Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu112d16.3                        134 END     6           7        4                (no blast hit)
     2   3.0    0Xt7.1-TEgg040h07.3.5                       84 END     1           1        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 396.0    0Xt7.1-TTpA059k15.5.5                       66 PI      77        288      882                Unknown (protein for MGC:122794) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012074284 Xt7.1-XZT52487.5.5 - 79 ESTs
                                                                       ..-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT52487.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGATCCGCCCGGAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTGTTTCTTCAGCTTCTCTGATGCTTTGAACTTTCACCCTGAATTTTGTGGCTGACCTTTTGTGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTAGCTTGTACTTTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAATTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTATA
                                                  Xt7.1-CHK-1008223967                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCCGGAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACxxxxxGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTxxTTxxTCAGCTTCTCTGxxxxxTTGAACTTxxxCxCTGAATTTTxxxGCTGACCTTTTGxxxxxAxxxxxxxTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTxTxxCTTxTxxTxTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACxxxATxxTTAxxCCTGCATTTGATTxxxxxTTTTGCxxxxxxxxxxAxAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTATATATATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     4     3     5     5     9    11    14    17    21    18    22    20    24    20    24    21    25    22    26    22    26    23    26    23    26    23    26    23    26    26    26    26    26    26    26    26    26    26    26    28    28    26    28    27    28    26    28    26    28    26    28    26    28    26    28    26    28    26    28    26    28    27    29    27    29    28    30    28    30    28    30    28    29    28    29    28    29    27    28    26    27    22    27    24    30    25    31    25    31    24    31    26    32    25    32    27    32    27    32    26    32    26    31    25    29    25    29    25    29    24    28    23    27    20    25    18    23    18    24    14    20    14    19    14    19    13    18    14    18    13    17    14    17    14    17    13    16    12    14    12    14    10    12     9    11     8    10     8    10     8    10     7     9     7     9     7     9     7     9     7     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     9     8     9     8     9     8    10     8    10     8    10     8    10     7     9     7     9     7    11     8    13     9    14    11    17    11    17    12    18    12    18    13    18    13    18    15    20    14    20    14    22    15    22    16    22    17    22    18    23    18    23    18    25    16    24    16    25    15    25    15    26    15    28    18    29    18    30    17    29    17    29    16    29    15    29    17    28    17    28    15    28    16    27    15    27    16    27    15    26    16    28    16    28    16    28    16    28    16    29    15    29    16    29    16    30    13    30    13    30    13    30    13    30    12    30    13    31    13    30    12    32    10    33    13    33    11    32    13    32    11    32    16    31    12    31     8    31    17    33     5    31     5    30     5    30     5    29     5    30     5    26     7    25     6    19     4    11     4     7     4     7     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5
  5   1   2                                         Xt7.1-TEgg060d07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTGACAAGCTGTGCCTCCCGCCTGCCCGCACACTCCGCAGCACAGGCCCATTATTGGTCGCTTCCCCCCACCCCCCCCATGTAGGCCGACTTGGTGGATCCGCCCGGAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATGGGGGATAATTAGAAAGACCATGGCATCATTTAAACTTGATTTCCTGCCTGAGATGATGGTGGATCATTGCTCTCTGAATTCCAGTCCTGTTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCNAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGATGCTTGAACTTTCACCTTTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTTGATTATTAAAGGAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAN1853.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTGCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGATGCCGGTGCACTCCCTTCACTGTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGTTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATTCCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATTGGCAAACAAACGAACCTCAGCAAATGTTTTGGGTTAGTAAGCTATGACAATCCCGTTTTTGGTCAGGGGGCTATCCAGTCCATGAACGGCTTTCAGATGGGAATGAAACGCCTGAAAGTCCAACTTTAACGCTCCAAGAATGACAGCAAACCGTAGTGAAACATACTCCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGGGCCTTTAAAGCAGGTCGGTGGGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGATTTTTTGATGCTTGAACTTTCACCTTCGAATTTTGGGCGGCCCTTTTGATGATAATATGTATTTTTTTTGGTTTTGTTTTTTTAAGTGACTGGGTATTTTTTTTTTTTTTTTCTTTCTTCATGTTCCTTATGTGTGGGTTGCCAAATTGGTTTTGCACAAAGATTTCGAAGAGGGACGCAATATTTAACCTGCATTTGA
  5   1   2  SIG                                    Xt7.1-TTbA008e07.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCGGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTCTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTGATTATAAAAGGAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-XZT52487.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAR5143.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAACTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTCTTTTTTATGTTCCTTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTG
  5   1   2  SIG                                    Xt7.1-TEgg103b21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGGTAAGTGTGGGAAGGAAAGTCCAAAACCAGGATGTATAGCTGGAGGAGCCCACTTAGTAAGAACACACAGACTATGCTGACTCTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTATTATTATTATTATTATAATTATTATTTGGACTTTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTATATATATATAAGTGTGTGGGTAAAACTAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATGGGGGATAATTAGAAAGACCATGGCATCATTTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTGAGATGATGGTGGATCATTGCTCTCTGAATTCCAGTCCTGTTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAAGCACAAACTATGGAGGGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGGTACAACTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTATGGAAGAAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTCTTTATGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTTAGGTGCCATATCAGTGAAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTATTATAATTATTATTTGGACT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----C-------
                                               BLH ATG     295    1577                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN     250     259                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR     295      60                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI     140      29                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG     295       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 1e-009     BAA88672.1 CiMsi [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bb ---- 2e-011     BAB62225.1 Hu/elav class neuron-specific RNA binding protein [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sc ---- 2e-010     NP_014518.1 Putative polyadenylated-RNA-binding protein located in nucleus; similar tovertebrate hnRNP A/B protein family; Hrp1p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Cs ---- 5e-039     BAB88676.1 Cs-ETR1 [Ciona savignyi] --=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 2e-099     XP_782270.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-101     NP_493673.1 ELAV-Type RNA binding protein, muscle specific and required for muscledifferentiation (62.3 kD) (etr-1) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 2e-113     NP_788039.1 bruno-2 CG31761-PD [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 0          NP_571688.1 CUG triplet repeat, RNA-binding protein 1 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 0          NP_001012539.1 CUG triplet repeat, RNA binding protein 1 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 0          NP_006551.1 CUG triplet repeat, RNA binding protein 1; CUG triplet repeat, RNA-bindingprotein 1; CUG RNA-binding protein; CUG triplet repeat, RNA-binding proteinprotein 1 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 0          NP_059064.2 CUG triplet repeat, RNA-binding protein 1 isoform 1 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 0          AAH57743.1 MGC69034 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 0          CAJ82289.1 CUG triplet repeat, RNA binding protein 1 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          Q28HE9 CUG-BP- and ETR-3-like factor 1 (CELF-1) (Bruno-like protein 2) (RNA-binding protein BRUNOL-2) (CUG triplet repeat RNA-binding protein 1) (CUG-BP1) [(unknown)]  =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZT52487.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGA------------------------------TGA------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------ATG---------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------ATG---------------------------------------ATG------ATG------------ATG---------------ATG------------------------------------------------------------------ATG---------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------TGA------------------TGA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------ATG------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------TAG---------------------------------------------------------------TGA------TGA------TGA------------TGA------------------------ATG------------------------------------------TAATGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2                                         Xt7.1-TEgg060d07.3                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTGACAAGCTGTGCCTCCCGCCTGCCCGCACACTCCGCAGCACAGGCCCATTATTGGTCGCTTCCCCCCACCCCCCCCATGTAGGCCGACTTGGTGGATCCGCCCGGAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATGGGGGATAATTAGAAAGACCATGGCATCATTTAAACTTGATTTCCTGCCTGAGATGATGGTGGATCATTGCTCTCTGAATTCCAGTCCTGTTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCNAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGATGCTTGAACTTTCACCTTTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTTGATTATTAAAGGAAAAAAAAA
                                                  Xt7.1-CHK-1008282540                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGCTGTGCCTCCCGCCTGCCCGCACACTCCGCAGCACAGGCCCATTATTGGTCGCTTCCCCCCACCCCCCCCATGTAGGCCGACTTGGTGGATCCGCCCGGAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATGGGGGATAATTAGAAAGACCATGGCATCATTTAAACTTGATTTCCTGCCTGAGATGATGGTGGATCATTGCTCTCTGAATTCCAGTCCTGTTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCNAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGATGCTTGAACTTTCACCTTTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTTGATTATTAAAGGAAAAAAAAAAAAAAA
  5   1   2       ext Te4  5x3  out                        CAAN8378.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTGACAAGCTGTGCCTCCCGCCTGCCCGCACACTCCGCAGCACAGGCCCATTATTGGTCGCTTCCCCCCACCCCCCCCATGTAGGCCGACTTGGTGGATCCGCCCGGAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATGGGGGATAATTAGAAAGACCATGGCATCATTTAAACTTGATTTCCTGCCTGAGATGATGGTGGATCATTGCTCTCTGAATTCCAGTCCTGTTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGT
  5   1   4      seed Egg  5x3  in                   TEgg060d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGATCCGCCCGGAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATGGGGGATAATTAGAAAGACCATGGCATCATTTAAACTTGATTTCCTGCCTGAGATGATGGTGGATCATTGCTCTCTGAATTCCAGTCCTGTTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCT
  5   1   3        nb Neu  5x                        TNeu096d15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATGGGGGATAATTAGAAAGACCATGGCATCATTTAAACTTGAGGGCCTGCCTGAGATGATGGTGGATCATTGCTCTCTGAATTCCAGTCCTGTTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTGCCTCAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCAGCAGTATGGAGCTGTCTATGAGATTAATGTGCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCGTGGTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAA
  3   1   4      seed Egg  5x3  in                    TEgg060d07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCNAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGATGCTTGAACTTTCACCTTTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTTGATTATTAAAGGAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAN1853.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTGCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGATGCCGGTGCACTCCCTTCACTGTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGTTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATTCCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATTGGCAAACAAACGAACCTCAGCAAATGTTTTGGGTTAGTAAGCTATGACAATCCCGTTTTTGGTCAGGGGGCTATCCAGTCCATGAACGGCTTTCAGATGGGAATGAAACGCCTGAAAGTCCAACTTTAACGCTCCAAGAATGACAGCAAACCGTAGTGAAACATACTCCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGGGCCTTTAAAGCAGGTCGGTGGGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGATTTTTTGATGCTTGAACTTTCACCTTCGAATTTTGGGCGGCCCTTTTGATGATAATATGTATTTTTTTTGGTTTTGTTTTTTTAAGTGACTGGGTATTTTTTTTTTTTTTTTCTTTCTTCATGTTCCTTATGTGTGGGTTGCCAAATTGGTTTTGCACAAAGATTTCGAAGAGGGACGCAATATTTAACCTGCATTTGA
                                                  Xt7.1-CHK-1008282548                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTGCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGATGCCGGTGCACTCCCTTCACTGTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGTTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATTCCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATTGGCAAACAAACGAACCTCAGCAAATGTTTTGGGTTAGTAAGCTATGACAATCCCGTTTTTGGTCAGGGGGCTATCCAGTCCATGAACGGCTTTCAGATGGGAATGAAACGCCTGAAAGTCCAACTTTAACGCTCCAAGAATGACAGCAAACCGTAGTGAAACATACTCCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGGGCCTTTAAAGCAGGTCGGTGGGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGATTTTTTGATGCTTGAACTTTCACCTTCGAATTTTGGGCGGCCCTTTTGATGATAATATGTATTTTTTTTGGTTTTGTTTTTTTAAGTGACTGGGTATTTTTTTTTTTTTTTTCTTTCTTCATGTTCCTTATGTGTGGGTTGCCAAATTGGTTTTGCACAAAGATTTCGAAGAGGGACGCAATATTTAACCTGC
  5   1   2   14  ext Te4  5g3  out                        CAAN1853.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGTGCCGCCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCANAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCATAGTGGTTAAGTTTGCAGACACT
  5   1   3   14   nb Brn2 5g3  out                       CAAJ23877.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATTTTGGATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGNGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGT
  5   1   4      seed TbA  5g3  in                   TTbA034i14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCGCACAGGGCAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCACGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAACGGAACTCTTCGAGCAGTATGGAGCTGTCTATGACATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATC
  5   1   3        nb Neu  5g                        TNeu022k12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGC
  5   1   2       ext Neu                            TNeu096e10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGGTGGGTTAAACACAGTGCTGTATCCAGAGCATCCTGCGTCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGAGATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTGCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAAT
  3   1   4      seed TbA  5g3  in                    TTbA034i14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGATGCCGGTGCACTCCCTTCACTGTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGTTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATTCCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATTGGCAAACAAACGAACCTCAGCAAATGTTTTGGGTTAGTAAGCTATGACAATCCCGTTTTTGGTCAGGGGGCTATCCAGTCCATGAACGGCTTTCAGATGGGAATGAAACGCCTGAAAGTCCAACTTTAACGCTCCAAGAATGACAGCAAACCGTAGTGAAACATACTCCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGGGCCTTTAAAGCAGGTCGGTGGGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGATTTTTTGATGCTTGAACTTTCACCTTCGAATTTTGGGCGGCCCTTTTGATGATAATATGTATTTTTTTTGGTTTTGTTTTTTTAAGTGACTGGGTATTTTTTTTTTTTTTTTCTTTCTTCATGTTCCTTATGTGTGGGTTGCCAAATTGGTTTTGCACAAAGATTTCGAAGAGGGACGCAATATTTAACCTGCATTTGATTGTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TTbA008e07.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCGGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTCTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTGATTATAAAAGGAAAAAAAAAA
                                                  Xt7.1-CHK-1008282544                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCACCGTCCGGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTGATTATAAAAGGAAAA
  5   1   2       ext Neu  5g3  in                   TNeu075m06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGAT
  5   1   4      seed TbA  5g3  in                  TTbA008e07.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAA
  5   1   1       add Gas8 5g3  in                          st21n21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCC
  5   1   2       ext Gas7      in                         XZG18508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACCGTCCGGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTT
  3   1   4      seed TbA  5g3  in                    TTbA008e07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTTCCAAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTNCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTTGAT
  3   1   3        nb Gas                             TGas095m01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTCTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTGATTATAAAAGGAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG18508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAAAAAGTATTTTTTTTTTTGTTTTTTTAAAGAAGGGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTTTTT
  3   1   2       ext Neu  5g3  in                    TNeu075m06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTTGATTTTAAAAGGAAAAAAAAAAAAAAAA
  3   1   0       add Gas8 5g3  in                          st97f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCCTTTGAANTTTGNGNNGNCCCTTTGNNGGTAAAAAGNANTTTTTTTTGNTTTGNTTTTTTAAAGAAGGGNANTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAAT
  3   1   0       add Gas8 5g3  in                          st21n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCNCCTTTGAANTTTGNGNTGNCCCTTTGANGNTAAAAAGNANTTTTTTTTTTGTTTTTTTAATGATGNGTATTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACCAAAGACTACGAAGAGGGACGCAAT
  5   1   2  SIG                                      Xt7.1-XZT52487.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008282552                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGxxxxxAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAxGxAAAAAAAAAAAAAAAAGATA
  0   1   1           Egg  FL                     TEgg064f02.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAAAAAAAAAAAAAAAAA
  5   1   2   12  ext Gas7 5g3  out                        XZG41869.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATCCTCTGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAATATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCANAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACATNCACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGGAACCTTGCTGGACTGAGCAGCTTGG
  5   1   4   14 seed Gas6 5g3  in                         ANBT1373.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGCACAGGGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGTGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCANAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGTCGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTNCATGTGG
  5   1   3   14   nb Te4  5g3  out                        CAAN4996.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGAGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCTCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCCTCATGTGGGGAAACCTTGCTGGACTGAGCAGCT
  5   1   3        nb Gas8 5g   ?                           st76j06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTGAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAAAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACC
  5   1   2       add Gas8 5g3  in                          st97f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCC
  5   1   3        nb Gas8 5g                               st98f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCC
  5   1   3   22   nb Tad5 5g                              XZT52487.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGG
  5   1   3        nb Egg  FL   in                   TEgg064f02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGAT
  5   1   3        nb Neu  5g                        TNeu030k04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTNCGAGGCCCTGATGGAATGA
  5   1   3        nb Neu  5g                        TNeu040g10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGGAAACGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAAC
  5   1   3        nb Gas8 5g                               st22n21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGCTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAANACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCANACTCCATCANGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCNCAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGANTGAGCANAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGC
  5   1   3        nb Egg0      in                         dad73a10.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATTCCTGGCACAGATGGCTATCAAAGCCATG
  5   1   3        nb Gas  5g   ?                    TGas077m11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTTGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAAC
  5   1   3        nb Gas                            TGas038i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGTTTGTGGGTCAGGTTCNCTCGAACTGGTCAGAGAAAGACTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTNGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCT
  5   1   3        nb Gas                            TGas134d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACACAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTG
  5   1   2       ext Neu       in                   TNeu083j18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCGATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTA
  5   1   3        nb HdA       out                 THdA002f17.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGATAATGATTCCGGGCATGTTCTCTAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGAATCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAG
  5   1   3        nb Neu                            TNeu132n14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGAAGACAGAAATCTCTTTGTTGGGATGGTTTCCAAGAACTGTAATGAGAATGATATCCGGGCCATGTGCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCGGGGGCACAAACTATGGAGGGGTGTGCCTCCCCAATAGTGGGTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCGGCAACTGAGATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAATATTTATCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCGTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGAGTTAATGCCATGCAGTTACAGAATTTGGCAGCTT
  5   1   3        nb Neu                            TNeu035b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATC
  3   1   3        nb Egg0      in                         dad73a10.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACTCTTTGTTGGATGAGTTTCCAANAAGTGTAATGAGAATCATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTGGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAAAAAAA
  5   1   2       add Spl1      in                         CABK3689.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCAGTAAGTGGTCATGTCATGTTCTTGACAAATCACCCCTCCTTCTGTGAGTTTTAGATATAGCGAATAACCACAAAATCTCAGAAAACACCTAGAAAGTGAGTTTGCACCTTCTCTTAACATTTCCCACTGACTGCCTCTCCTCCCCATCTAGCTCTGTACAAACCAGTAGAAGGCACTCAGGGTGGTATTTGACAGTGGTACCTATAAATACATGCACCCCTGCACACTTTCTCTGTGTACTTTTTAAGGGAGTTCAGTTGTTGCATTGCTTTCCCCCCAGCCTTATAGCTATGATGAGCTTATGGATGCCACTGCTGCATAATCACAAGAGAAGGTGCATTCTTCACTAGACCTAGGCTGCTGCGTGCTGGGTTAATACTTTAACCCCATTTTTTGTTTTGTTTTTTTGTTGAAGTGCAGTAACCAATATCCTAGTGTTTTTTTTTTTGTTTT
  3   1   2       add Spl1      in                         CABK3689.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAATGTCTAGCTTTATTTGCAGCTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGTGTGTGTATTTTTTCACTTATTTCTATTCTTTCATCTTGTTTTGTCAGGGATTTCATTGGTTGTAACATTGTGTTCCCTCCCCTTTAAACTAGAAATGTACCTGAGTTTTTTGCATGTGTATTGCTCATTTGTGTGTTGTGTTACAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGTGAGCAGCATGTATTGTCTGGGAACTATCGTTATTGCTTCTAGGATAGCCTTGTCCACTACTTATGGCAGGCACATACATTATTTTTTCTACGGGAGTACAGTGACTGAACCTATGCTGCCCGTGGTTCAAAAAAATACTCTTGTCTTGTAGGAGCAACTTTCATTGATGGTTGAGGTACCGGTACAGGGAATCGGATTAACAAATAGACATTTCTCATTCCATTAAACATTTCTATATGATTATCTGAATATGTAGTACCTTTTGTGGGTTTAGGTTTTTGAACAAACAACAACAATTATTTCAGTGAGATAAAATAACATTTAATGGCTCAAAATTAAACAAACAATTTCAAATGAAACAAACCATAATATACCAAACAATGGAAAGGTGCATCCTAGTGTCTCATGGTACCCACTCTCCTAACGCGTTTCGCACCAATGGGTGTTCATCAGAG
  5   1   2       ext Egg       in                  TEgg074b10.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGACAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGATAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCA
  5   1   3        nb Egg                            TEgg084a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTT
  5   1   2       add HdA       in                   THdA008f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTCTGGANACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAATTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTT
  5   1   3        nb Gas  5x3  out                  TGas123o13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGCACTCCTACTTCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAAGTATGGCTGCGTTAAATGGAAGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAACAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAAGGTTTGGGGGCTGCTGGGAGTCAAAAGAAAGCCCTGAAAGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTC
  3   1   2       ext Egg       in                    TEgg074b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGGTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTTATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGGTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCCGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAACGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCGATATTTAAACCTGCATTGATTATTAAAGGAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas       in                   TGas072n24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTT
  3   1   2       add HdA       in                   THdA008f12.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGTTGCACTCCCTTCACTTTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATTGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTTTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGGTAAGTGTGGGAAGGAAAGTCCAAAACCAGGATGTATAGCTGGAGGAGCCCACTTAGTAAGAACACACAGACTATGCTGACTTTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTAAAAGGTATTATTATTATAATTATTATTGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   4      seed Gas6 5g3  in                         ANBT1373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCAGCAGTATGCTGCCGNTGCACTCCCTTCACTTTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTTTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGGGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAACC
  3  -1   2       ext Thy1      out                       CBST4633.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTCTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAAACAAAAAAAAAAAAGATATAAATCTATTTTTCTAGAAATTCATAGTAAACCACTTAATTTTGGGACGCTACTTTGTACCTATCTTTTGAGCAGGCCTAGATGGCACACCA
  3   1   2       add HdA                             THdA034i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGGGGGTTGTTGGGAGTCGAAAAGATGGCCTTGAAGGAGCCACCCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGACTACGAAGAGCGCCTCTTGGTTTAAACCTGCATTTGATTATTAAAAGGAAAACAAAAAAAAAAAAAAAAAAGC
  5   1   3        nb Neu                            TNeu005j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                NAAAAAGCCCTNGAAGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAAAC
  5  -1   2       ext Egg                            TEgg094c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTCTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGGGTATTTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAAAAAAAAAAAAAAAAAGCGGCCGCGTCGACACTAGTT
  3   1   2       ext Neu       in                    TNeu083j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Egg  FL   in                    TEgg064f02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAAAAAAAAAAAAAAAA
  5   1   0       chi TbA                            TTbA063i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTTAATGATGNGGAGGTTAATGCATCGCACATTGCCTCAGATGCACACGTATGAGAGAACCGAGTGATTGGGCGTAGATGAGTCCTAAAAGATTGTTGTAATATTCTGGACGATACTGTTTTACCTCCGGAGACTGTGGTTCCTCCCTTCACGGTGTTTGCTGGATGTCCGGGTCTGTTTTCTGGAGAGCTCCCAGAATGCACACAAGACCTCATGATTGACGTGACCAAGAATTACTACCAGAAGTTCCTACCCCTGACACAAATTTAAAAGTCTCTTCTCATGGCTTGAGCTTTCTCCTTTTTTTTTAATTTGGTAATGTATATATGTTAT
  3   1   3        nb HeRe                             EC2CAA10BD03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAAATTGGTTTTGCTACAAAGACTACGAAGAGGA
  5   1   3        nb Neu                            TNeu135d17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTTTGTTTTTGTTTTCTAGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTTGTTTTTTTTTTTTTTTCTTTCTTTATGTGCCTTATGTGTGTGTGGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGG
  3   1   2       ext Gas       in                    TGas072n24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTTTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTGTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAACCTGCATTTGATTTTAAAAGGAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAR5143.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAACTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTCTTTTTTATGTTCCTTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTG
                                                  Xt7.1-CHK-1008282554                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAACTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTCTTTxTTxxxxTxCxTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGTTTATT
  5   1   2       ext Gas  5g3  in                   TGas121c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAGCGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGCCCTGATGGAATG
  5   1   4   10 seed Liv1 5g3  in                         CAAR5143.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGTGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCANAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGNCAATGCAGCAACTGAATGCAG
  5   1   2       ext TpA  5g3  in                   TTpA023h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGACCCGGGGGACGGCGAGCGGGAAACGGGAGCTGAGGGCGGCTCTCCCCCCACCCGGTGCAAGTAACTATCAGGGTCACCTGATCTTCAGGACTCTGATCAGTTTCTTGGAAATCAAGAAAACGCTAATTTCCAAGAAAATGAATGGCACAATGGACCACCCCGACCATCCGGATCCAGACTCCATCAAGATGTTTGTGGGTCAGGTTCCTCGAAGCTGGTCAGAGAAAGAGCTAAGGGAACTCTTCGAGCAGTATGGAGCTGTCTATGAGATTAATGTTCTCCGAGACAGAAGCCAGAATCCTCCCCAGAGCAAAGGATGCTGTTTTATTACTTTCTACACAAGAAAAGCTGCGTTAGAAGCACAGAATGCTCTGCACAACATGAAAGTTCTCCCTGGGATGCATCATCCAATACAGATGAAGCCAGCGGACAGTGAAAAAAATAATGCTGTTGAAGACAGAAAGCTCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCNCCAATAGTGGTTAAGTT
  5   1   2       ext Gas7      in                         XZG46989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTTTGTTGGGATGGTTTCCAAGAAGTGTAATGAGAATGATATCCGGGCCATGTTCTCTCAGTTTGGGCAGATAGAGGAAAGTCGCATCCTCCGAGGCCCTGATGGAATGAGCAGAGGTTGTGCATTTGTTACATTTACAACCAGATCCATGGCACAGATGGCTATCAAAGCCATGCACCAAGCACAAACTATGGAGGGCTGTTCCTCCCCAATAGTGGTTAAGTTTGCAGACACTCAGAAAGACAAAGAACAGAAGCGAATGACGCAGCAACTTCAGCAGCAAATGCAGCAACTGAATGCAGCCTCAATGTGGGGAAACCTTGCTGGACTGAGCAGCTTGGCACCCCAGTATTTAGCACTCCTCCAGCAGACCGCATCCTCTGGAAACCTCAACTCCCTAAGTGGCCTCCACCCTATGGGAGGTGAGTACGCCACTGGAATGACATCAGGACTTAATGCCATGCAGTTACAGAACTTGGCAGCTTTGGCAGCTGCTGCTAGCGCTGCCCAGAATACCCCAAGTGCAGGCTCAGCACTCACTACTTCCAGCAGTCCCCTCAGCATCCTAACCAGTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTC
  5   1   2       ext Gas7      in                          XZG5228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCCGGCTCCTCCCCCAGCTCAAATAACAACTCAGCTGTCAACCCCATGGCATCCCTAGGAGCTCTGCAGACATTGGCAGGGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGATTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTCTTTCTTTATGTTCCTT
  3   1   2       ext Gas7      in                          XZG5228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCCACAGCTGGTCTCAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGATTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATT
  3   1   4      seed Liv1 5g3  in                         CAAR5143.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGGTCTCAATGTCGGTTTCGCTTGCAGGTATGGCTGCGTAAATGGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTATTAAAAGGAAAAAAAA
  3   1   2       ext Gas7      in                         XZG46989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAATGTCGGTTCGCTTGCAGGTATGGCTGCGTTAAATGGAGGCCTTGGCAGCAGCCTCTCCAATGGCACTGGCAGTACGATGGAAGCCCTTAGTCAAGCTTACTCTGGGATTCAGCAGTATGCTGCCGCTGCACTCCCTTCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTTTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGATTTTT
  3   1   2       ext Gas  5g3  in                   TGas121c19.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCCCTTAGTCAAGCTTATTTTGGGATTCAGCAGTATGTTGCCGTTGCACTCCCTTCATTTTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCACCCTTTTTATATCCCCCCTCCCCCAGGAGTTGGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCTTGGACAAACAAAGGAACCTCAGCAAATGTTTTGGTTTGGTAAGTTATGACAATCCCGTTTTTGCTCAGGGTGCTATCCAGTCCATGAAGGGCTTTCAGATTGGAATGAAACCCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAACCCGTATTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTTTAAAGCAGGTGGGGGGGGGGTTCAAGTACATCGTCCAAATCCTTGTTTTTTCAGCTTTTTTGAGGCTTGAACTTTCCCCTTTGAATTTTGGGCGGCCCTTTTGAGGCTAAAAGGTATTTTTTTTTTGTTTTTTTTAAGGAGGGGTATTTTTTTTTTCTTTCTTTATGTCCCTTAGGGGGGGGTTGCCAAATGGGTTTTGCTACAAAGACTAGGAAGGGGGACGCAATATTTAACCCTGCATTTGTTTAAAAGGGGAAACCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       ext TpA  5g3  in                    TTpA023h21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTTTGTCACAACAGGGTTTGGGGGCTTCTGGGAGTCAAAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATTCCCCCTACCCCAGGAGTTGGGGGACCAGGGCCTCCTGCAGAAGTTCATGCCATTTGGAAAAGTTGTGTCCGCCAAAGTTTTTTTTGACAAACAAACGAACCTCCGCAAATGTTTTGGTTTGTGTAAGCTATGACAATCCCGTTTTTGCTCAGGTTGCTATCCAGTCCATGAAAGGGTTTCAGATTGGAATGAAAGGCCTCAAAGTCCAACTTAAACGCTCCAAGAATGGAAGCAAACCGTTCTGAAAAATACTACCCTGGGAAGTGAGCGAGAAGGATGTTTTGATCCCTTCCCGCCATTTGTCCATCATTGTGCCTTTAAAACAAGTAGGTGTGGGGTTCAAGTACATTTTCCAAATCCTTGTTTCTTCAGGTTCTTGGAGGCGTGAACTTTCACCTTTGAATTTTGTGGTGGCCTTTTGAGGAGAAAATGTATTTTTTTTTTGTTTTTTAAAAAAAGGGGAATTTTTTTTTCTTTCTTTAGGTTCCTTATGTGTGGGTTGCCAAATTGGTTTTGGTACAAAGAGTAGGAAGAGGGCCGCAAAATTTAAACCTGCATTTGTTTATTAAAAGGAAAACAAAAAAAAAGGGAAAAAAAAAAACTTAAACCAAGAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu029k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCGGGTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGATCCCTTCCTGCCATTTGTCCATCATTGTGCCTCTAAAGCATGTCGGTGTGGCGTTCAAGTACATCGTCCAAATCCTTGTTTCTTCAGCTTCTCTGATGCTTGAACTTTCACCTCTGAATTTTGTGCTGACCTTTTGATGCTAATATGTATTTTTTTTTTGTTTTTTTAATGATGTGTATTTTTTTTTTCTTTCTTTATGTTCCTTATGTGTGTGTTGCCAAATTGGTTTTGCTACAAAGACTACGAAGAGGGACGCAATATTTAAACCTGCATTTGA
  5   1   2  SIG                                    Xt7.1-TEgg103b21.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGGTAAGTGTGGGAAGGAAAGTCCAAAACCAGGATGTATAGCTGGAGGAGCCCACTTAGTAAGAACACACAGACTATGCTGACTCTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTATTATTATTATTATTATAATTATTATTTGGACTTTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTATATATATATAAGTGTGTGGGTAAAACTAGA
                                                  Xt7.1-CHK-1008282556                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGGTAAGTGTGGGAAGGAAAGTCCAAAACCAGGATGTATAGCTGGAGGAGCCCACTTAGTAAGAACACACAGACTATGCTGACTCTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTATTATTATTATTATTATAATTATTATTTGGACTTTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTATATATATAxxxGTGTGTGGGTAAA
  5   1   2       ext Egg                            TEgg103b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACTCTACAACCAGAGCCTTTTGTCACAACAGGGTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGGTAAGTGTGGGAAGGAAAGTCCAAAACCAGGATGTATAGCTGGAGGAGCCCACTTAGTAAGAACACACAGACTATGCTGACTCTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTA
  5   1   2       ext Gas       in                   TGas086a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTGGGGGCTGCTGGGAGTCAGAAAGAAGGCCCTGAAGGAGCCAACCTTTTTATATACCACCTACCCCAGGAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGGTAAGTGTGGGAAGGAAAGTCCAAAACCAGGATGTATAGCTGGAGGAGCCCACTTAGTAAGAACACACAGACTATGCTGACTCTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAAAACAGCTTGTACTTTTTT
  5   1   4      seed Spl1      in                         CABK1317.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGTTCGGGGACCAGGACCTCCTGCAGATGTTCATGCCATTTGGAAATGTTGTGTCCGCCAAAGTTTTCATCGACAAACAAACGAACCTCAGCAAATGTTTTGGTTTCGTAAGCTATGACAATCCCGTTTCTGCTCAGGCTGCTATCCAGTCCATGAACGGCTTTCAGATTGGAATGAAACGCCTGAAAGTCCAACTTAAACGCTCCAAGAATGACAGCAAACCGTACTGAAACATACTGCCCTGGGAAGTGAGCGAGAAGGATGTTCTGGTAAGTGTGGGAAGGAAAGTCCAAAACCAGGATGTATAGCTGGAGGAGCCCACTTAGTAAGAACACACAGACTATGCTGACTCTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTATTATTATTATTATTATAATTATTATTTGGACTTTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATAT
  3   1   4      seed Spl1      in                         CABK1317.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTATGCTGACTCTCAGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTATTATTATTATTATTATAATTATTATTTGGACTTTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATGTACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTTATATATATAAGTGTGTGGGTAAAACTAGAG
  3   1   2       add Neu                             TNeu117d24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACATTCAGCAGCTCTGAAGCATTTCCATGTGCTTAAAGCCAGAAGCTTCATTTTCCTTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTATTATTATTATTATTATTATTATAATTATTATTTGGACTTTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAAGATGCAAGAGTCCATGTACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTATATATATATAAGTGTGTGG
  3   1   2       ext Gas       in                    TGas086a20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAGCCCTGAAGCATCTCCATGTGCTTTAAAGCCAGAAGCCTCATTTTCCCTCCTAAAGACTCTGGGTACAACTATTTTTTTGTTGTGGATTTTGCTTCTTATGGAAGAACAGCTTGTACTTTTTTGTTCCAAGTGTTTTATTTTGGAGTTTAGGTGCCATATCAGTGAATTTTATTATTATTATTATTATAATTATTATTTGGACTTTTTGCTGTGTTTTGTACAATGTGTGACATGTCCCAACGCCAGCACCCTTGGAAAGGGAAAGGATTAGGAGCCGGTTATATGACACTGACCAGCCTTAGAGAGTCCTGACTCGTCCTCGATGGTGTATTGCCTTTATTTTGCTATGGCTGCTATTCTGCACACCTTCCTGTGTGGGGACATCCCAGGAATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAAAAGGGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTGATGGGGTTATATATAAGTGTGTGGGTAAAACTAGANNGAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Gas       in                   TGas108b10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTATATATATAAGGGTGTGGGTAAAACTAGAG
  3   1   3        nb Gas       in                    TGas108b10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTATAAGCACACACTGCTAGCAGCCGTAGGCTTCGGGACAGGGTTTATTAAGGCTAACTTAAACCAAATGTTTGGGGCAACATATAAAGCCCTTTGCAATTGGAACTTAGCTCCCCCCTTCACTATTGCTCTTTGCAACATGCAAGAGTCCATATACAAGGTGCAGGAGTCAGGCTTCTCTAACGTTTACATACTGGTGTTCGGTGTTGTGTGTTAGGGTAGCTATGTATTTCATGTGTCCGTATGCCTATGTACTATCCCTTGTACATACGTGTACCCGTGATATACATGAAAACGGTGAACTGCTAAAACTTGAATACTGTACACTCAGAGAAATGTTATGGTTTGGTATAATGTGAAAAGTATTGAGGCTTCCAGGCTCCTATAATGAACATTTTTTTTTTTTTTATATATATAAGTGGTGGGTAAACTGGAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)