTGCAGCGCAAACGCCAGGGGGGCTTAAGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGAGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAAGGACTTCGCCCCAGCTACTCAAGGCCAATGACCGAGTTTGGAATTAAGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAAGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAAGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAATGGCTGCTGTGGGCCGCCAAAGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACA
  5   1   3        nb Neu  5g                        TNeu061b16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAGGGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGC
  5   1   3        nb Gas8 5g                               st64c05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTANGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAAGAAATGATGAAAGAACATCAAGTA
  5   1   3        nb Gas8 5g                               st71d10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAA
  5   1   3   12   nb Gas7 5g3  in                         XZG50552.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTATGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAGAATGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACTCTCCTCACCCCCAA
  5   1   3        nb Gas  5g3  in                   TGas065f03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAAGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAACGTG
  5   1   3        nb Gas  5x3  out                  TGas138p14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGACTGCAGCGCAAACGGACAGGGGGGCTCAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAAGAATGCTCAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTC
  5   1   4   10 seed Hrt1 5g3  in                         CAAQ8643.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGACTGCAGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAA
  5   1   3        nb TbA  5g                        TTbA046l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGACTGCGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATCGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATCTCNCTTGGAAACGTGAATTTTTCAAAGTTTCTCATGAATGGACATGAGCTGTG
  5   1   3        nb Neu  5g                        TNeu027f08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGACTGCAGCGCAAACGACAGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTANGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGA
  5   1   3        nb Gas8 5x3  out                         st76l04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGCAAACGGACAGGGGGGCTTAGGGTTCCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTGGCCTTTGGATTGTTTGTGGATATTTATATATTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCTAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTANGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCAT
  5   1   3   12   nb Gas7 5g3  in                         XZG36103.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGGACTCCGAGGCTGGGAATCGCGGGATACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACC
  5   1   3   12   nb Gas7 PIPE in                          XZG6593.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTATTAACGCTCAGTGTCGCCTTTGGATTGTTTGTGGATATTTATATACTTGGGAGGGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAGAATGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCCA
  5   1   2   10  ext Spl1 5g3  in                         CABK8183.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGACTTCGCCCCAGCTACTCAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCANATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGG
  5   1   2       add In62                            IMAGE:8955377.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTTCTAAATTCTGGCAATTGCGAGACTATGATTCAGAGACAGCGGCACAGAAGCTTCGAGAGCACCGATCATGCTACAGTCTGACGAGCCAGTCTTCCCTTGTAAAATGCAGGAGTTCTTCGATGACGCTTTGAGAAGATGCAGCAGCGTTATGTGATAGCACTATGTCTTCAGATTATCAGACATTGGACAGCGACTGGCACTGATCGCCTTATCCTGCTCAGATGAATTCGTAGGATCTGTGACTACGCAATCTGCCTTATACTGACGGACAGTGAATACA
  5   1   3        nb Thy1                               CBST13154.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTCACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAAGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCANATTGCGAGACTATGATTCANGAGACAGCGGCACAGAAAGCTTCGAGAGC
  5   1   3        nb Tad5      in                         XZT48072.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAGAATGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTTTGAATAGCCACCTATGTCCTTCAAGATTACATTCAGGACAGATGTGAGC
  5   1   2       ext Sto1      in                         CABG1291.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCACCTATGTCCTTCANAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAAT
  5   1   3        nb Gas8      in                          st51k23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACG
  5   1   3        nb Gas                            TGas064k21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTACGGACAA
  5   1   3        nb Egg       in                   TEgg014b07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTTTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGCTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATC
  5   1   2       add Bone                                CBTC2294.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCCATTTAGGTGCAGTAACCCAAAGCAACCAGTTAGTTTTCAGTCTAGTGCTGGTATATTATATGCAAATGTCTTAGGCGTGCACTGTTTTCTTCAAGATGCCAGTAGACACATTGAAATGTAACTATTTCAAATATGTTCAGGGCTTCCTGTAAGAATTCTTGCGTTTGTCCTCTAGGCAAATTGCGAGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACTGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAAACTTGTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACAC
  5   1   3        nb Egg       in                   TEgg022a19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACTATGATTCAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCACCTATGTCCCTTCAAGATTACA
  5   1   3        nb Gas       in                   TGas132i20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGGAGACAGCGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTTTGAATAACCACCTATGTCCTTCAAAGATTACATTTCAGGACAGATGTGAGCCAGCCGAACTGGGCAACCTGTAATTTCCGCCTCTATACTCGC
  5   1   3        nb Egg                            TEgg114l21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCACAGAAAGCTTCGAGAGCACCGAATCCATGCTACAGTCTTGGACGAGCCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAG
  5   1   2       ext Neu       in                   TNeu112i23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGTCTTCCCTTGTAGACATGCAGCGAGTTCCTTCGTATGACAGCTTTGAGGAAGATGGCAGCCAGGCGTTATGTCTGAATAATCCACCTATGTCCTTCAAAGATTACATTCAAGACAGATGTGATCCATCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCATCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGATGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGATAAGCTCATTCGAAGGCTGAAGTATTATTACGACAAGAACATCATCCACAAGACATCATGGAAGATATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACA
  5   1   3        nb Gas                            TGas040g06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTGAGGAAGATGGCAGCCAGGCGTTATGTTTGAATAAGCCACCTATGTCCTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGCTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCCGAGTCGGATGGATGGCGC
  5   1   2       add Sto1      in                         CABG1192.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGGCTTTTGCTTACACAGCCTGGCACTATTTAAAAACAAATGACGGTTATCTTGACTTTGTTATAGAAATAAATATATTCTTATGGTCTGTTTTTTCTTCTGTAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCC
  3  -1   3        nb Sto1      in                         CABG4401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATAGGGCGAGAGGTTCAAAGATTACATTCAGGACAGATGTGAGCCAGCCGAACTGGGCAAACCTGTAATTCCGGCCTCTATACTCGCTGGCTTCACAGGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCCTGTGATGAAACCACATCCAAGGATCCGGGAGTCTTAATTGGCTNATGGCTATGCTGGTATCTAAGTGGTGTAGATATTGG
  5   1   3        nb Gas                            TGas030h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCGCTGGCTTCACAGGAGTGGACCAATCCAGTTATGGCAGTTCTTGTTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGATAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCGAGGTCGGATGGATGGCGCTTAATGATAAACCGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGC
  5   1   3        nb Bone      in                        CBTC3972.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTATGGCAGTTCTTGCTGGAACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACACACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATGGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTANAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCCTGTGATGAACCCACA
  5   1   2       ext Egg       in                   TEgg021n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAGAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTC
  5   1   3        nb Egg                            TEgg100f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTTTTAACGGACAAATCATGTCAGTCATTTATCAGCTGGACTGGGGACGGATGGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTATAGAACCTTTTATTTTCGCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCA
  5   1   3        nb Gas7      in                         XZG51425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAG
  5   1   2       ext Sto1      in                        CABG12101.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGTTCAAGCTGACTGACCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGGTTGGAAATAA
  5   1   2       add Brn4                                 CAAL9058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGATGAGGTGGCCCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGT
  5   1   3        nb Egg                            TEgg105g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGCGGCGGTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATG
  5   1   3        nb Gas7      in                          XZG1491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGTGGGGCAAAAGGAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGC
  5   1   2       add Gas7      in                         XZG22299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGGGCAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCCGGGGCACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATG
  5   1   3        nb Gas7      in                         XZG57983.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAAAGGAAAAACAAACCTAAAATGAACTACGAGAAGCTCAGTCGAGGGCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATGGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTC
  5   1   3        nb Gas7      out                        XZG48328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCAGTCGAGCCCTGAGGTATTATTACGACAAGAACATCATCCACAAGACATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATGGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGGAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTG
  5   1   3        nb Gas       in                   TGas087j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCAGGGAAGAGATACGTCTACCGATTTGTCTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATA
  5   1   3        nb Hrt1      in                         CAAQ8101.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCGACCTTCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATTGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATA
  5   1   3        nb Bone      in                        CBTC1184.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        NTCCGCACAACTTGTTGGGTTACACGCCGGATGAATTGCACGCCATGCTTGGCGTACAGCCCGACACAGACGAATGAGCCGCCGGAGTGTGAACTATAAAACAGTTTGGCTTGAAGAGCACATTATTGTACTGTGAATGGGATCTCGTTTGCTGGGCTGTCCAAGATGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTANGATG
  5   1   2       add Thy1                                CBST7344.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCCGAACGGCGCAGGCGTTCAAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGA
  5   1   2       add Gas7      in                          XZG5199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCGGCGTTCAAAGACTGGAAAGGCTAAAGACACCAAATCGGTGGCGTGAAATTAGCGCTTTGCTCTGGTTCCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTT
  5   1   3        nb Ski1      in                         CABJ9416.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGCGCTTTGCTCTGGTTTCCGAGGTCGGATGGATGGCGCTTAATGATAAACAGTTGCTAACTTGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAAAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGGAATATG
  5   1   2       ext Neu       in                   TNeu081p04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAAAAGAAGATTGCACATAAGTAACACATCATGTATGCTGCTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTATATATCCAATCAAAGCCAGGCGCCTGTTGATGAACCACAATCCAAAGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAAGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTGAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTATTGTATTTTAATGATGTAAATATTACATTAAGATGAGCGGCCGGGATTGCCATTTGTACATAAGAGATGTCTCGATTGCTGCAATTGGG
  5   1   2       add Tbd1      in                        CBXT13452.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGTATGCTACTCTCTGACTATTGCATCCCGCCTTAAAGAACCTTTTATTTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCACCAGGCTGACCATAAAATTTTTTTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCAGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGGTTT
  3   1   4      seed Hrt1 5g3  in                         CAAQ8643.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCCCCTCCACGAACGAGAAGAGAGGGCTTATCTTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAA
  3   1   2       ext Gas  5g3  in                    TGas130p21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGNGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu       in                    TNeu112i23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAAAGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAA
  5  -1   3        nb Sto1      in                         CABG4401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTT
  3   1   3        nb TbA  5x3  out                   TTbA014a14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTTTGCAGCCGTGTCATTTTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGAATGGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       ext Sto1      in                        CABG12101.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTAAAAA
  3   1   2       ext Spl1 5g3  in                         CABK8183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAA
  3   1   2       ext Egg       in                    TEgg021n08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas       out                   TGas138b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATNGATCTTTTTTTTGTGAAAAGAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Ski1      in                         CABJ9416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAGAAAT
  3   1   3        nb Gas       in                    TGas087j10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATGGGTTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Sto1      in                         CABG1291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGAAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTG
  5   1   2       add Gas                            TGas025l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTTTTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATATTTTTNAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTCTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTT
  3   1   2       ext Liv1      in                        CAAR10882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  5   1   2       ext Liv1      in                        CAAR10882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAGAAAAAAAAAAAAAAAA
  3   1   2       ext Bone 5g3  in                        CBTC4187.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTAGATATCCATCAAAGGCCAGGCGCCTGTTGATGAACCACATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATTTTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  3   1   3        nb Gas       in                    TGas132i20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAGAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Hrt1      in                         CAAQ8101.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  3   1   2       add Gas7      in                          XZG5199.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAGGCC
  3   1   3        nb Gas7      in                         XZG51425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTGTG
  3   1   3        nb Bone      in                        CBTC3972.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATTTTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  3   1   3        nb Bone      in                        CBTC1184.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATTTTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  3   1   3        nb Gas7 PIPE in                          XZG6593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAC
  3   1   2       add Sto1      in                         CABG1192.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  5   1   3        nb TpA       out                  TTpA023k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGTATCTAAGTGGTGTAGATATTGGCCTTTGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGACAGGTACATGTATATTTTACTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCAATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCAGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCACCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTG
  3   1   2       add Tad5      in                         XZT55236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGGTGTAGATATTGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACAAGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCCTTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGGTGGTTTGTTTTTGTTCTTTGTTTTCGCAAAGAAGCCTTGGGTTCCCCGCGGGGGGATTTCATGCTGATTGTTCGCAATATTGCCCAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAAAGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCCTTATATATATATATTTTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACCGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGGGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAGG
  3   1   3        nb TbA                             TTbA041p20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCCGGGGCCGGGGCCCCAGGGTGGCCATATACACTTTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCCTTTTCATCATTTCAAGGGTTGTAAATAATACCAGGTTTTATATTTTCAGAACTATTTTATTTTGTCAGGGACAAGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCCTTTGGATGGGCGGCCGGGATTGCCAGTTTGTACATAGGGGATGTTTCGATTGCTGCAAATGGGTGGGTTGTTTTTGTTTTTTGTTTTTGCAAAGAAGCCTTGGGTTTCCCGCGGGGGGATTTCATGCTGATTGTTTGCAATATTGCCCAACCAAAAGAAAGTCCTGTTCCCTCCTTTGGTGTATATAAAGGTCACGTTCCCCTTTTTTTTTATTTTTAATTGGTATTTGATTTCATAATATGAATTCCTTATATATATATATATTTTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCCGGGGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTTTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGGGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCCTGGGGAAAAAAACGAATGGATGGATTTATGATTAAAATGATTTTTTTTTT
  3   1   3        nb Tad5      in                         XZT48072.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCCGGGGCCGGGGCACCAGGCTGACCATATACACTTCTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACAAGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAAAGAAGCCTTGGGTTCCCCGCGGGGGGATTTCATGCTGATTGTTCGCAATATTGCCCAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCCTTATATATATATATTTTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  3   1   2       add Gas7      in                         XZG22299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGATATTGGCCGGGGCACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGGGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTTTTTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATATTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTCTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGAAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTG
  3   1   3        nb Gas                             TGas117o01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAGAAATAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas  5g3  in                    TGas123o22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAAAGTGATCATGGCATTTTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGGACAAGTATATTTTAGTTGTATTTTAATGAGGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTTTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCCCGCGGGGGGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAAAGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAAAATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAACCACTAATAAGCGGAATAAATTAAAACTaaaaaaaaaaaggaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext Neu       in                    TNeu081p04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCCGGGGCACCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAGAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                          XZG1491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCGGGGCCCCAGGCTGACCATATACACTTTTTTTTTTTTTTTTAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTT
  3   1   2       ext Gas  5g3  in                    TGas106m15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAGAAAAAAAAAAAAAATAAAAA
  3   1   3        nb Gas7 5g3  in                         XZG36103.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATACACTTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTTTCATCATTTCAAGGCTTGTAAATAATACCCGGTTTTATATTTACAGAACTATTTTTTTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGAGGTAAATATTAGCCTTAGGATGAGCGGCCGGGATTTCCAGTTTGTACATAGGAGATGTTTCGATTGCCGCAATTGGGTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCCCCCGGGGGGATTTCATGCTGATTGTTCGCAATATTGCCCAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTAAATAAAGGTCCCGTTCCCCTTTTTTTTTTTTTTTTTTAAATGCTATTTGATTTCATAATATGAATTCCTTATATATATATATATATTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCCGGAGTAATGTGTGTAGCAGCTATTTGTACCGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCCTGGGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAGGG
  3   1   2       add Tbd1      in                        CBXT13452.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCAGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTTGTGAAAAGAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg014b07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg       in                    TEgg022a19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTT
  3   1   3        nb TbA       out                   TTbA061k15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTTTCGATTGCTGCAATTGGGTGGTTTGTTTTTGTTCTTTGTTTTCGCAAAGAAGCCTTGGGTTCCACGCGGGGGGATTTCATGCTGATTGTTTGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTCTTTGAAAAAAAATTGTATTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTT
  5   1   3        nb Gas7                                 XZG20747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGA
  5   1   2       add Tbd1      in                         CBXT7061.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCGAATTTCCGTCCGACCCACGCGTTCCGATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCAGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTTGTGAAAAGAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG57983.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATTTTCATCATTTCAAGGCTTGTAAATAATACCCGGTTTTATATTTACAGAACTTTTTTTTTTTGTCAGGGACACGTATATTTTAGGTGTTTTTTAATGAGGGAAATATTAGCCTTTGGATGGGCGGCCGGGATTTCCCGTTTGTACATAGGAGATGTCTCGATTGCCGCAAATGGTGGGTTTGTTTTTGTTCTTTGTTTTCGCAAAGAAACCTTGGGTTCCCCCCGGGGGGATTTCATGCTGATTGTTCCCAATATTGCCCAACCAAAAGAATGTCCTGTTCCCCCCTTTGCGGTATATAAAGGTCCCGTTCCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCCTTATATATATATATTTTTTTTAAAAGTATTTGCCCCCTTTTCATAGGCCCGGGGTAATGTGTGTAGCAGCTTTTTGTACCGGAAAAAAGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTTAACAAGGGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCCTGGGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGGGG
  3   1   3        nb Gas7 5g3  in                         XZG50552.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCATTTCAAGGGTTGTAAATAATACCCGGTTTTTTATTTTCAGAACTTTTTTATTTTGTCAGGGACAAGGATATTTTAGTTGTATTTTAATGAGGTAAATATTAGCCTTTGGATGAGCGGCCGGGATTTCCAGTTTGTACATAGGAGATGTCTCGATTGCCGCAAATGGGGGGGTTGTTTTTGTTCTTTGTTTTCGCAAAGAAGCCTTGGGTTCCCCGCGGGGGGATTTCATGCTGATTGTTCGCAATATTGCCCAACCAAAAGAAAGTCCCGTTCCCTCCTTTGCGGTATATAAAGGGCCCGTTCCCCTTTTTTTTTTTTTTTTAAATGCTATTTGATTTCATAATATGAATTCCTTATATATATATATATATTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCCGGAGTAATGTGGGTAGCAGCTTTTTGTACCGGAAAAATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGGGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCCTGGGGAAAAAAACGAATGGGTCGATTTATGATTAAAATGATCTTTTTTTTGTGG
  3   1   2       add Tbd1      in                         CBXT7061.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCAGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTTGTGAAAAGAAAAAAAAAAAAAAA
  3  -1   3        nb Gas8      in                          st51k23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGGTTTGATATTTACAGAACTATTTTATTTTGTCCGGGACATGTATATTTTAGTTGTATTTTANTGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGNNCNTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGNGGTGATTTCATGCTGATTGTTCGCAATANTGCACAACCNAAAGAATGTCCTGNTCCCTCCNCTGCTGTATANAATGGNCACGNTCCCTTTTTTNNTAATNTTNAANNGC
  3   1   3        nb Gas  5g3  in                    TGas065f03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTTTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAAAGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATAAGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAAGCGAATGGATCGATTTATGATTAAAAGTGATCTTTTTTTTGTGAAAAGGAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Te4  5g3  in                         CAAN8343.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATATTAGCCTTTGGGTGAGCGGCCGGGATTTCCCGTTTGTACATAGGGGAAGTCTCGATTGCCGCAAATGGGGGGGTTGTTTTTGTTCTTTGTTTTCGCAAAGAAGCCTTGGGTTCCCCCCGGGGGGGTTTCCTGCTGATTTTTCGCCATATTGCCCCACCAAAAGAAAGTCCCGTTCCCCCCTTTGCCGTATATAAAGGGCCCGTTCCCCTTTTTTTTTTTTTTTTTAAATGCCATTTGATTTCCTAATATGAATTCCTTATATATATATATATTTTTTAAAAGTATTTGCCCCCTTTTCATAGGCCCGGGGTAATGTGTGTAGCCGCTATTTTTCCCGGAAAAAAGTTTTGTTTTGGTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGGGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCCTGGGGAAAAAAACGAATGGGTCGGTTTTTGATTAAAATGATCTTTTTTTTGTGG
  3   1   2       add Gas7      in                         XZG58170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGTCCGCTCGATTGCTGCAAATGGGTGGTTTGTTTTTTGTTTTCGCAAAGAAGCCTTGGGTTCCCCCCGGGGGGATTTCATGCTGATTGTTCGCAATTTTGCCCAACCAAAAGAATGTCCCGTTCCCCCCTCTGCTGTAAATAAAGGGCCCGTTCCCCTTTTTTTTTTTTTAATTGCTATTTGATTTCATAATATGAATTCCTTATATATATATATTTTTTTTAAAAGTATTTGCCCCCTTTTCATAGGCCCGGGGTAATGTGGGTAGCCCCCTTTTGTACCGGAAAAATGTTTTGTTTTGGTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTAACAAGGGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCCTGGGGAAAAAAACGAAGGGGTCGATTTATGATTAAAATGATCTTTTTTTTGGGAAAGGG
  5   1   2       add Gas7      in                         XZG58170.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCGATTGCTGCAATTGGTTGGTTTGTTTTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATATTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCCTTTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       add Thy1                                CBST4989.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACAACCAAAAGAATGTCCTGTTCCCTCCTCTCCAGTATATAAAGGTCACGTTCCCTTTTTTTTTTTTTTTTTTTTAAATGCTATTTGATTTCATAATATGAATTCATTATATATATATATATATTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACTGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG
  3  -1   3        nb Gas       in                    TGas144b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTTTTTTTTTATTGCTATTTGATTTCATAANNTATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTG
  5  -1   3        nb Gas       in                   TGas144b16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAAACGAATGGATTCGATTTATGATTAAAATGATCTTTTTTTTGTGCCC
  3   1   3        nb Gas7                                 XZG19483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACCTATTATGATTCATGCGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTCTGGAAAGAAAAAAAAAAAAAAC
  5   1   2       ext Spl1                                 CABK3104.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGaaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2                                            Xt7.1-CABJ781.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGCTGCCTGAGGAAACGCATCGCCACCGCGGTCGCTGGGGAATAATTCACTAAACTCATTATCTCCTTTTCTCTTCCCCTTTAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGTAAGTTATTTTCAATGCCATGTATAAGCCATTCAGACATACTTTCAAGAAATATCTAGGGCAGCAGATATGTCGGTCTTCTCTCCAAACCTTCAAGTTCAAGTATCCAAGTGGGGTGTCCGTTAGTTACAACAAGGTTACAGACTGGTCCCCATTCTGATTTGGCCAACCCCCATAGTTAGATTGATGGTGGCTAAGGGAAACTTGNGAAGACCTCAGCAATAAGGGGCATACTCTTCACTAGTAATACAATCAGCTGACTGCAGTAACAATCTGGGGCATTTGTGCCATT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTGGNAAAAGAAA
                                                  Xt7.1-CHK-1008276832                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTGAGGAAACGCATCGCCACCGCGGTCGCTGGGGAATAATTCACTAAACTCATTATCTCCTTTTCTCTTCCCCTTTAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGTAAGTTATTTTCAATGCCATGTATAAGCCATTCAGACATACTTTCAAGAAATATCTAGGGCAGCAGATATGTCGGTCTTCTCTCCAAACCTTCAAGTTCAAGTATCCAAGTGGGGTGTCCGTTAGTTACAACAAGGTTACAGACTGGTCCCCATTCTGATTTGGCCAACCCCCATAGTTAGATTGATGGTGGCTAAGGGAAACTTGNGAAGACCTCAGCAATAAGGGGCATACTCTTCACTAGTAATACAATCAGCTGACTGCAGTAACAATCTGGGGCATTTGTGCCATTTAGGTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCCTTTTTTxxGxx
  5   1   2   24  ext Brn3 5g                              CAAK6514.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATGGCTGCCTGAGGAAACGCATCGCCACCGCGGTCGCTGGGGAATAATTCACTAAACTCATTATCTCCTTTTCTCTTCCCCTTTAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCCTTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTTGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAGAATGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACC
  5   1   4   10 seed Ski1 5g3  in                          CABJ781.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGGGAATAATTCACTAAACTCATTATCTCCTTTTCTCTTCCCCTTTAGGGCCAATGACCGAGTTTGGAATTAGGAACATGGACCAAGTGGCGCCGGTGTATAACGGCCACAGAGGAATGCTCAAGCGCCAGTTTGCATTCGACAATGTCAGCGTTCCGACCTCTCTCTACTCGGGCTTATTTTCTGCTTACGAAGAAGAACAGGCGGTACCAACGGGTCTGGACTCTTACTCTCATGATTCCAGCAGCTGCGAGTTACCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCCAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGCAATTGCGAGACTATG
  5   1   2       ext Ovi1      in                         CABI8085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCCCCTGCTGACCCCGTGCAGCAAGGCTGTGATGAGTCAAGCCCTGAAAGATACATTTAATGGTTTCACGAAGGAGCGGTGCAGACTTGGCATCCCCGGCAACCCGTGGCTTTGGGATGAGAATCACGTGTTTCAGTGGCTGCTGTGGGCCGCCAAGGAATTCTCCTTGGAAAACGTGAATTTTCAAAAGTTTCTCATGAATGGACATGAGCTGTGCAGCCTAGGAAAGGAGAGGTTTTTGGCTTTGGCTCCTGACTTCGTTGGGGACATACTCTGGGAGCATCTGGAAGAAATGATGAAAGAACATCAAGTAAAAGCCCAGGAGTCATACATTGACCATTCTAACCGGGACTCCGTTAACCAGTGGATGAATGCAGATTCCTTAAATTTCCCCGCTGATCCCTTGCAGTGTGGAGCACAAGTACACAATTACCCCAAAAACGGCATGTTTAATGATATGTGCTCGGTGCCCACCGGTCAACCTCTCCTCACCCCCAAACAAGAGTTCCAACAATATCCCAGCTCTTGCCTCAAATCCAGAGCGGTAAACTACCCACCCAGCCAGGATTTTGCAAGGAGCAATATGAACGCACTACTCAGTTCTCTAAATTCTGGTAAGTTATTTTCAATGCCATGTATAAGCCATTCAGACATACTTTCAAGAAATATCTAGGGCAGCAGATATGTCGGTCTTCTCTCCAAACCTTCAAGTTCAAGTATCCAAGTGGGGTGTCCGTTAGTTACAACAAGGTTACAGACTGGTCCCCATTCTGATTTGGCCAACCCCCATAGTTAGATTGATGGTGGCTAAGGGAAACTTGNGAAGACCTCAGCAATAAGGGGCATACTCTTCACTAGTAATACAATCAGCTGACTGCAGTAACAATCTGGGGCATTTGTGCCATTTAGGTGCAGT
  3   1   2       ext Ovi1      in                         CABI8085.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTGGNAAAAGAAAT
  3   1   4      seed Ski1 5g3  in                          CABJ781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGTTTGCAGCCGTGTCATTCTTAGATATCCAATCAAGGCCAGGCGCCTGTTGATGAACCACAATCCAAGGATCCGGGAGTCTTAATTGGCTATTGGCTATGCTGGTATCTAAGTGGTGTAGATATTGGCCGGGGCCGGGACACCAGGCTGACCATATACACTTTTTTTTTTTTTTTAAATGAACTGAAAATGTGATCATGGCATTCTCATCATTTCAAGGCTTGTAAATAATACCAGGTTTTATATTTACAGAACTATTTTATTTTGTCAGGTACATGTATATTTTAGTTGTATTTTAATGATGTAAATATTAGCATTAGGATGAGCGGCCGGGATTGCCAGTTTGTACATAGGAGATGTCTCGATTGCTGCAATTGGTTGGTTTGTTTTTGTTCTTTGTTTTCGCAATGAAGCCTTGGGTTCCACGCGGGGTGATTTCATGCTGATTGTTCGCAATATTGCACAACCAAAAGAATGTCCTGTTCCCTCCTCTGCTGTATATAATGGTCACGTTCCCTTTTTTTTTTATTTTTAATTGCTATTTGATTTCATAATATGAATTCATTATATATATATATTTTTTTTAAATGTATTTGCCTCCTTTTCATAGGCCAGGAGTAATGTGTGTAGCAGCTATTTGTACTGGAAATATGTTTTGTTTTGTTTTTTTTTTTTCTTTGAAAGGAAGTTGTATTTTTTTTTTAACAAGTGCCTTCAATGAAACCTATTCCTGTAACATATTTTGATTCATGAGGAAAAAAACGAATGGATCGATTTATGATTAAAATGATCTTTTTTTTGTGAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)