Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN2698.5                            2 END     1           2       50                enhancer of zeste homolog 1 [Homo sapiens]

 This cluster: approximate FL confidence score = 1%

 1012075308 Xt7.1-CABD12901.3 - 38 ESTs
                                                                       ......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD12901.3                                                                                                                                                                                                                                                                                                                                                                                                                                 TCAGGGTCGCAACATAAGCATGTCCAGGCACAGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAACAAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACACAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227033                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGCAACATAAGCATGTCCAGGCACAGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAACAAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACACAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                      2     3     3     4     5     7     6     7     7     7    10    10    10    10    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    14    13    14    14    15    15    16    15    16    15    16    14    16    13    16    13    16    13    17    12    17    11    17    11    17    10    17    11    17     8    15     8    14     9    15    10    14     8    13     9    13     9    11     7    10     7    10     7    10     7    10     7     9     6     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7    10     8    10     8     9     8     9     8     9     9    10    11    12    12    13    12    13    13    14    14    15    14    15    15    16    16    17    16    17    16    17    15    16    16    18    18    19    18    19    19    21    19    21    20    21    20    21    20    21    21    21    20    20    20    20    20    20    19    19    18    18    18    18    18    18    20    20    20    20    20    20    19    20    19    19    19    19    20    20    20    20    20    20    20    20    20    20    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    18    19    18    19    18    19    18    19    18    19    17    18    17    18    17    18    16    17    13    16    10    15     3     6     4     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                               BLH ATG      19       1                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Sc ---- 5e-056     NP_010921.1 NUclear GTPase; Nug1p [Saccharomyces cerevisiae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 4e-083     Q6P4W5 Guanine nucleotide-binding protein-like 3 (Nucleostemin-like protein) [Xenopus tropicalis]  =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 6e-094     NP_650593.1 CG3983-PB [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 3e-103     XP_414249.2 PREDICTED: similar to Guanine nucleotide binding protein-like 3 (nucleolar) [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-109     NP_495749.1 nucleostemin (62.3 kD) (2I572) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 2e-139     XP_783153.2 PREDICTED: similar to LOC496093 protein [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Mm ==== 5e-152     XP_983635.1 PREDICTED: similar to guanine nucleotide binding protein-like 3 (nucleolar)-like isoform 4 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Hs ==== 6e-154     NP_061940.1 hypothetical protein FLJ10613 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 0          NP_001002875.1 guanine nucleotide binding protein-like 3 (nucleolar)-like [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = ?? ==== 0          NP_001088820.1 hypothetical protein LOC496093 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 0          AAH87521.1 LOC496093 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD12901.3                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------TGA---------------------------------------------------------------------------------------------TAAATG---------------------TAATAA---TGA------------------------------------------------------TAA---------TGA---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Neu0 PIPE in                       IMAGE:6992745                                                                                                                                                                                                                                                                                                                                                            CATGTCCAGGCACAGTAAGTCTGTCCGTTCTTCTGGCCTTCTGCTATTTATCTGAATTCTAAACCCCCGGCCCTATTACCTCACGATCTATCTCTTCACAGGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGGTTGTAGGGTTTCCAAACGTGGGGAAAGAGCAGTTTTGATTAACAGTCTAAAGAGAACAAGGGGCCTGTAATGTG
  5   1   2   10  bld Ovi1 5g3  in                        CABI11228.5p ........................................................................................................................................................................................................................................................................................................................................................................................................CTCAGTCCTTGCTTTACGCCAGTTTCAGGGTCGCAACATAAGCATGTCCAGGCACAGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGC
  3  -1   2       bld Lun1      in                         CABD2156.3p                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAGGGTCGCAACATAAGCATGTCCAGGCACAGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTANAGAGAGCAAGGGGCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACT
  5   1   2       bld Tbd0      in                       IMAGE:6976787                                                                                                                                                                                                                                                                                                                                                                                                                                            ACATAAGCATGTCCAGGCACAGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGGNCAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTTCCAACGTGGGGAAAAGCAGTTTGGATTAACGTCTAAAGAGAGCAAAGGCCCTGTAATGTGGGGTGCCACACCCGGGCGTGGACCAAATGCCCTGCAGGAAGGTTCATTTGGAACAAA
  5   1   2   20  bld Eye  5g                              CCAX1920.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................ATAAGCATGTCCAGGCACAGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCT
  5   1   2       bld In63                            IMAGE:8957779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCCCCTGGCACATGGCACAACGCTGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGCAATTACTGTCGGAACAAGACATCAGACATCTATAGTGTGGGGTGTAGGGTTCAACGTGGGAGAGCAGTTGATACAGTCTAAGAGAGCAGCTGTATGTGGTGCCAACCCGGCTACATGCCTGCAGAGTCATGGACAACATCACTGCTAGACTGTCGGATTCGTCATGCATACCTCTTACGT
  5   1   2       bld Neu0 5g                            IMAGE:6995232                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATGTCCAGGCACAGGCACAAGCGGGCAGGAAAGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGGCGTGACCAAATGCCTGCAGGAAAGTCATTTGGACAAACACATCAAACTGCTAGACTGTCCCGGGTATCGTCATGGCTACCCTCTACGTCCGAATGCTGCTGGTCATCCT
  5   1   2       bld Int1      in                         CAAP1623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGC
  5   1   2       bld Limb      in                        CBSU2993.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTTAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCANGAAGTTCAT
  5   1   2       bld Lun1      in                        CABD12901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACGTACAAGGGCCAGGGTAAAGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGNGTGCCACACCCGGCGTGACCAAATGCCTGCANGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGNCACTGTGT
  5   1   2       bld Spl1      in                          CABK696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGATCTGTGCAGCATGGGAAGAATGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCA
  5   1   2       bld In63                            IMAGE:8958899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGGAATCGTCAAGAAAGACCCTGGAGTGCCCAACTTGTCCCACTTCAAAGAGCAGGCAAAGAGAGAGGCTGAGCAGAAGAAGAAAAGGGTGGAAGAGATGAGAGAAAAGCAGAAAGCTGCCAGACAGAAAGAAATGGCTAAGAGGAGGAGCCTGGGTACATTTCAGAACGATGTTTTGAAGCGCCAAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAGAGAGCAGGCCCTGTAATGTGGTGCCACACCCGGCGTGACCAAATGCCTGCAGAAGTTCATTTGGACAACACATCAACTGCTAGACTGTCCGGGTATCGTCATGGCTACTCTACGTCTTGATGCTGCTTGTCATTCTACGCACTGTGTGAGATCGAACAGCTGTAATTCTGTGGACCCGGGTGAAGCATATTGGAGACGGGGCCCACAGGAACAGAAATCAATG
  5   1   2       bld Int1      in                         CAAP8887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGGCCAAGGGAGTTTGAGCAAAAGGAGGCTGATCTTAGGAGTCTGGAGAAGCATGAGCAGCTGGAGAATGAGAATTCCAGGAAGGCTTACTACAGGGAGTTCAAAAAGGTGGTAGAAGCGGCAGATGTTATTTTAGAAGTGCTGGATGCCAGGGATCCTTTGGGCTGCCGATGTCCCCAAGTGGAGCAGGCTGTAGTACAGTCTGGCACAGAGAAGAAACTGGTGTTGGTTCTTAATAAAATAGATCTCGTCCCTAAACCTGTTGTGGAGAAGTGGTTGAAGTACCTCAGGAATGAGTTCCCTACAGTGGCCTTCAAAGCCTCCACTCAGCAGCAGAACAAGAATTTGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCAGGAAGTTCATTTGGACAAACACATCANACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAAACAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGC
  5   1   2       chi Tad5      in                          XZT6846.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATCAAGGCAAGGGTAACTTATACTCTTGCACAGTAATAGTTAGCTTTGGTCACTTCCTTGACACTCTTCCCTTGTATCGTATTACAGCAACAGAGCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAACAAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGT
  5   1   2       bld Bone      in                        CBTC5793.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGAGTGCCAGTCAAGCAGGCATCTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAACAAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTANAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAAGTCTCTGGGCTCACAGCTGGTGTCAGAGAAGAGGTGGAGCATGTTGAACTGGATGA
  5   1   2       bld Eye       in                         CCAX5881.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAGGATCTGCTGAGCTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAACAAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAG
  3  -1   2       bld Int1      in                         CAAP1507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCTGGAGCCTGCATTGGCGCTGATTCTCTAATGAAACTCCTGGGCAATTACTGTCGGAACAAGGACATCAAGACATCTATAAGTGTGGGGGTTGTAGGGTTTCCAAACGTGGGGAAGAGCAGTTTGATTAACAGTCTAAAGAGAGCAAGGGCCTGTAATGTGGGTGCCACACCCGGCGTGACCAAATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAACAAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCANAGCCCTAAAAAAGCAAGTCCAG
  5   1   2       bld Ova1      in                         CABE2095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCGGATCCATCGATTCGTTACCATTCTAGCCCCCATCCCCATGAAAATTTGCCANCTGGCTTCAAAAAGAAATCAACATAGGGAATTCATTAACATTAAATTACTTGCTTAGATGCCTGCAGGAAGTTCATTTGGACAAACACATCAAACTGCTAGACTGTCCGGGTATCGTCATGGCTACCTCTACGTCTGATGCTGCTGTCATCCTACGCAACTGTGTGAAGATCGAACAGCTTGTAGATCCTGTGGGCCCGGTGGAAGCCATATTGAGACGGTGCAACAAGGAACAGATCATTCAGCACTACAAAGTGAGCAATTTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAG
  3   1   2       chi Tbd0      in                       IMAGE:6976787                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGTGTTGGGAGAGAGCCACAAAAATTTTTTTTTTCGCGGGGGAGGGATTTATCCCCCGCCTTCGGGGGGAAGGTTTTTTTCACCTGGGGGGCCCCCAATTGGGCTTGGGGGGATTAAAAAAAATCGGGGGGCCCAGGGGGGGTTAAAAGCGGCTTGAAAAAAAGAAAAAAAGGGATTGGGGCCCAATCAACCCCGGGGAATTCCAATTGAAGGAAAAGGGGGCTTGGCCACAAAAGTTCCTGGTTTTCCTTTAACCAGGGAATTTGGGGGTTGGAGTTTGGTTAAAAGAAATCCAAGGTTTAACTTTTTCAACCCCCATTTCCCCCCCCAAGGAGGAAACGCCACCAACCAATTGGCCTTAAACAACCACGGTACAGGTGGCGGGGAGAATTTGTCCACCAGAAAATTGGGGGAAGGGCAATTTGAATTTTGAGGGCCCCTGGAAGATGGACCAACCATGAGTTCTTTATTAAAGGTCCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTAAAGCCCACGTGGCGGCCGGTGGGGTGGTGTCGGACGTGGGTCGGGGCGCGGCGGGCGGGGTGTGCGGTGCGGCGCGGTGTGTGCTGCGGGTGGTGTGGTGGTCGGGGTGTGCGGTGTG
  5  -1   2       bld Int1      in                         CAAP1507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATCATTCAGCACTACAAAGTGAGCAATNTTCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTT
  3   1   2       bld Neu0 PIPE in                       IMAGE:6992745                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTTCAGCACTTACAAAGTGAGGCAATTTTCGAGATACACGGGAGTTCCTGGCCCATGCTGGTTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTGCTTCATAGT
  3   1   2       bld Lun1      in                        CABD12901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAGCATTTTCCGAGATACACTGGAGTTCCTGGCCATGCTGGCTAAACGGCAGGGTAAGCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCCATTAA
  3   1   2       bld Int1      in                         CAAP1623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTGAAGAAAGGTGGCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCNCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTAA
  5  -1   2      seed Lun1      in                         CABD2156.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGT
  3   1   2       bld Tad5      in                          XZT6846.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACACCGGATCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTAAAGCCCATAAAGAGATACTGTC
  3   1   2       bld Spl1      in                          CABK696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATGAGAAGGCTGCCAAGTCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGATCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACAC
  3   1   2       bld Limb      in                        CBSU2993.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGTTCTTACAGATTGGGTGAGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCCATTAAAGAGATACTGTCAACAC
  3   1   2       bld Int1      in                         CAAP8887.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTGGTAAGATCAGTTACTTCACCCATCCCCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATAAAGCCTCTCGCCCATAGTGAGTC
  3   1   2       bld Bone      in                        CBTC5793.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCATCCNCCAGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAAGTCTCTGGGCTCACAGCTGGTGTCAGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACAC
  3   1   2       bld Te4  5x3  out                        CAAN2698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGACGCACACCATGCCTACACACGTCAGTGCGGAGATTGTCACAGAAATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACCC
  3   1   2       bld Eye       in                         CCAX5881.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGGGGAAGGCATTTGATTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTTTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACAC
  5   1   2       bld Te1       in                        CBWN10179.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGACGCGTGGAGTTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAAGTCTCTGGGCTCACAGCTGGTGTCAGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACACAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                        CBWN10179.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTGAGGCCCTGGAGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAAGTCTCTGGGCTCACAGCTGGTGTCAGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCTTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACTTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACACAAAAAAAAAAAAAAA
  3   1   2       bld Tad5                                 XZT52693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGATGGACAACCATGAGTCTTTATTAAAGGTCCAGTCTATCCCAGAGGGCATTGTTATGGAGGTCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCACCCC
  3   1   2       bld Tbd1      out                         CBXT712.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAAAACACAGCAGTTCTTGTCTCAAAATAAACATTGGTGGGTTGCAAAAAAAAAAAAAAAGCTCTGGGCTCACAGCTGGTGTCGGAGAAGAGGTGGAGCATGTTGAACTGGATGAGTTAAGTGATGAGGATGAGAAACCCACAGATTCCATGGAACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGAAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACACAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA061i19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTTTATTCACCCATTGCAGCAAGGACAGGCCCTGTTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCTTAAATGCTGGGACTGTGCTGGGTCACTATAATAATGCGGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTTTTGGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACGGTCAACACAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Ova1      in                         CABE2095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGACATAGATACAGAGTTTGGTCCCATGACTGTGGAAATCAAAGCCCTAAAAAGCAAAGTCCAGCTTGAACCAGAACAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCCTGCTCGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAAACTGTCAGATTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGACTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCACTATAATAATGCTGAGTAGCCACTTATGCAACAAAACAGGAGCAGCAACCCTCACTGTTTTCTTCGACCTAAACTGTTTATTGAGTTGCTTCTCTGGGTTTTAAAGCCCATTAAAGAGATACTGTCAACAC
  3   1   2       bld Ovi1 5g3  in                        CABI11228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAAGTAGTTCCCAAAGCCCCGAACTTGCAGGAGATTCAGTCTATTCACCCATTGCAGCAAGGACAGGCCTTGCTTGCCGCCAGCAAGAAGAGGAAAAAGTTGCAGAAGCGAGCGAACAAAATTGCCACAAATCTGTCAGTTTCGCTTACGCTAGCAATGAATTTTGGACTGAGCGATGTCTGAGAGGGAAAATGGACTTTTATAAAGCCCATCGTTGACCATAAGGGTGCATCATCCTTGCAGCCCCGCCGGTACACAGGACCCTTGTCATTATCCTAAATGCTGGACTGTGCTGGGTCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)