Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 191.0    0Xt7.1-TGas142j06.3                         58 PI      76        557      905                iroquois homeobox protein 3 [Xenopus tropicalis]
     2 214.0    0Xt7.1-TNeu111g19.3                         50 PI      90        746      905                irx2-prov protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012074080 Xt7.1-CABD9669.3 - 56 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                 2     2     3     3     4     6     4     6     6     8    10    11    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    14    12    14    10    14    14    15    13    15    12    12    11    12    10    12    12    12    12    12    13    13    13    13    12    14    13    14    14    14    14    14    14    14    13    13    16    17    14    15    15    15    15    15    15    15    15    15    15    15    14    15    12    15    14    15    16    16    16    16    16    17    15    16    15    17    16    17    16    17    16    17    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    16    16    15    15    15    16    15    16    15    15    14    14    13    13    13    13    13    13    13    13    12    12    11    12    10    12    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9     9     9     9     9     9     8     8     8     8     9     9     9     9     9     9     9    10     9    10    10    11    11    12    12    15    13    15    13    15    12    14    12    14    12    13    13    14    13    14    14    15    17    18    18    19    21    23    23    24    24    25    26    27    25    26    25    26    25    26    25    26    25    26    26    27    26    27    25    26    24    26    25    26    25    26    25    26    25    26    25    26    25    26    25    26    26    26    26    26    28    29    27    29    28    29    28    29    28    28    26    28    27    27    27    28    26    28    28    28    26    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    25    27    26    26    26    26    26    26    25    26    25    26    26    26    26    26    26    26    26    26    25    26    23    25    23    25    23    25    23    25    22    23    17    17    16    16    16    16     6     6     2     2
                                                                   SNP                                                                                                                                                                                                    A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                        --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                    -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------GT
                                               BLH ATG     328    2083                            
                                               BLH MIN     328     198                            
                                               BLH MPR      46     198                            
                                               BLH OVR     328     255                            
                                               CDS MIN     328     198                            
                                               EST CLI      41       3                            
                                               ORF LNG     328      23                            
                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 5e-007     AAM18882.1 unknown [Branchiostoma floridae] ------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                            PREDICTED - Sc ---- 8e-009     NP_015148.1 homeobox domain similar human proto-oncogene PBX1; Cup9p [Saccharomycescerevisiae] ------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 1e-034     NP_492533.1 Homeodomain protein [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                PROTEIN --- Dm ---- 1e-040     NP_524045.2 araucan CG10571-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 1e-043     BAE06520.1 transcription factor protein [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 1e-046     XP_795008.1 PREDICTED: similar to Iroquois-class homeodomain protein IRX-4 (Iroquois homeobox protein 4) (Homeodomain protein IRXA3) [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 3e-164     NP_997067.1 iroquois homeobox protein 1, a isoform 1 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 2e-174     NP_034703.1 Iroquois related homeobox 1 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 1e-174     NP_077313.3 iroquois homeobox protein 1 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 0          NP_001025509.1 iroquois homeobox protein 1 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 0          CAB38329.1 homeobox Iro protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 0          NP_001081649.1 homeobox Iro protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          AAT72003.1 iro1 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD9669.3                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG---------TAAATG---------------------TAA------------------------------------------------------------------------TAA---TAA---TGA---------------------------------------------------------TGA---------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  3  -1   2       bld Gas       in                    TGas126n11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCAGCCGGATCCGGAAGGCCGACAGGAGCTGATCTGGGCAGCAGTTCTACCGCGGCAGTGACCTCAGTGCTGGGCATGTATGCCAGCCCCTACAGCGCTCCCAACTACAGCGCCTTTCTACCCTACACCACCGATCTCACCCTTTTCTCCCAAATGGGATCGCAGTATGAACTGAAAGACAACCCCGGTGTCCACCCAGCCACATTTGCTGCACACACTACTCCAGGCTATTACCCCTATGGACAGTTCCAATATGGAGACCCAGGGCGGCCCAAGAATGCCACCAGGGAGAGCACCAGTACCCTAAAGGCTTGGCTCAATGAGCACAGGAAGAACCCTTACCCCACCAAGGGGGAGAAGATCATGCTGGCCATAATCACCAAGATGACCCTCACCCAGGTCTCAACGTGGTTTGCAAACGCTCGGAGGAGGCTAAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGGAGTAAGGAAGATGACAACATCTTTGGGAGTGATACTGAAGGAGACCATG
  5   1   2       bld Neu                            TNeu010m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGATCGCAGTATGAACTGGAAANACAACCCCGGTGTCCACCCAGCCACATTTGCTGCACACACTACTCCAGGCTATTACCCCTATGGACAGTTCCAATATGGAGACCCAGGGCGGCCCAAGAATGCCACCAGGGAGAGCACCAGTACCCTAAAGGCTTGGCTCAATGAGCACAGAAGAACCCTTACCCCACCAAGGGGAGAAGATCATGCTGGCCATAATCACCAAGATGACCCTCACCCAGGTCTCAACGTGGTTTGCAAACGCTCGGAGGAGGCTAAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGGAGTAAGGAAGATGACAACATCTTTGGGAGTGATACTGAAGGAGACCATGAAAAAAATGAAGATGACGAGGAAATAGATTTGGAAAGCATAGATATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAATGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAGAGTTTGAAAAAGGAGAGTGAAGTGATGATTCCAAGTTCCGACGGACTTAAATCAAAAGACTCATTGTCCCTTGGTAAGGAAAGTTCTGATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCA
  5   1   2       bld Gas7      in                         XZG51489.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAGATGACCCTCACCCAGGTCTCAACGTGGGTTTGCAAACGCTCGGAGGAGGCTAAAGAAGGAGAATAAGGTCACTTGGGGGGCAAGGAGTAAGGAAGATGACAACATCTTTGGGAGTGATACTGAAGGAGACCATGAAAAAAATGAAGATGACGAGGAAATAGATTTGGAAAGCATAGATATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAATGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAGAGTTTCAAAAAGGAGAGTGAAGTGATGATTCCAAGTTCCGACGGACTTAAATCAAAAGACTCATTGTCCCTTGGTAAGGAAAGTTCTGATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAANACCTT
  5   1   2       bld Fat1      in                         CABC8362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCACTTGGGGGGCAAGGAGTAAGGAAGATGACAACATCTTTGGGAGTGATACTGAAGGAGACCATGAAAAAAATGAAGATGACGAGGAAATAGATTTGGAAAGCATAGATATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAATGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAGAGTTTCAAAAAGGAGAGTGAAGTGATGATTCCAAGTTCCGACGGACTTAAATCAAAAGACTCATTGTCCCTTGGTAAGGAAAGTTCTGATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAANACTTACCCAGAACCGAATCTCCACCTCANGTAAAACCTTCCTTCCAAGCTNGTCGT
  5   1   2       bld Tad5                                 XZT38705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGACCATGAAAAAAATGAAGATGACGAGGAAATAGATTTGGAAAGCATAGATATTGATAAAATTGATGACAACGACGGTGAGCAAAGCAATGAGGAAGAGGATGAGAAACTGGAGCACTTGAGACAGGGCGAGAAAGAGAGTTTGAAAAAGGAGAGTGAAGTGATGATTCCAAGTTCCGACGGACTTAAATCAAAAGACTCATTGTCCCTTGGTAAGGAAAGTTCTGATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATT
  5   1   2       bld Gas7      in                         XZG28873.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGATTCCAAGTTCCGACGGACTTAAATCAAAAGACTCATTGTCCCTTGGTAAGGAAAGTTCTGATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTT
  3   1   2       bld Ski1 5g3  in                        CABJ10539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTCATTGTCCCTGGTAAGGAAAGTTCTGATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATGAAAAA
  3   1   2       bld Lun1      in                        CABD14938.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAGAAAAGTTCTGATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTGCCTC
  3   1   2      seed Ski1      out                        CABJ2812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATACCAGCAATACCAGAATAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATG
  3   1   2       bld Neu       in                    TNeu093a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCCACCTCACCCATTAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTNTTCTCCTTCTTCCACTTCTNCAAGCCAATCACACATTCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Lun1      in                         CABD9669.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAATAGTAAGCCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTCACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATT
  5   1   2       bld Neu       in                   TNeu093a24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTAAGCCCCGGTGGGCAGGGCAACATACAAGTGCCACCTGACAATAAACCAAAAATCTGGTCCTTGGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCGAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTGCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAATGCGCCTCTCGTATATTGACAGCAC
  3   1   2       bld Fat1      in                         CABC8362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAGAAACAGCAACAAGTCCAGATGGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCNCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATGAAA
  5   1   2       bld Gas7      in                         XZG24986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGCCTTGAAGTCTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATGAAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8 5g3  in                          st68p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTGTC
  3   1   2       bld Gas8      in                          st72b05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTGTC
  3   1   2       bld Gas8 5g3  in                          st62l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTG
  3   1   2       bld Ski1 5g3  in                         CABJ1311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCACCTTCTCAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATT
  3   1   2       bld Gas6 5g3  in                          ANBT402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATGAAAAAAAAAAAAC
  3   1   2       bld Fat1 PIPE in                         CABC1136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATG
  3   1   2       bld Gas8 5g3  in                         st113b02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTGTCTAAATCATA
  3   1   2       bld Gas8      in                          st39d17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATA
  3   1   2       bld Gas8      in                          st50d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGCCAATCACACATCTCCCCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTG
  3   1   2       bld Tad5      in                         XZT34697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCAATTCAGCACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTACAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATG
  3   1   2       bld Gas8      in                          st49a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CACCCAGCCTTTCTCCCCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTGT
  3   1   2       bld Gas7      in                         XZG24986.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGTGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATG
  3   1   2       bld Gas7      in                         XZG28873.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCCATGGACTATACACATGCCAAATTGGCAAATTTCACAACTGGACAAACGGGGCCTTTCTCACACAGAGCTCCCTGATAAACATGAGGTCCTTGCTGGGAGTAAACCCTCACCATGCGGCTCACCATAACCACCATCACCTTCAGGCTCACCAACAAGCTCCATTGTTAGCAACAAACCTGAGTTCCCTCAGCAGCGACAAAACTCCAGAACGGACCAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATGAAAAAT
  3   1   2       bld Gas7      in                         XZG51489.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCCTGATAAACATGAGGTCCTTGCTGGGGGTAAACCCTCCCCATGGGGCTCCCCATAACCACCATTACCTTCAGGGTCTCCAACAAGGTTCATTGTTAGCAACAAACCTGAGTTTCCTCAGCAGGGGCAAAACTCCAGAACGGGCCAGCCCCAAGCCCTCAGACAGAGAAAAATTTCCCCGAACCGAATTTCCCCCTCAGTTAAAACCTTCCTTCCAAGCTGTTTGGGAAAACACCCTTTCCCAGCAAGAAGGCACCTTTTGTATATTGACAGCACTTCCCTTTGCCTGACTGCTAGAAGGGACGATTAAAAGAGGCCTTACCAAAATATGGGCCCAAATGGGTTTTTTATAAAAGACTCCTACCCTCTTTTTGCAAAAATGTGCTACCCATTCAGACTTTTGAATTTTTTTGGGGGGGTTTCCCTCTTTCCGTGTTCCCTTTCAGAACGGGTAAAAATAACCCTGATCGGAAATTTTTTATGTTTCCCAAGTATTTGGGTTTTTTTTCTCT
  5  -1   2       bld Gas                            TGas012c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCCCCAAGCACTCAGACAGAGAAAACTTACCCAGAGCCGAATCTCCACCTCAGTTAAAACCTTCCTTCCGAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGGCAGCAGTTCCCTGGGCGTGAGTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCGTACCCTCTTTTTGCGATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTAGTTGTGTTTTTTTTGCGCTCTGGAGAGAGAGTGAGCTCAGATTGTAAAGAGCGCGCAAGCAAG
  5   1   2       bld Gas                            TGas017p12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCAAGCACTCAGACAGNANAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTNTG
  5   1   2       bld Gas                            TGas041f11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCCAAGCACTCAGACAGAGAAAACTTACCCAGAACCGAATCTCCACCTCAGTTAAAACCTTCCTTCCAAGCTGTTCGTGAAAACACCCTTTCACAGCAAGAAGGCACCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATG
  5   1   2       bld Neu                            TNeu097f10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCACAGCAAGAAGGCACGCTCTCGTATATTGACAGCACTTCCCTCTGCCTGACTGCTAGAAGGAACGATTAAAAGAGACCTTACCAAAATATGGACACAAATGGGTATCTTATAAATGACTCCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATCTCCCTCTTTCCGTGTGCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATG
  5  -1   2       bld Eye       in                         CCAX3473.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTACCCTCTTTTTGCAATAATGTGCTACACATTCAGACTATCGAATTTTTCTAGGCGGATTTCCCTCTTTCCGTGTTCCATTTCAGAACGTGTAAAACTAACCCTGATCGGATATTTTTTATGTTTCCCAAGTATTTGTGTTTTTTTTCTCTCTGTATATAAAGTGATCTCAGATTGTAAATAGCGCGCAAGCAAGAACTTGTCTAAATCATATATTTTTGTCTAATAAACTAAATGAAATTATGAAAAAAAAA

In case of problems mail me! (