Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012074936 Xt7.1-CABK8644.3 - 50 ESTs
                                                                       ....-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK8644.3                                                                                                                                                                     AGTTGCTGAAGTTGCTGCCCAGTCCTGGCCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225693                                                                                                                                                                           TGAAGTTGCTGCCCAGTCCTGGCCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                          2     4     3     5     3     6     5     8     7    10     7    10     7    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10     9    12    10    12    10    12    10    12    11    14    11    14    11    14    12    14    12    14    12    14    12    14    12    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    14    15    14    15    14    15    13    15    15    16    15    16    15    16    15    16    15    16    15    16    14    16    15    16    15    16    14    15    12    14    13    15    14    17    14    17    14    17    14    16    14    16    14    15    14    15    14    15    14    15    13    15    13    14    13    14    13    13     8    10     9    10     9    10     8    10     8     8     8     8     7     8     6     7     7     7     7     7     6     6     5     5     5     5     5     5     6     6     7     8     8     9     8     9     8    10     8    10     8    11     8    11     8    11     8    11     9    12     9    12     9    12     9    12     9    12    10    12    11    11    11    11    12    12    12    12    12    12    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    11    14    12    15    11    15    11    15    12    16    16    17    17    17    16    17    16    17    17    18    17    19    18    20    20    22    18    22    18    21    19    23    22    25    21    25    22    25    23    25    24    26    25    27    25    27    25    27    25    27    25    26    24    25    24    25    24    25    24    25    25    25    24    24    25    25    25    25    25    25    23    25    24    25    24    24    23    23    23    23    22    23    22    23    23    23    22    23    20    21    21    21    20    21    21    21    21    21    20    21    20    21    19    21    19    21    21    22    21    22    20    21    21    22    20    22    19    22    21    22    21    22    21    22    21    22    20    21    18    21    20    21    18    21    18    21    18    21    17    20    15    20     5    11     6     8
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C---
                                               BLH ATG     373     141                                                                                                                                                                     
                                               BLH MIN     373      77                                                                                                                                                                     
                                               BLH OVR     373     662                                                                                                                                                                     
                                               EST CLI     -27       1                                                                                                                                                                     
                                               ORF LNG     373      37                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sc ---- 7e-007     NP_009887.1 Catalyzes the formation and isomerization of disulfide bonds during the foldingof secretory proteins.; Pdi1p [Saccharomyces cerevisiae] =======================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 2e-039     XP_688243.1 PREDICTED: similar to Wu:fc04g05 protein [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ==== 5e-043     XP_787930.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 1e-053     NP_504655.1 Short DumPY body and abnormal sensory rays DPY-11, membrane associatedthioredoxin-like protein (27.4 kD) (dpy-11) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 7e-055     NP_611838.1 CG5554-PA [Drosophila melanogaster] --------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 2e-058     XP_415026.2 PREDICTED: similar to Txndc13-prov protein [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xl ---- 3e-062     AAI34819.1 Unknown (protein for MGC:161007) [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 3e-064     NP_001025330.1 hypothetical protein LOC561444 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 3e-080     NP_082615.1 thioredoxin domain containing 1 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 7e-092     NP_110382.2 thioredoxin domain containing; thioredoxin-related transmembrane protein;thioredoxin domain-containing [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 1e-156     CAJ81944.1 novel protein containing thioredoxin domain [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK8644.3                                                                                                                                                                                                    TGA------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------ATG------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------TAA---------------------------------------------------ATG---------------------------------------------------------------------------------------TAA------------------------ATG---------------TAA---------------------------------------------------------TAA------------TAA------------------ATG---------------------------------------------TAA---------------------------------TAA---------------------------------------------------------------------ATG------------------TGA------------TGA------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TGA---------TGA---------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------TAG------------------------------TAA------TAG------TAA---------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           Egg  FL                     TEgg123p24.FL-Sanger                                                                                                                                                                          CTGAAGTTGCTGCCCAGTCCTGGCCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTATAAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Te1  5g3  in                        CBWN12320.b1 .........................................................................................................................................GGAGAAGGAACCGGAAGAGCTGCAGAGAGTTGCTGAAGTTGCTGCCCAGTCCTGGCCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATAT
  5   1   2   22  bld Tad5 5g                              XZT61653.5p ............................................................................................................................................AGAAGGAACCGGAAGAGCTGCAGAGAGTTGCTGAAGTTGCTGCCCAGTCCTGGCCCTGACACGCGTGAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGNGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCA
  5   1   2   22  bld Tad5 5g                              XZT42269.5p ...........................................................................................................................................................GCTGCAGAGAGTTGCTGAAGTTGCTGCCCAGTACTGGCCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTCCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAAACAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGTCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCA
  5   1   2       bld 1030 5x                         IMAGE:7026919.5p                                                                                                                                                                  AGAGAGTTGCTGAAGTTGCTGCCCAGTCCTGGCCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGTCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGAATGTTACAGCTCAGCCCGGACTGAGTGGCAGATTTATCATTACAGCACTGGCCAACAATATACCACTGCAAAGATGGAGTTTTTCAAAAAGTACCCAGGAATCTAGGGACACACCAAGGAATTTTTATTCCATTTTCCATCAGGTGA
  5   1   2       bld Egg  FL                        TEgg123p24.p1kSP6                                                                                                                                                                          CTGAAGTTGCTGCCCAGTCCTGGCCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTG
  5   1   2   10  bld Limb 5g3  in                        CBSU6427.fwd ......................................................................................................................................................................................GACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGGGGAGACAGCTGGCTGTATGAAAAGGCCTCATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGTCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATC
  5   1   2   10  bld Liv1 5g3  in                         CAAR3942.5p ................................................................................................................................................................................................CCCTGACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATC
  5   1   2   10  bld Ski1 5g3  in                         CABJ3259.5p .................................................................................................................................................................................................CTGAACACGCGTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGGCATTCCCTGTGTGGGA
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6977071                                                                                                                                                                                                            GTGAAAAAGACGAGACGAAGAATTTATTATTCTCATCAGACCCAGCAGATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTTGGATCAGGCAATGCCACAATTATTTTGGTTGAAGACCTGGGCATTTCCGGTGTGGGGT
  5   1   2   10  bld Int1 PIPE in                         CAAP2347.5p ...............................................................................................................................................................................................................ATCAGACCCAGCAGGTGAGACAGCTGGCTGTATGAAAAGGCCTCATCCCACAGAAGCGAAAGGTTACAAAGCAACCCTGGTTACCTCTACTACACCCAGCTTACGTATCTCCAGAAGATTCATCTCAGAGACTGTTCATTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTTGTCCAGCTATCCATGTGGATCAGGGCATGCCACAATTATNTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGGATTGATGACCCTGTTTTTAGGTCT
  5   1   2       chi HdA       in                   THdA032a13.p1kSP6                                                                                                                                                                                                                                                                                                                                                      TTCTTTACCACACCCAGACTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATAAGAGTTTTTTTTTATTATTTAGACGGCACAAAAGAAAATATATACATCTCATTCATATGTGCGGACTCTGGAGCATTAGCTGGAAGGCTATTCCATTTATCTATTTCTGTAATGTAGTGAATTTTTAGTGAACTTTTTAGTTTATTCCTTCCAAATTCAGATTTGTTTTCTGTTTGTAACTAGTCATCATCATCTGACATGTTTCCCTAGTAAACTTTATTTTCCAGGGGCAAATAGTACTTTAACTATAGTTTTCTTTATGATATGGCATAATTTACCTTTTTATCTTTACATTTTTCTTGGAAACCACTGTTTTGTACAAGGTATATTTGTTCT
  5   1   2       bld HdA  5g3  in                   THdA032b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                       TTCTTACCACACCCAGCTTACGTATCTTCAGAGGATTCATCTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCNNATTTTATGCCCCTTGGTGTCCTGCTTGTCNTNNNCTGCCNCCTGCGTGGAATGAACTTGCAGACTGGGGAGAATACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAACCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCACATTCTTTTCAGATGAGTG
  5   1   2       bld Spl1      in                         CABK6479.5p                                                                                                                                                                                                                                                                                                                                                                                               CTCAGAGACTGTTCATTTTGAGGTGCATCTCATCTAAACCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATC
  5   1   2       bld Int0 5g                         IMAGE:7795465.5p                                                                                                                                                                                                                                                                                                                                                                                                        TGCGGTCCATCGATTCGATTCGGCACGAGGCTGACCTGACACTGAGCCTTGCAGCAGTGGATCAGACTGAAATTCTCTGACTGTGCAAAACAAAAAAAAAACCAAATCTGCAGTGGTTTACTGGACAATCTAACCATACCAGTGCCATGACACGCCTGTTATTTTTATGCTTGGGACTGATACTGTGCTCCTCAGAAGTGCTGGCGAAAAAAGGGGATGTGATAGACATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTANGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGA
  5   1   2       bld Te1       in                         CBWN9086.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTACAGACAGCAACTGGAATGAAGTCTTGGAGGGGGAGTGGATGATCAAATTTTATGCCCCTTGGTGTCCTGCTTGTCATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGCGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGGTTCTACTTATAAGGTCTGTAGCCTGCAGTCTTG
  5   1   2       bld Gas7                                 XZG12555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATAAACTGCAGCCTGAGTGGAATGAACTTGCAGACTGGGGAGAAGACCTTAATGTGAATATCGCCAAAGTGGATGTTACAGCTCAGCCAGGACTGAGTGGCAGATTTATCATTACAGCACTGCCAACAATATACCACTGCAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTNCAGAATTCTGCCTCTT
  5   1   2       bld Ovi1      in                         CABI1713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAGATGGAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTAT
  5   1   2       bld TbA       in                   TTbA070o03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGTTTTCAGAAAGTACCAAGGATCTAGGACACACAAGGATTTTATCAATTTCATCAGTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGAGTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCAGGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCANAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTANGGGCATCATAATGCATTCTAAGTATTT
  5   1   2       bld TbA       in                   TTbA066c05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTTTTCATAAAGTACCAAGGATCTAGGACCACAACGATTTTATCAATTTCATCATTGAGAGGGAATGGGAAGCCATTGAACCTGTATCATCATGGGTTGGCCCAGATTCTTTTCTGATGACTGGCATGTCTGCTTTGTTCCAGCTATCCATGTGGATCACGCAATGCCACAATTATTTTGTTGAAGACCTGGCCATTCCTGTGTGGGGATCCTACATTATATTTGGATTGATGACCCTGTTTTTAAGTCTAATGTTGGGTTTGATTTTGGTGTTTGTGGCAGACTTCCTTTGTCCATCCAAAAGGCACAGACCCCAAGGATACCAATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAAATGAACTAAACGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAAGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCACAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTA
  5   1   2       bld Egg                            TEgg095m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATACCCTAAAAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGA
  5   1   2       bld Tbd1      in                        CBXT13370.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGCCTGCAGTCTTGTGTTATTCTAATCATGGACAAGTCATCATGGGAGAAGCCTAGTTTGTCATAGCAGTATGCAGGGCCCCTCACTGAATCCATAGTAAGCGTTAAAGGATTTCACAGCCTTCTCTGCTGCACTTTACAACTGAGGTACAAATGGATTGTCACTTTTCTTACTAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGC
  5   1   2       bld Spl2      in                        CBSS2301.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAACCTGCCCACTGTACCTGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCANATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTANACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCT
  5   1   2       bld Neu       in                   TNeu064l18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGCTGATAGGAAGGAACTGGAAGATGAACTAAAGGAAGAAGTGAATGAATTTGAAAATACCAAGCTTGGAGACAAAGAAGCACGTGATGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCA
  5   1   2       bld Tad5      in                         XZT32024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCTGTAGCCTGCAGTCTTGTGTTATTCTAATCATGGACAAGTCATCATGGGAGAAGCCTAGTTTGTCATTGCAGTATGCAGGGCCCCTCACTGAATCCATAGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGAT
  5   1   2       bld Gas7      in                         XZG17074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTGTCATTGCAGTATGCAGGGCCCCTCACTGAATCCATAGTAAGCGTTAAAGGATTTCACAGCCTTCTCCGCTGCACTTTACAACTGAGGTACAAATGGATTGTCACTTTTCTTACTAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTG
  5   1   2       bld Lun1      in                          CABD849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCCCCTCAGGACAAACTAAGGAAACGTACTGCAAAGTCTTGATGCTTATACAGTTTCTACTTATAAGGTCAGAACACATGCCACAGATCCTTGGACCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGNGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAG
  5   1   2       bld Te5                                  CAAO1256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCATACAGGAACATTTCTTCATGCCATCTTTCAAGAATTCTGCCTCTTCTCCAATTTATTCCAACTCCCTACAATTATTTAGGTATGATATTCTTCTCCTTGTGGTGCATTAATGTGATCTTTCCCTGTTTTCCTGCATGGGATGCCTGATTTCATAAAGGAAATGGGCTTTTCAAAGATTACTGCTACTAACATGTCTTTCCATACGGTTATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGTTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAG
  3   1   2       bld Int1 PIPE in                         CAAP2347.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTGTAACTACAATACCTGTAACACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTGAAAATATATTTGTATTTTGCCTCTCGCCCATA
  3   1   2       bld Spl1      out                        CABK8644.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTTTAGGGGCATCATAATGCATTCTAAGTATTTTAGGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTC
  3   1   2       chi Tbd0 5g3  in                       IMAGE:6977071                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTTTTCCTTTGTAAATTTCCCAAATTTGGGGCCCCTTTAAAAAATTTAAATTTTAGGTGTTTCGGAAAAAAAAAAATTTAATTGGTATCCCACTTTAGCCAAAAAACAAACCCATTATTACCAGCCAGAAAACTATTGCAAACCTTCAAAATATTGAACCCACTTAACAACAANCTGTTCTTGATCAATCAGTTACATTGATTTCCCATGTACTAAAACCTCCAAGGAAAGAGAACCAAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACCNNNCCCCGGTGGGGGGGACGNGGGCGGGTCGGGATGTCGGTGGGGGGTGCGGCGCGTCGGTGGTTCGGGGGGGTCGTGGGTGCGGTGGTGTGGCTGGGGACGTGAC
  5   1   2       bld TpA       in                   TTpA004l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTACATTATATTTGGATTGATGACCCTGTTTTTAGGTCTAATGTTGGGTTTGATTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTT
  3   1   2      seed Ski1 5g3  in                         CABJ3259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAATGCATTCTAAGTATTTTAAGGCTTTAAAGTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTT
  3   1   2       bld Ovi1      in                         CABI1713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGTATTTTAAGGCTTTAAAGTATATAATGGTTTTGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTAT
  3   1   2       bld Liv1 5g3  in                         CAAR3942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTATAATAATGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTATGCTGCTGCTTTGGTGAATTACATTATATTTT
  3   1   2       bld TbA       ?                     TTbA051k12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGTTTGGTTTAAAATCACATTTCTTTAATACAATTGGCCATAAAATAATTGGTGTCTGAAAAAATTATTGTATCGCTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTGTGATCATCAGTACATTGATTTCCAGGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTTTGGGGCCTAAATAGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTTTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTTTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTTTGTGGGTTTTAGCTAGAATATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGAGGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAATTTTTGGGGTGTAACACTGGTGAAGAGCCCCAACATGTATATGGGATGCAGTGTAGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTTTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTTTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACAAGCTGCAATAAATAAAATTTGTTTTGCTTAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Spl1      in                         CABK6479.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATCACATTTCTTTAATACAATTGGCCATAAAATAATTAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTT
  3   1   2       bld Spl2      in                        CBSS2301.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTT
  3   1   2       chi Tbd1      in                        CBXT13370.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGTGTCTGAAAAAATTATTGTATCACTAGCAAAACAACCATATACAGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAGTTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATTTTTTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACACAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA032a13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCAAAGCAACCAGATACAGCGGAACTATGCAATTCAAATATGACCCACTACACAACTGTTTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATGTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTAAGTTTTGGGGTCAGCTGATGGAGGCCACG
  3   1   2       bld Tad5      in                         XZT32024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCCCAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGTTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTT
  3   1   2       bld Te1  5g3  in                        CBWN12320.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAACTATGCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                    THdA032b13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAACTCAAATATGACCCACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGATGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAGATATATCTTTGTATTCTTTGTAACACTGCTGCAATAAATAAACTTTGTTTTGCTTAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Te1       in                         CBWN9086.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAA
  3   1   2       bld Limb 5g3  in                        CBSU6427.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTACACAACTGTCTGATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAGTTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACACAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTT
  3   1   2       bld Neu       in                    TNeu064l18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGCCCTTTTTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTGGGGTAAAATATTTTTTTCCTCTTTTAGTTTTGGGGGTGTAACACTGGTGAAGAGCCCCAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTTNAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA066c05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCATCAGTACATTGATTTCCATGTACTAAACCTCCAAGGAAAGAGAACCAAGTTAGTCTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGAATGCATCTTGCAAACTGTTCAAATGTGAATTTAATTTTATTTTGAATAGGTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTATTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTTTGTGGGTTTTAGGTAGAGTATTGTTCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTTTTTTATTATTATTGAAGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGAGATTCCATATGGATGCTTTCATTTAGATTTTGTTTTGGGGGGAGGTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGCCTGTTTGAAAATATATTTAGTATTTTTGTAACAAGCGGCAATAAATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA       in                    TTpA004l20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGTTAGTTTGGGGCCTAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAAATGTGAATTTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCACCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTTTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCCCAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGGGTAACCCTGGTGAAGAGCCCCAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCCCATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA070o03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAGTTGAGTTGCATATTACAGCTCCATATGGGGAGCAAGCAAAGCTACATCATGACTGCATCTTGCAAACTGCTCAAATGTGAATCTAATTTTATTCTGAATAGCTTCATTATAAGACTGTTACCAGCCTTAGTGTTATATGAGAAATGCATTTGTGCCCATTATTTTCAGTACTCTTATGTTTTGGGGTCAGCTGATGGAGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCAGGTGTTGGACAGACAAATTACAGTGTATGCACAGACCTTTCTTTTATTATTATTGATGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAATATATTTTTTTCCTCTTTTAGTTTTTGGGGTGTAACACTGGTGAAGAGCCACAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTGCAAAGCTAAACCACATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAANATAAACTTTGTTTTGCTTTAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG17074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTAGTGTTATATGAGAAAGGCATTTGTGCCCATTATTTTCGGTACTCTTATGTTTTGGGGTCAGCCGATGGGGGCCATGTAGACAGTTTTCTGTGGGTTTTAGCTAGACTATTGTCCCGGTGTTGGACGGACAAATTACAGTGTGTGCACAGACCTTTCTTTTATTATTATTGAGGGCACTGTTGACCCAGTAACAACGCAAGCTTGGGTAAAATATTTTTTTCCTCTTTTAGTTTTTGGGGGGTAACACTGGGGAAGAGCCCCAACATGTATATGGGATGCAGTGTTGAATTTGCAGTGGGCAGGGATTCCATATGGCGGCTTTCATTTAGATTCTGTTTTGGGGGGGGTTAGTTTAAGGTCAGGGGGCCCTTTTTGCAAAGCTAAACCCCATAGTCTGTGTAAATCAGTTTGTTTGAAAATATATTTTGTATTTTTGTAACATGCTGCAATAAATAAACTTTGTTTTCCTTTTAAAAAAAAAAAAAAAAAAAAAAAA
  3  -1   0       chi Lun1      in                          CABD849.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGTGGACACTGGTGAAGAGCCACAACATGTATATGGGAGGCAGTGTTGAATTTGCAGTGTGCAGTGATTCCATATGGCTGCTTTCATTTAGATTCTGTTTTGGGGGGAGTTAGTTTAAGGTCAGGGAGCACTTTTTTAAAGCAAAACAAAGTTTATTTATTGCAGCATGTTACAAAAATACAAAATATATTTTCAAACAAACTGATTTACACAGACTATGTGGTTTAGCTTTGCAAAAAGTGCACCCTGATCATGGAGTAACTCTCCCTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)