Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABH4898.3.5                         15 END     1           2        6                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012074402 Xt7.1-TGas067j17.3.5 - 45 ESTs
                                                                       ......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas067j17.3.5                                                                                       CTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTGCGCAGACACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTT
                                                  Xt7.1-CHK-1008226250                                                                                             GCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTGCGCAGACACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTCAAAAA
                                                      consensus depths                                                                                            2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     4     3     4     3     4     4     4     4     4     5     5     7     7     8     8    10    10    12    12    13    13    14    14    15    15    17    17    18    18    19    19    19    19    19    20    20    21    21    22    21    22    23    24    24    25    24    25    26    28    26    29    24    28    25    28    27    29    26    28    26    31    27    30    28    34    28    34    28    34    28    34    27    33    28    34    26    32    27    33    28    34    29    35    29    35    28    34    28    34    27    33    27    33    26    33    27    33    27    33    27    33    27    33    26    33    25    32    25    32    23    32    31    32    31    32    29    31    30    32    31    32    29    31    30    31    29    31    29    30    30    30    30    30    26    29    26    28    27    29    25    29    22    26    24    26    25    26    26    26    26    26    24    25    26    26    25    25    23    24    23    24    23    24    22    24    16    16    14    14    13    14     9    10
  5   1   2  SIG                                 Xt7.1-IMAGE:6990880.5                                                                           TAATGCCCCCATTAGGCCAGGGAGCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCCACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCCTGCGCCCCCTGGTGTCGTCCTTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGG
  5   1   2  SIG                                    Xt7.1-TGas067j17.3                                                                                      GCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTGCGCAGACACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACT
  5   1   2  SIG                                      Xt7.1-st105g10.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTACTTCAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------G-
                                               BLH ATG     305     900                                                                                       
                                               BLH MIN     305     123                                                                                       
                                               BLH MPR     305     123                                                                                       
                                               BLH OVR     305     158                                                                                       
                                               CDS MIN     305       1                                                                                       
                                               EST CLI     285       1                                                                                       
                                               ORF LNG     305      11                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Sc ==== 1e-013     NP_012584.1 Interacts with Syf1p, Prp39p and Ypl213wp.; Isy1p [Saccharomyces cerevisiae] ==========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Sp ==== 5e-032     XP_788670.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Ce ==== 2e-064     NP_505803.1 putative protein, with 2 coiled coil domains, of eukaryotic origin (31.3 kD)(5L480) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 4e-073     XP_698746.1 PREDICTED: similar to CG9667-PA, partial [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 5e-095     NP_649768.2 CG9667-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Hs ==== 2e-136     NP_065752.1 KIAA1160 protein [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Mm ==== 7e-138     NP_598695.1 RIKEN cDNA 5830446M03 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 6e-141     XP_414311.1 PREDICTED: similar to Hypothetical protein MGC76019 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 3e-152     AAH72869.1 MGC80278 protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 3e-152     NP_001085511.1 MGC80278 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xt ==== 1e-160     AAH61420.1 Unknown (protein for MGC:76019) [Silurana tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas067j17.3.5                                                                                                                             TGA---------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAAATG---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2  SIG                                 Xt7.1-IMAGE:6990880.5                                                                           TAATGCCCCCATTAGGCCAGGGAGCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCCACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCCTGCGCCCCCTGGTGTCGTCCTTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGG
                                                  Xt7.1-CHK-1008289614                                                                                 CCCCATTAGGCCAGGGAGCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCCACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCCTGCGCCCCCTGGTGTCGTCCTTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTT
  5   1   1           Neu0 FL                     IMAGE:5384697.FL-MGC                                                                              TAATGCCCCCATTAGGCCAGGGAGCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext TbA  5g                        TTbA060b19.p1kSP6                                                                           TAATGCCCCCATTAGGCCAGGGAGCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCCACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCCTGCGCCCCCTGGTGTCGTCCTTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCCCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGAACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAA
  5   1   4      seed Neu0 FL   in                    IMAGE:5384697.y1                                                                              TAATGCCCCCATTAGGCCAGGGAGCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGC
  5   1   2       ext Gas1 5g                            IMAGE:6990880                                                                                                                                                                                                                                                                                                                                             GTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCANAAGGGGAGGAAGGGNNCACAGAATTATTGCCCACGTGCCAGTGCCGACGCAAAGGAGATCCGAGAGCGCTCATTCCAGGAA
  3   1   4      seed Neu0 FL   in                    IMAGE:5384697.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2  SIG                                    Xt7.1-TGas067j17.3                                                                                      GCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTGCGCAGACACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACT
                                                  Xt7.1-CHK-1008289616                                                                                            GGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTGCGCAGACACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTT
  0   1   1           Gas  FL                     TGas067j17.FL-Sanger                                                                                                                                                                                                                                                                                                                                                  TCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGATCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTAAAATACAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Te5       in                         CAAO8779.5p GCTGCCCCTCCCCCCCCATCTACCTGTTGGGCCGCCCCGGGGCAGAGCCAGTAAGGCTGCAGTAATGCCCCCATTAGGCCAGGGAGCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTGCGCAGACACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTACTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGATCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGNGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCC
  5   1   3        nb Gas8 5g3  in                           st9m16.5p                                                                                      GCTGTAGGCCGAACCCGGCCCTATCAGAGCGGCCTATACTGAGGGCCTGGGCCGGTCCCTGTCGGGCTATGAGGGGCGCAGCTAGGAACCGGTCTGTTCCGGGCACAGGCGGCTGCGGGTAATCCCCCGGGTTTATGGGCGGTACCTGCTGAGTATTGCGGTCACGTGGTGCGCAGACACGTGGTATCTCGGTACAAATCAGAATCTTTCCGCTGCGCGCCCTGGTGTCGTCATTTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCC
  5   1   2   12  ext Gas7 5g3  in                         XZG32218.5p ...............................................................................................................................................................................................................................................................................................................................TTCCGGTGCGACTGTTTCTCCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGATCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGAGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCNGGTGCCGA
  5   1   3        nb Gas  FL   in                   TGas067j17.p1cSP6                                                                                                                                                                                                                                                                                                                                                   CCCAGTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGATCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGGTGCTGGTGCCTCTGGAG
  5   1   3        nb Gas8 5g3  in                          st11g23.5p                                                                                                                                                                                                                                                                                                                                                       GTCCGGCTCTGCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCNATGGGGACAGGAATGAGGAGNAGGAGGAAGTGAANTATTTATGCTGTGGCTGCANATG
  3   1   3        nb Gas6      in                         ANBT2653.3p                                                                                                                                                                                                                                                                                                                                                                 CCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGGGGAGGAGAAGAAAAAAAAAAA
  5   1   3        nb Gas6      in                         ANBT2653.5p                                                                                                                                                                                                                                                                                                                                                                 CCGTGTGTGTCCGGCGGCTGTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGGGGAGGAGAAGAAAAAAAAAAA
  5   1   3   12   nb Gas7 5g3  in                          XZG7219.5p ...................................................................................................................................................................................................................................................................................................................................................................................GTGCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGA
  5   1   0       chi Tbd1      in                        CBXT22673.b1                                                                                                                                                                                                                                                                                                                                                                                      GCGCTTCCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGGGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCAGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTCTCTGTGGCGCCGCCTCTGTCTTCTTCCCCCTCAGGGTACGGCCAGGTCTGTGCTGCAAGCAGTGTGGCAACCCCATCTCCTGTATATATACAGCTGGGGGTGATGGTGGCGCTCTAGGCCTGGCCCAGAGAAAAGAGACGCAAATAGTGAGACACCATTTATTTAAGTAAAATCCTGTACAAATGGGCCTCTCACAGGAGTGC
  5   1   3   10   nb Hrt1 5g3  in                         CAAQ7397.5p ...........................................................................................................................................................................................................................................................................................................................................................................................CCTGCTTCCGCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAAGAGATCGAGGAGGCGCTCATTCGCAGGAA
  5   1   3   10   nb Tail 5g3  in                         CBSW1177.b1 ....................................................................................................................................................................................................................................................................................................................................................................................................GCCATGGCTCGAAATGCAGAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGATCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGC
  5   1   0       chi Tad0                               IMAGE:6985019                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAAGGCCATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGTCGGACTCGGGGAGTTCAGGATAAGGGACTTGAATGATGAACTCTACACGTTCATCACGAAACAATGCACATTTGAGACGAACCTTGCGGGTCAATGGTCCCATGTGATTTTAGATATACATTTGCTTAGAGATGATCTACTACTTGCTCAAATCTGTAATAGGTTGCTCTTACGTGGTGGGGTTAATGACTGTGTCTCGCGTATAGCACGATCATAAGTTATATAGTCTCCATGTAGCTGGTATACTAGTCTCTACCTATAAATGTATTCCAGCTAATTATCCACCTACTCTGCCAATTAATCCTATAAATTAACTGAATATTTCTGCCTTGCTATTAATAGCAGATAATACACAATTTTTATGATTTCTACATATAAATTATACTTATAATACAAGTTAGTCCAAAGCGATACATAGAAAAGAAGAAATAATCCAAGATTTTCTTTCTTTCTTCTTATCGATATTACACTTATTATTATTCCTCTCTACGTTTATTCTTTTTTACATTACTATTTAGTTTTCATATTGATTTTT
  5   1   3        nb Gas8      in                          st66a16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                ATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTANAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCANGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGNGCCCAAGATGCTCGATCACGAAGGG
  5   1   3        nb Gas8      in                          st66b16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                ATGACGGCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGA
  5   1   2       ext Ovi1      in                         CABI4067.5p                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGTTGGCGCGGTTCCGCCAGGCTCAGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCAGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAATGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTA
  3   1   3        nb Gas  FL   in                    TGas067j17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTTGAGGAAGGGAAAGTAAAGGAAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGATCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGACGCAATACAGTCGGACTTTAAAAT
  5   1   3        nb Neu                            TNeu047g21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGGAGACCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCNAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCAGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGAGGAAGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCC
  5   1   3        nb Tad0      ?                      NISC_no09f09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGTTCCTCGCCTCTGAGTGCAATGAGCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCA
  3   1   4      seed Te5       in                         CAAO8779.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGTGCAATGATCTGCCCAAAGCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTC
  3   1   2       ext Ovi1      in                         CABI4067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGAGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCAGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTCAAAAAAAGCCTCTCGCCCTATAGGATCG
  3   1   3        nb Hrt1 5g3  in                         CAAQ7397.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAGTGGAGACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCC
  3   1   3        nb Gas8 5g3  in                           st9m16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACGACAGATAATTGGGGAAATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATT
  3   1   3        nb Tail 5g3  in                         CBSW1177.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                          st66b16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATT
  3   1   3        nb Gas8 5g3  in                          st11g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAAAGAAAGTGGCACAGATTCAGAATGCCGGACTCGGGAGTTCAGGATACGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTA
  3   1   2       ext Gas7 5g3  in                         XZG32218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGATTCAGAATGCCGGACTCGGGGAGTCCAGGATACGGGGACTTGAATGATGAAATCAACAAGCTCATCAGGGAAAAGGGCCACTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGAGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCATaaaaaaagaaaacaaatagaaaaagaaaaaataaaaaaaaaaagataaaaaaaaaCC
  3   1   3        nb Gas7 5g3  in                          XZG7219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGAGGTCCGTATTAAGGAGCTGGGTGGCCCGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCGCCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTCTAAAAAAAAAAAAAAAATT
  3   1   3        nb Gas8      in                          st93o18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTA
  5   1   3        nb Gas8      in                          st93o18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCCCTCCCACCCCCCAGGAAGACCCGCGCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGGATGAGGATGATGGGGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTAAAA
  5   1   3        nb Gas8      out                         st68b16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGANAAAGAACCCCTCCCACCCCCCAGGAAGACCCNNNCGGAGCTGATGAAGAGCATTGATGCCGAGTATTATGGGTACCGGNATGAGGATGATGGGGTGCTGGTGCCTC
  5   1   0       chi TbA       in                   TTbA026l02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGCATTGGGCCCATAGTCCGGGCCACCCAGCTCCTTAATACGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGGAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTC
  3   1   0       chi TbA       in                    TTbA026l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGCATTGGGCCCATAGTCCGGGCCACCCCAGCTCCTTAATACGGACTATGGGCGCATTGGGCCCAAGATGCTCGATCACGAAGGAAAGGAAGTGCCGGGAAACCGTGGTTACAAGTACTTTGGCGCTGCTAAGGATTTGCCCGGCGTCCGGGAACTGTTTGAGAAAGAACCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAAAAGAAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCTACAGAAATTTATTGCCCACGTGCCGGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCTTTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCGGCGAGACCTTATTGGCGCGGAGCGAGGACGCGAAACGACTTCTAGGCGTATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTCAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                          st66a16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGAGGAGGAGAAGAAAGCTATNGNGGNGGCNCTNGNGAAGTGGNGGCAGGAGAAGGAGGCGCGTCTGNCCANTGGGGACAGGANTGAGGAGGNGGAGGANNTGAATANTTATGCTGTGNCTGCAGATGATGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCTCGTGNCAGTNCCGACNCANAAGGAGATCGANGNGGCNCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATANNCCAGCNAGACCTTATTGGCGCAGANCGAGGACGCAAAACGACTTCTAGGCATATAAATG
  3   1   2       add Tbd1      in                        CBXT22673.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCTGACTTTTCTACTTCTCTGTGGCGCCGCCTCTGTCTTCTTCCCCCTCAGGGTACGGCCAGGTCTGTGCTGCAAGCAGTGTGGCAACCCCATCTCCTGTATATATACAGCTGGGGGTGATGGTGGCGCTCTAGGCCTGGCCCAGAGAAAAGAGACGCAAATAGTGAGACACCATTTATTTAAGTAAAATCCTGTACAAATGGGCCTCTCACAGGAGTGCGGTGTTACAGTCGCATCAGCCCGACGCGTTTCACGTCATGTTCGTTGCGCTTCTTCCGGAGCAAAATGTACTGAACCGGACCCTTCCCTACACCCCCGCCGAGCCGCGCGTTACAGTAACATCTGTATATGCACAGAGGGCGTTTGCGCCATGAGCGCGTGAGAGTGTACGTTTGTGTATCTGGCAGGTAGTTATAATGGATATAACCGCTAAATACATAAATAAAACCTGTAAGTAGCCCCCGGGGAAACTGCGCTCGCCATAAGTAAGAAAAAAAGCGCTAAAATGATTAATACACGTCACGCATAATAAATAAATGAGATGATCCCAAAAAAAAAAAAAAA
  3   1   3        nb Gas8                                  st32n22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATT
  5   1   2  SIG                                      Xt7.1-st105g10.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTACTTCAAAAAA
                                                  Xt7.1-CHK-1008289618                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTACTTC
  3   1   4      seed Gas8      in                         st105g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTAT
  3   1   2       ext Gas8      in                         st106g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGNGCCGCTATT
  3   1   3        nb Gas8      in                         st107g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTGCTGGTGCCTCTGGAGCAAGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGNCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTANGCATATAAATGGGAGTGGCCTAATNNGCCGCTATT
  5   1   2       ext Gas8      in                         st106g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGANAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCANAAGGGGAGGAGGGGCAACANAAATTTATTGCCCACGTGCCAGTGCCGACGCANAANGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTACTTC
  5   1   4      seed Gas8      in                         st105g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGAGAAGGAGGCGCGTCTGGCCAATGGGGACAGGAATGAGGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCAGAAGGGGAGGAGGGGCAACAGAAATTTATTGCCCACGTGCCAGTGCCGACGCAGAAGGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAGAGCAATACAGTCGGACTTTTCTACTTCAAAAAAAAAA
  5   1   3        nb Gas8      in                         st107g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGGAGGAGAAGAAAGGTATCTGTAACCCCTCGTGTTCCCCTGTCTGAGCTACAAATGGAATGGGGCTGTGGGGTACATTGCCAGGGGCTGTGGGTGGGACTTATGTTTGAGGGAGGGGCTGAATCCAAGATAGGAACCTGGAAGCTGATCCAGGGAATCTTCCTATTTGTTGCCTCCAGGGGGCAGATCTTACTCGGTGCTCTCGGCCAATAAGATGTGAGCTTGTTGGCAGGTGGGCGGGGTTGCTACGCGCCATTAGCTGGTACTCAGCCCACACTCTGTTTGTAGCTATAGGGGAGGCGCTGGAGAAGTGGCGGCAGGANAANGAGGCGCGTCTGGCCAATGGGGACAGGAATGANGAGGAGGAGGAAGTGAATATTTATGCTGTGGCTGCAGATGAGTCGGGGGATGACAGTGACAGCGGCGCANAANGGGANGAGGGGCAACANAAATTTATTGCCCACGTGCCAGTGCCGACGCANAANGAGATCGAGGAGGCGCTCATTCGCAGGAAGAAGATGGAGCTGCTGCAGAAATACGCCAGCGAGACCTTATTGGCGCAGAGCGAGGACGCAAAACGACTTCTAGGCATATAAATGGGAGTGGCCTAATGTGCCGCTATTTGTGTATATTTGTACAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)