Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-TEgg080e06.5                          4 END     1           1       25                kelch-like 15 [Homo sapiens]

 This cluster: approximate FL confidence score = 95%

 1012073437 Xt7.1-CABJ3991.5 - 57 ESTs
                                                                       ....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ3991.5     GCCGGAAGTAGGGGGAATTGTGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAACTTGGCTCCTGTGTGATTTGTAATTTGGAATCTTTAGGAGAGAACTTGCTGTGTCGCTTATTAAAGGAAAAGTATGTGCTATTAAGTAATCCTAAGTAGAAAATATCATGTAGAATAATGCAGGACCCCTAGATGCACATTTTTTGGAGCCATACATGGGCCTGCATTGGCTTATTGGGTCCTA
                                                  Xt7.1-CHK-1008225152           AGTAGGGGGAATTGTGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAACTTGGCTCCTGTGTGATTTGTAATTTGGAATCTTTAGGAGAGAACTTGCTGTGTCGCTTATTAAAGGAAAAGTATGTGCTATTAAGTAATCCTAAGTAGAAAATATCATGTAGAATAATGCAGGACCCCTAGATGCACATTTTTTGGAGCCATACATGGGCCTGCATTGGCTTATTGGGTCCTATAGGGG
                                                      consensus depths          2     2     4     4     6     6     7     7    10    10    11    11    12    12    13    13    15    15    17    17    19    19    19    19    19    20    20    22    18    25    24    28    24    29    25    29    28    32    27    32    31    34    32    37    34    39    35    40    37    42    38    43    38    43    37    45    40    45    40    45    43    48    45    51    45    51    45    52    45    52    45    52    46    54    47    54    52    54    52    54    51    55    52    56    51    55    50    55    52    55    51    55    51    56    52    56    52    56    45    56    53    56    52    56    50    54    51    54    51    54    51    54    51    53    51    53    51    53    51    53    49    52    49    51    48    50    44    50    47    49    46    47    46    47    45    47    43    45    42    44    41    43    36    40    36    38    36    38    36    38    36    38    36    38    36    38    35    37    34    37    32    34    27    29    23    27    23    26    19    25     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                         GCAGGCAGGTTCCTCCTCTTCCTCATGGTTGGGTTTGGTACTGAGCTGAGTATGTTCTGGTTACCAGTGTTCTGTGCAGGTGCT
                                                                   SNP                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                             ---------G--
                                                                   SNP                                                                                                                                                                                         ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                     -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A--T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---A----G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                               BLH ATG      61     919     
                                               BLH MIN      61      81     
                                               BLH MPR      58      81     
                                               BLH OVR      61     170     
                                               CDS MIN      61       1     
                                               EST CLI       0       1     
                                               ORF LNG      61      12     
                                                                                                                                           PREDICTED - Sp ==== 2e-012     XP_784167.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN === Dr ==== 1e-064     NP_001002714.1 zgc:91806 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                     PROTEIN === Mm ==== 1e-073     NP_062410.1 Down syndrome critical region protein 2 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                     PROTEIN === Hs ==== 2e-074     NP_003711.1 Down syndrome critical region protein 2; chromosome 21 leucine-rich protein;leucine rich protein C21-LRP [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN === Gg ==== 2e-086     NP_001012561.1 Down syndrome critical region protein 2 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN === Xl ==== 8e-145     AAI23193.1 MGC154420 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PREDICTED = ?? ==== 8e-145     NP_001090485.1 hypothetical protein LOC779398 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                        PROTEIN === Xt ==== 2e-166     AAI35748.1 Unknown (protein for MGC:122162) [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ3991.5                                                                  ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAG------------------------------------------TAA---------------------ATG------------------------------------------------------TAA---------------------------------------------------------------TAA---TAA------------ATGTAG------------------------------------------ATG
                                                                   ORF                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  0   1   1           Tad5 FL                          XZT56483.FL-MGC     GCCGGAAGTAGGGGGAATTGTGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu065j07.FL-Sanger                                                          CTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACTCTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAAAAA
  5   1   1   10    - Tail 5g3  in                         CBSW1118.b1 CAGAGCCGGAAGTAGGGGGAATTGTGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGATGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCAGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCTGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTGACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCAGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTG
  5   1   1         - Tad5 FL   in                         XZT56483.5p     GCCGGAAGTAGGGGGAATTGTGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCNCTGTCTG
  5   1   1   10    - Te1  5g3  in                         CBWN5642.b1 .......GGAAGTAGGGGGAATTGTGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGATGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCAGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCTGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTGACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCAGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCAGTGCTACACTGATCTCC
  5   1   1   14    - Te5  5g3  in                        CAAO10852.5p ...............GGGGAATTGTGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCCAAAATT
  5   1   1   14    - Te5  5g3  in                        CAAO11788.5p ........................TGGGTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACTCTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCANAAATTCAAG
  5   1   1   10    - Tbd1 5g3  in                        CBXT22024.b1 ...........................GTGAGTGTCGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGT
  5   1   1   14    - Te3  5g3  in                         CAAM2450.5p ...................................CGCTGTATCATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTG
  5   1   1   14    - Te3  5g3  in                        CAAM10091.5p ...........................................CATCCCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGC
  5   1   1         - Tad0 5g3  in                     NISC_no21f06.y1                                                CCTGGAGCTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACTCTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAG
  5   1   1         - Neu  5g3  in                   TNeu052e07.p1cSP6                                                   CCGGGTGCTGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAAGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCT
  5   1   1         - Neu  FL   in                   TNeu065j07.p1cSP6                                                           TGAGCCAATGGCTACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACTCTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAG
  5   1   1         - Gas8      in                          st33a23.5p                                                                        ACATTCTTCGGGGAAGTGCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGA
  5   1   1         - Lun1      in                         CABD2174.5p                                                                                         GCAGTCTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGNCAAAATTNCAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGC
  5   1   1         - Tbd1                                CBXT22228.b1                                                                                              CTGTCTTCTCCAGGGCTGTGGATGAGGATGATGAGGATGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCAGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCTCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCTGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGCCAGGTTTGGCAGATCCCTGCGGTTTTCTACCAGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTTCT
  5   1   1         - Tad5      in                         XZT62701.5p                                                                                                     CTCCAGGGCTGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGTTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACTTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCCTATGGCCGATGGCTAATATATTTTTGTTAATGTATTA
  3   1   1         - Neu  5g3  in                    TNeu052e07.q1kT7                                                                                                              TGTGGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATGNAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCGTATTGGCCGATGGCTAATATAATTTTGTTAATGTATGGAGGGGAAATGTAAAATACACTCTTTATTCATT
  5   1   1         - Tad5      in                         XZT12053.5p                                                                                                                 GGATGAGGATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCT
  5   1   1         - Gas8      in                         st112k12.5p                                                                                                                        GATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCANCGTATGAGC
  5   1   1         - Gas8      in                         st113k12.5p                                                                                                                         ATGATGAGGAGGAAGAAGGAGAGGAGGAAGAGGAGGACAGGGAGATCATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGAT
  5   1   1         - Gas7      in                         XZG61458.5p                                                                                                                                           CCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGAGGGCTGAAGGAAAGTCGGGGGTGGGGGTTTCTGCCCTAAAGACACACAAATCTAATTCTGACCAGCCAGTAGGGGCGTTGCTGATTGTAGCCCCGCCTTCTTCTTTAGGGCCAATAACATTGCCAGTCAGTGTTCAGCTGCTCCTATAAAGTCACCTGACTTCCATTTGTTAATTACTTGTTCCTGGGAAGCAGCAGGCAGGTTCCTCCTCTTCCTCATGGTTGGGTTTGGTACTGAGCTGAGTATGTTCTGGTTACCAGTGTTCTGTGCAGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGC
  5   1   1         - Ski1      in                         CABJ3991.5p                                                                                                                                                                TTCAATTCGGCACGAGGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTNAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAAACTCGAGC
  3   1   1         - Tad5      in                         XZT62701.3p                                                                                                                                                                 GGAGATCATTGCGGAGCTGGAGAGAAAGCGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGTTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGT
  5   1   1       chi Brn4      in                        CAAL10124.5p                                                                                                                                                                       CATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGGTAAGGAACTTGCCTTCCCCTTATCACTGCTCCCAGTGGAACCTTCCCAGCTATAGGAATAAGGCACACTGTGGGGGTCCCGGGGGCGCCCCAACATATCAGGGTTTTAATTTTAACCTCTAACTGACCATTCTGTAGCAGTCTCGCCTGTGTGCCTTTTGTTCACATGAGTGTTTAGCATGATGTGCGTGTTTTGTATTTGCCTAGTTTGCAAGTACATTCTATATCCTGATCATTCTGATGCCCTAATTAATAATCTATAAAGGTGCTAGTTGCCCTATCAGTACTTGTGTAA
  5   1   1         - Neu                            TNeu135m09.p1cSP6                                                                                                                                                                        CATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTGCAACCCAAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAAGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCT
  5   1   1         - Neu                            TNeu135m10.p1cSP6                                                                                                                                                                        CATTGCGGAGCTGGATAGAAAACGGGAGGTACATGTGACCTCGAACCCAAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAAGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTGCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATA
  3   1   1         - Ski1      in                         CABJ3991.3p                                                                                                                                                                                 CTGGATAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTAACAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTGT
  3   1   1         - Te3  5g3  in                         CAAM2450.3p                                                                                                                                                                                   GCGGAGAGAAAGCGGGAGGTACATGTGACCTGACCCCAGAGGTAACAGCAGCCATGAAAGCTCCCCCAACAGAAGGCTCCCTTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGT
  3   1   1         - Te5  5g3  in                        CAAO11788.3p                                                                                                                                                                                      TAGAAAACGGGAGGTACATGTGACCTGGAACCCAGAGGTACNAGCAGCCATGANAAGCTCCCCCACNAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACTCTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGT
  3   1   1         - Lun1      in                         CABD2174.3p                                                                                                                                                                                                 GAGGTACATGTGACCTGAACCCAGAGGTACNAGCAGCCATGAAAGGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGT
  3   1   1         - Tad5 FL   in                         XZT56483.3p                                                                                                                                                                                                                     CCAGAGGTANCAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAAGG
  3   1   1         - Te5  5g3  in                        CAAO10852.3p                                                                                                                                                                                                                       AGAGGTACNAGCAGCCATTGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTGT
  3   1   1         - Gas7      in                         XZG61458.3p                                                                                                                                                                                                                        GCCCTAAAGACACACAAATCTAATTCTGACCAGCCAGTAGGGGCGTTGCTGATTGTAGCCCCGCCTTCTTCTTTAGGGCCAATAACATTGCCAGTCAGTGTTCAGCTGCTCCTATAAAGTCACCTGACTTCCATTTGTTAATTACTTGTTCCTGGGAAGCAGCAGGCAGGTTCCTCCTCTTCCTCATGGTTGGGTTTGGTACTGAGCTGAGTATGTTCTGGTTACCAGTGTTCTGTGCAGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAAAGG
  3   1   1         - Te3  5g3  in                        CAAM10091.3p                                                                                                                                                                                                                                                TCCCCCACAGAAAGGCTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGT
  3   1   1         - Gas8      in                          st33a23.3p                                                                                                                                                                                                                                                   CCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTACTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTT
  3   1   1       chi Brn4      in                        CAAL10124.3p                                                                                                                                                                                                                                                         AGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGGTAAGGAACTTGCCTTCCCCTTATCACTGCTCCCAGTGGAACCTTCCCAGCTATAGGAATAAGGCACACTGTGGGGGTCCCGGGGGCGCCCCAACATATCAGGGTTTTAATTTTAACCTCTAACTGACCATTCTGTAGCAGTCTCGCCTGTGTGCCTTTTGTTCACATGAGTGTTTAGCATGATGTGCGTGTTTTGTATTTGCCTAGTTTGCAAGTACATTCTATATCCTGATCATTCTGATGCCCTAATTAATAATCTATAAAGGTGCTAGTTGCCCTATCAGTACTTGTGTAATGTTTAGTGCCGTTTCCATGAAATTACGTACCCTTTAATATGCTTTGCTTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGT
  3   1   1       chi BrSp                             EC2BBA13AA12.b1                                                                                                                                                                                                                                                            TGAAAGCTCCCCCAACAGAAGGCTCCCCTGCTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCTGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAAGACCAGCTGTTCCAATGGTGTGAGAAGATATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCCGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACAGGTGCTACACTGATCTCTCCGAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACACTCCTGTCTGAGCCTATTGGCTGAAGGCTGATATAATTT
  3   1   1         - Gas7                                 XZG29176.3p                                                                                                                                                                                                                                                               CTCCCCTGCTCCAATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAAAGG
  3   1   1         - Gas8                                  st15m13.3p                                                                                                                                                                                                                                                                       CTCCAGTGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGAA
  3   1   1         - Neu  FL   in                    TNeu065j07.q1kT7                                                                                                                                                                                                                                                                         AATGTCATTTTGTCTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACTCTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCTTCTTCCTGCACCCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACCAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTGTAAAAAAAAAAAAAAAAAA
  3   1   1         - Te1  5g3  in                         CBWN5642.g1                                                                                                                                                                                                                                                                                        CTGTCGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCTGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTGACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCAGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCAGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCTGAAGGCTGATATAATTTTGTTAATGTATTAATGAGAAATGTAAAATACACTTTATTCATTTGTAAAAAAAAAAAAAAA
  3   1   1         - Gas8      in                         st113k12.3p                                                                                                                                                                                                                                                                                            CGGGGACAATGCAACAGGCTTCGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGG
  3   1   1         - Gas8      in                         st112k12.3p                                                                                                                                                                                                                                                                                             GGGGACAATGCAACAGGCTTCGTATCNTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTT
  3   1   1         - Tbd1 5g3  in                        CBXT22024.g1                                                                                                                                                                                                                                                                                                                 CGTATCCTCCTACATACTGAGCTCAGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACGCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAA
  5   1   1         - Limb      in                        CBSU4984.fwd                                                                                                                                                                                                                                                                                                                                 CTGAGCTCTGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTGACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCAGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCAGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCTGAAGGCTGATATAATTTTGTTAATGTATTAATGAGAAATGTAAAATACACTTTATTCATTTGT
  3   1   1         - Limb      in                        CBSU4984.rev                                                                                                                                                                                                                                                                                                                                 CTGAGCTCTGGCAGCTGGGAAGTGTGTGGATCTATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTGACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCAGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCAGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCTGAAGGCTGATATAATTTTGTTAATGTATTAATGAGAAATGTAAAATACACTTTATTCATTGT
  3   1   1         - Tad5      in                         XZT12053.3p                                                                                                                                                                                                                                                                                                                                                                  ATTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAAGGTACCTGTCCTTTCTCCCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTC
  3   1   1         - Tail 5g3  in                         CBSW1118.g1                                                                                                                                                                                                                                                                                                                                                                   TTACACTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTGACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCAGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCAGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCTGAAGGCTGATATAATTTTGTTAATGTATTAATGAGAAATGTAAAATACACTTTATTCATTGTAAAAAAAAAAAAAAA
  3   1   1         - Te1       out                       CBWN10505.g1                                                                                                                                                                                                                                                                                                                                                                        CTGTGGAACGAGAGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTGACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCAGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCAGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCTGAAGGCTGATATAATTTTGTTAATGTATTAATGAGAAATGTAAAATACACTTTATTCATTTGTAAAAAAAAAAAAAAA
  3   1   1         - BrSp      in                     EC2BBA27AC06.b1                                                                                                                                                                                                                                                                                                                                                                                    GGGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACAGGTGCTACACTGATCTCTCCGAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCTGAAGGCTGATATAATTT
  5   1   1         - BrSp      in                     EC2BBA27AC06.g1                                                                                                                                                                                                                                                                                                                                                                                     GGTGCAGAGACTGTAACCCCAGAAAGGATTCCCTTCCAGCTCCCTCTTCCTGCACCTTTTACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACGTATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACAGGTGCTACACTGATCTCTCCGAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTG
  5   1   1         - Gas7                                  XZG8381.5p                                                                                                                                                                                                                                                                                                                                                                                       CAGCAGGCAGGTTCCTCCTCTTCCTCATGGTTGGGTTTGGTACTGAGCTGAGTATGTTCTGGTTACCAGTGTTCTGTGCAGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTTATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGATTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATTTAAAATACACTCTTTATTCATTTGTAA
  5   1   1       chi Ova1      in                         CABE2552.5p                                                                                                                                                                                                                                                                                                                                                                                                              CTCATGGTTGGGTTTGGTACTGAGCCGAGTATGTTCTGGTTACTGGTCTCCTGTGCAGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAACTTGGCTCCTGTGTGATTTGTAATTTGGAATCTTTAGGAGAGAACTTGCTGTGTCGCTTATTAAAGGAAAAGTATGTGCTATTAAGTAATCCTAAGTAGGAAATATCATGTAGAATAATGCAGGACCCCTAGATGCACATTTTTTGGAGCCATACATGGGGCTGCATTGGCTTATTGGGTCCTATAGGGGC
  5   1   1         - Neu                            TNeu128b22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCTTTTACAGGTCCTTACAGACCCCACGGTGCTGGTGTGCCAGTGCAACTCTTACATAGCAGAGGACCAGCTGTTCCAATGGTGTGAGAAGGTGTTTGGCTCATTGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTGGGGTTCTTAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGTGTGGCAGATCCCTGCGGGTTTCTACCGGTGCTACACTGATCTCTCCAAACT
  3   1   1         - Tad0 5g3  in                     NISC_no21f06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGGTCCATTACAGACCCCACGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGGTATTTGGCTCATTGGAAAAGAGCAGCCTGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAAAAAAAAAAAAAAAAG
  3   1   1       chi Ova1      in                         CABE2552.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACATAGCAGAGGACCAGCTGTCCCAATGGTGTGAGAAGGTATTTGGCTCATGGAAAAGAGCGGCCTGAATGTAACGGTCCTTTCTACCTGCCCGGTGTCTGAATATAAAACCCCCGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCAGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTTAATGTATTAATGGGAAATGTAAAATACACTCTTTATTCATTTGTAACTTGGCTCCTGTGTGATTTGTAATTTGGAATCTTTAGGAGAGAACTTGCTGTGTCGCTTATTAAAGGAAAAGTATGTGCTATTAAGTAATCCTAAGTAGAAAATATCATGTAGAATAATGCAGGACCCCTAGATGCACATTTTTTGGAGCCATACATGGGCCTGCATTGGCTTATTGGGTCCTATAGGGGCTAAAGGAACAGCTATAAAAAAAAAAAAAAAAAAAAACC
  5   1   1       chi Egg       out                  TEgg070i07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGCAGGCAGGTTCCTCCTCTTCCTCATGGTTGGGTTTGGTACTGAGCTGAGTATGTTCTGGTTACCAGTGTTCTGTGCAGGTGCTGCTGTGCCAGTGCAACTCTTACATAGCGGAGGACCAGCTGTTCCAGTGGTGTGAGAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGTGAAAACATCTGAATTCTACCGGTACTCACGGCAGCTGAGGCACGAAGTTGAGCAAGCCCTGAACTACTTCCATAATGTCAGCGAGCAGCCTCTGATGGAAATGAAATCAAACCACATCCGTTCAGCAAAACCCCAGACTGCAGTATTCCGGGGAATGATTGGGCACAGCATGGTTAATAGCAAGATCCTCCTTCTTCATAAGCCTCGTGTGTGGTGGGAGCTTGAAGGACCCCTGGTTCCACTCCGTCCAGACTGCCTTGCCATCGTCAACAATTTTG
  3   1   1         - HeRe                             EC2CAA10AG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAATGTAACTGTCCTTTCTACCTGCCCAGTTTCTGAATATAAAACCCCTGAGTCCACCTACAGTCTCCCTGTTCCCTTCTTGAAAGCGCTGAGGACCAGTGAGTACAGGGAGGAGGTGCCATGCCCCTGCTGGAACAGCCTAATATTGCAGATGGGCTTCCTGCTGCAGTGCTGACATATTGTCAGGTTTGGCAGATCCCTGCGGTTTTCTACCGGTGCTACACTGATCTCTCCAAACTGGATTCCATCACCATTGATGCTTTCCGACCCCTCCTGTCCTGTCAACGTATGAGCCGACTGGCCGCGGACTCTGCAAAAATTCAAGAAACACTGAGAAAAACGGTAAAATCGAGTGAGATCCAGAGTAACCTCTACATCTAGCCCCGAGCATCACTCTCCTGTCTGAGCCTATTGGCCGATGGCTAATATAATTTTGTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)