Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK9620.3                            3 END     3          13      100                PREDICTED: similar to CD2-associated protein (Mesenchym-to-epithelium transition protein with SH3 domains 1) (METS-1) [Danio rerio]

 This cluster: approximate FL confidence score = 0%

 1012075638 Xt7.1-CABJ10059.3 - 22 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABJ10059.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAACCAAAGACTGACCTTTCTCCTAAAGTGACTAATCAACCAGGAAAAAAGGCAGCTCCTCCCCCTCCAGTGCCAAAATCGGCCAAACATAATACTGGTCCTCTCAACAAGCCCAGCACTGAAGCAGGAGAAGATGTGAACCATAGTTCTAAGGAGTCAAATACTTTAGATGGACTCAGGGTGTCCTCCATGAAGCTAGCACATCCTACTGCAGACAGACCAAAGATGATGGGCAAAAGACTACCTAAGGGGAAGGTGACATCTCCTGAAAAGCCTATATCTGAATCAGATGATAAAAAGAATGAAGAACAGGTGAATTCTCACAGCAAAGTATCCTCAGCCCCAAAGGATCCAAGGATACCCACCACCCCAAGCCCATCACCCTCACCAACTAAGACAAGCCCACTGTCTCCTTTAGCCACTTCAACAGTGAAGCAAAGCCAGAAGACTGCTGATAATCATGCTTCTTCCGTGCAGAGTTTACAAGAAGATCTTGCAGCAGAGATCGCATCAATCAAATTCATGATGGAACTCTTGAGAAACAAACATACAAAAGATATGGAAGATATCAGATCTGAGTTAAATGAAGAGAGAACCAAACGCCTAGCACTCCAGATGGAGGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCATAAAAAAAAA
                                                  Xt7.1-CHK-1008229914                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGACTGACCTTTCTCCTAAAGTGACTAATCAACCAGGAAAAAAGGCAGCTCCTCCCCCTCCAGTGCCAAAATCGGCCAAACATAATACTGGTCCTCTCAACAAGCCCAGCACTGAAGCAGGAGAAGATGTGAACCATAGTTCTAAGGAGTCAAATACTTTAGATGGACTCAGGGTGTCCTCCATGAAGCTAGCACATCCTACTGCAGACAGACCAAAGATGATGGGCAAAAGACTACCTAAGGGGAAGGTGACATCTCCTGAAAAGCCTATATCTGAATCAGATGATAAAAAGAATGAAGAACAGGTGAATTCTCACAGCAAAGTATCCTCAGCCCCAAAGGATCCAAGGATACCCACCACCCCAAGCCCATCACCCTCACCAACTAAGACAAGCCCACTGTCTCCTTTAGCCACTTCAACAGTGAAGCAAAGCCAGAAGACTGCTGATAATCATGCTTCTTCCGTGCAGAGTTTACAAGAAGATCTTGCAGCAGAGATCGCATCAATCAAATTCATGATGGAACTCTTGAGAAACAAACATACAAAAGATATGGAAGATATCAGATCTGAGTTAAATGAAGAGAGAACCAAACGCCTAGCACTCCAGATGGAGGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCATAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     9    10    10    10    12    12    13    13    14    14    14    14    16    16    16    16    17    17    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    16    18    17    18    17    18    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    16    17    15    17    14    15    14    15    14    15    13    14    13    14    13    14    13    14    13    14    12    13    12    13    12    13    12    13     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----T-------
                                                                       ...PROTEIN --- Gg ---- 8e-011     NP_001025976.1 SH3-domain kinase binding protein 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-013     NP_067364.2 SH3-domain kinase binding protein 1; Sh3 containing, expressed in astrocytes[Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                 PREDICTED - Dr ---- 2e-014     XP_699004.1 PREDICTED: similar to CD2-associated protein (Mesenchym-to-epithelium transition protein with SH3 domains 1) (METS-1) [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-016     NP_036252.1 CD2-associated protein [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-017     AAH97671.1 LOC445851 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 2e-017     NP_001086432.1 hypothetical protein LOC445851 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABJ10059.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------ATG------------------------------------------------------ATG---------------------------------TAG---------------------------------------------------TAA---------TAA---------------------------------------------TAA---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------TAA---------------------ATG---------TAG---------------------TAG---------TAA------------------------------------------------TGA------ATG------------------------------------------ATG---------------------------TGA---ATG------------------------TGATAG---------------------------------------------------ATG---------TAG---ATG---TAA---------------ATG------------------------------------------TGA---------------------------------------------------------------------TAG---------------------TAA------------ATG------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       bld Hrt1      in                         CAAQ3832.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCATCGATTCAATCGGCACGAGGCTTTTCCCCAGAGATTCCTTTCTTCTTGAATGGTATTTAAAAGATCTCCCAGATGGATTTTTGATTGCTACATATCAGAATAACTGTTTTCCTCCAGTAGCTAAAACAGATGCTCAAAAAAGACCCTGTAAAAGCATGACTAAATCAGACCTTAATATTATGGATAAAAAGCCCCATGAAGTCAAGAAGCCAGCTGCAGAAGTCAACAAGCATGAACACACAACAACCAAGAAAGGGCAACGTGAACCAAAGACTGACCTTTCTCCTAAAGTGACTAATCAACCAGGAAAAAAGGCAGCTCCTCCCCCTCCAGTGCCAAAATCGGCCAAACATAATACTGGTCCTCTCAACAAGCCCAGCACTGAAGCAGGAGAAGATGTGAACCATAGTTCTAAGGAGTCAAATGGCTGTATTTGGTCTCCTCATACAGATACTTTAGATGGACTCAGGGTGTCCTCCATGAAGCTAGCACATCCTACTGCAGACAGACCAAAGATGATGGGCAAAAGACTACCTAAGGGGAAGGTGACATCTCCTGAAAAGCCTATATCTGAATCAGATGATAAAAAGAATGAAGAACAGGTGAATTCTCACAGCAAAGTATCCTCAGCCCCAAAGGATCCAAGGATACCCACCACCCCAAGCCCATCACCCTCACCAACTAAGACAAGCCCACTGTCTCCTTTAGCCACTTCAACAGTGAAGCANAGCCAGAAGACTACTGATAATCATGCTTCTTCCGTGCAGAGTTTACAAGAAGATCTTGCAGCAGAGATCGCATNCATCANATTCATGATGGAACTCTTGAGAAACAAACATACAAAAGATATGGAAGATATCAGATCTGAGTTAAATGAAGAGAGAACCAAACGCCTAGCAC
  5   1   2       bld Gas7      in                         XZG22920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGAAGCCAGCTGCAGAAGTCAACAAGCATGAACACACAACAACCAAGAAAGGGCAACGTGAACCAAAGACTGACCTTTCTCCTAAAGTGACTAATCAACCAGGAAAAAAGGCAGCTCCTCCCCCTCCAGTGCCAAAATCGGCCAAACATAATACTGGTCCTCTCAACAAGCCCAGCACTGAAGCAGGAGAAGATGTGAACCATAGTTCTAAGGAGTCAAATACTTTAGATGGACTCAGGGTGTCCTCCATGAAGCTAGCACATCCTACTGCAGACAGACCAAAGATGATGGGCAAAAGACTACCTAAGGGGAAGGTGACATCTCCTGAAAAGCCTATATCTGAATCAGATGATAAAAAGAATGAAGAACAGGTGAATTCTCACAGCAAAGTATCCTCAGCCCCAAAGGATCCAAGGATACCCACCACCCCAAGCCCATCACCCTCACCAACTAAGACAAGCCCACTGTCTCCTTTAGCCACTTCAACAGTGAAGCAAAGCCAGAAGACTGCTGATAATCATGCTTCTTCCGTGCAGAGTTTACAAGAAGATCTTGCAGCAGAGATCGCATCAATCAAATTCATGATGGAACTCTTGAGAAACAAACATACAAAAGATATGGAAGATATCAGATCTGAGTTAAATGAAGAGAGAACCAAACGCCTAGCACTCCAGATGGAGGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGAT
  5   1   2       bld Bone                                CBTC1940.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAACGTGAACCAAAGACTGACCTTTCTCCTAAAGTGACTAATCAACCAGGAAAAAAGGCAGCTCCTCCCCCTCCAGTGCCAAAATCGGCCAAACATAATACTGGTCCTCTCAACAAGCCCAGCACTGAAGCAGGAGAAGATGTGAACCATAGTTCTAAGGAGTCAAATACTTTAGATGGACTCAGGGTGTCCTCCATGAAGCTGGCACATCCTACTGCAGACAGACCAAAGATGATGGGCAAAAGACTACCTAAGGGGAAGGTGACATCTCCTGAAAAGCCTATATCTGAATCAGATGATAAAAAGAATGAAGAACAGGTGAATTCTCACAGCAAAGTATCCCCAGCCCCAAAGGATCCAAGGATACCCACCACCCCAAGCCCATCACCCTCACCAACTAAGACAAGCCCACTGTCTCCTTTAGCCACTTCAACAGTGAAGCAAAGCCAGAAGACTGCTGATAATCATGCTTCTTCCGTGCAGAGTTTACAAGAAGATCTTGCAGCAGAGATCGCATCAATCAAATTCATGATGGAACTCTTGAGAAACAAACATACAAAAGATATGGAAGATATCAGATCTGAGTTAAATGAAGAGAGAACCAAACGCCTAGCACTCCAGATGGAGGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCATTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGCTGTGTAGCAACACTGAAGAGTCTTTTACCC
  5   1   2       bld Thy1      in                       CBST12395.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTAAGGGGAAGGTGACATCTCCTGAAAAGCCTATATCTGAATCAGATGATAAAAAGAATGAAGAACAGGTGAATTCTCACAGCAAAGTATCCTCAGCCCCAAAGGATCCAAGGATACCCACCACCCCAAGCCCATCACCCTCACCAACTAAGACAAGCCCACTGTCTCCTTTAGCCACTTCAACAGTGAAGCAAAGCCAGAAGACTGCTGATAATCATGCTTCTTCCGTGCAGAGTTTACAAGAAGATCTTGCAGCAGAGATCGCATCAATCAAATTCATGATGGAACTCTTGAGAAACAAACATACAAAAGATATGGAAGATATCAGATCTGAGTTAAATGAAGAGAGAACCAAACGCCTAGCACTCCAGATGGAGGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCC
  5   1   2       bld Gas7      in                         XZG44519.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTAAATGAAGAGAGAACCAAACGCCTAGCACTCCAGATGGAGGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTAAATATTTATATACATG
  5   1   2       bld Sto1      in                        CABG10304.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACCAAACGCCTAGCACTCCAGATGGAGGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGG
  5   1   2       bld Neu                            TNeu020k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGTTGAGCACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGGTCCTGACCCTAAAGCCACAAGCATAATGTACTGTGTCT
  5   1   2       bld Ovi1      in                         CABI4078.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTGAAGAATCTGTCTTCAGCGTAGGTCATTGCGAGTTCTAAAACTGCCCTGCTCCTTGAGCAAATAGAACTTGTGTAACTGGTCCAGTAATTAAAAGGATACAGATTTGGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATATTGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCANAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATAT
  3   1   2       bld Ski1      ?                         CABJ10059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAAGAAGCCTAATCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTNTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCATAAAAAAAAA
  3   1   2       bld Int1 PIPE out                        CAAP9961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGCCTAATCCCCGCTGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATATTGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTCCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTC
  3   1   2       bld Int1      ?                          CAAP2418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGCCTAATCCCGCTGGTGACTTTATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTC
  5  -1   2       bld Spl1      out                        CABK9620.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGCCTAATCCCGCTGGTGACTTATTTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT
  5   1   2       bld Sto1      in                        CABG10581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTGACTTAATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCATAAAAAAAAAAAAAAAAAA
  3   1   2      seed Sto1      in                        CABG10304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT
  3   1   2       bld Ovi1      in                         CABI4078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGACACTACCCAGTTTTACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATATTGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAC
  3   1   2       bld Sto1      in                        CABG10581.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACTGAGATTTTACTCATGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT
  3   1   2       bld Thy1      in                       CBST12395.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTGTGTAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT
  3   1   2       bld Gas7      in                         XZG44519.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCAACACTGAAGAGTCTTTTACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT
  3   1   2       bld Hrt1      in                         CAAQ3832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATATTGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT
  3   1   2       bld Gas7      out                        XZG29880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCAATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTAGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATTGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGTGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCAAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT
  3   1   2       bld Gas8 5g3  out                          st8i08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGTCTGCCTCTCTCTGGATTTTTTTGTTTTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATAATGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTT
  3   1   2       bld Gas7      in                         XZG22920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTCATAAGCCTACTTATATTCATTTTCTAACTGCTTTGGCATCTTTTGCACATATGTATGATCAGAGGTAATTTGGTGGAACATATATAATCATGTCATTCCAATAGCAGAGGCAGTTGTTGAAACGATAGTTGGGACAATAATGGGGTCCATACAAGTGTGCCATTCCTACTTTGTTATTTTGCATCTCTTGAATTAACATGGTAAAATCCATTTATAAACACTGCCTGATCGCATGTACATTTATGCTGTCACTGTCAGGATTGCACACACATTGAACGATGGGCCTTCAAAAGGTCTCACAAAACTGATAGATAGATGCTCTGACATCTATCAAGGTCCTGAACCCTAAAGCCACAAGCATATTGTACTGTGTCTAGCCTATGTCCTAAGGACATTATTTGCCAATGTTTGTAACCAGCATAGATATCAACCTGATAAACTCTGCATCTTGAATAATATATAGAACTGTATGTACCAGCACTGCCTTCTATGCAGAGCTCACAGCAAAGTTAAGTTATAATTAGAAAAAGTTGCATATATTTTCTTAAATATTTATATACATGGGACCAATTCAGTGCCAAACCTCTTCTAGCATTGAAATGACATATGGGAAGTCATATTTTTTAATCAGGGTGGGTTATCATTTAATAGCTGTCTTTTTTCTATATAATTTGTGCAATGTTTTTAATAAATATGCATATTTATTCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)