Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC1056.3                            9 END     1           2       11                FK506 binding protein 12-rapamycin associated protein 1; FK506 binding protein12-rapamycin associated protein 2; rapamycin target protein; FKBP12-rapamycincomplex-associated protein 1; FKBP-rapamycin associated protein [Homo sapiens]
     2   2.0    0Xt7.1-CAAM14187.3                           4 END     1           2       25                (no blast hit)
     3   2.0    0Xt7.1-CAAJ14580.5                           2 END     1           2       50                FK506 binding protein 12-rapamycin associated protein 1; FK506 binding protein12-rapamycin associated protein 2; rapamycin target protein; FKBP12-rapamycincomplex-associated protein 1; FKBP-rapamycin associated protein [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012076116 Xt7.1-TTpA049m02.3 - 37 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA049m02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGGAAGGAATCAAAACTATTCAGATAGATACATGGTTACAGGTGATTCCACAGCTTATTGCAAGGATAGACACGCCAAGGGCTCTTGTAGGCCGTCTTATTCATCAGCTTCTCACAGATATTGGCAGATACCATCCACAGGCTTTAATTTACCCACTCACAGTGGCCTCTAAATCAACAACCACCGCTCGCCACAATGCAGCCAATAAAATTCTAAAGAACATGTGTGAACATAGCAACACGTTAGTGCAGCAAGCCATGATGGTAAGTGAAGAGCTTATTCGTGTGGCTATTCTTTGGCATGAGATGTGGCATGAAGGCCTAGAAGAAGCATCACGCTTATATTTTGGCGAAAGGAATGTGAAAGGGATGTTTGCTGTACTTGATCCACTGCATGCCATGATGGAGAGGGGACCTCAGACTCTTAAGGAAACCTCTTTTAATCAGGCATATGGTAGAGACCTTATGGAAGCTCAGGACTGGTGTAGAAAGTACATGAAATCTGGAAATGTAAAGGATCTCACACAGGCCTGGGACCTATATTACCATGTTTTCCGAAGAATCTCAAAGCAGCTGCCTCAGCTCACTTCTTTGGAACTTCAGTATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTCGAAAATTAACCTTAATGGGTAGCAATGGGCATGAATTTATGTTCCTGTTAAAGGGGCATGAGGATTTGCGTCAAGATGAGAGGGTAATGCAGCTCTTTGGGTTGGTGAACACATTGCTGGCCAATGACCCGGCATCTTTACGTAAAAACTTGAGTATCCAGCGATATGCTGTAATCCCCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCACATTGTGACACACTTCATGCATTAATTCGAGACTATCGTGAAAAAAAGAAAATTTTGCTGAATATTGAGCATCGAATTATGTTAAGGATGGCTCCAGATTACGATCACCTAACGTTAATGCAAAAAGTGGAGGTTTTTGAGCATGCTGTGAACAATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCCAGCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGTGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGATGTTGGATCGACTCAGTGGGAAAATCCTACATATAGACTTTGGGGATTGTTTTGAGGTGGCCATGACAAGAGAGAAGTTCCCAGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGCTATGGAGGTGACAGGACTTGATGGAAATTACAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227191                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGAATCAAAACTATTCAGATAGATACATGGTTACAGGTGATTCCACAGCTTATTGCAAGGATAGACACGCCAAGGGCTCTTGTAGGCCGTCTTATTCATCAGCTTCTCACAGATATTGGCAGATACCATCCACAGGCTTTAATTTACCCACTCACAGTGGCCTCTAAATCAACAACCACCGCTCGCCACAATGCAGCCAATAAAATTCTAAAGAACATGTGTGAACATAGCAACACGTTAGTGCAGCAAGCCATGATGGTAAGTGAAGAGCTTATTCGTGTGGCTATTCTTTGGCATGAGATGTGGCATGAAGGCCTAGAAGAAGCATCACGCTTATATTTTGGCGAAAGGAATGTGAAAGGGATGTTTGCTGTACTTGATCCACTGCATGCCATGATGGAGAGGGGACCTCAGACTCTTAAGGAAACCTCTTTTAATCAGGCATATGGTAGAGACCTTATGGAAGCTCAGGACTGGTGTAGAAAGTACATGAAATCTGGAAATGTAAAGGATCTCACACAGGCCTGGGACCTATATTACCATGTTTTCCGAAGAATCTCAAAGCAGCTGCCTCAGCTCACTTCTTTGGAACTTCAGTATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTCGAAAATTAACCTTAATGGGTAGCAATGGGCATGAATTTATGTTCCTGTTAAAGGGGCATGAGGATTTGCGTCAAGATGAGAGGGTAATGCAGCTCTTTGGGTTGGTGAACACATTGCTGGCCAATGACCCGGCATCTTTACGTAAAAACTTGAGTATCCAGCGATATGCTGTAATCCCCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCACATTGTGACACACTTCATGCATTAATTCGAGACTATCGTGAAAAAAAGAAAATTTTGCTGAATATTGAGCATCGAATTATGTTAAGGATGGCTCCAGATTACGATCACCTAACGTTAATGCAAAAAGTGGAGGTTTTTGAGCATGCTGTGAACAATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCCAGCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGTGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGATGTTGGATCGACTCAGTGGGAAAATCCTACATATAGACTTTGGGGATTGTTTTGAGGTGGCCATGACAAGAGAGAAGTTCCCAGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGCTATGGAGGTGACAGGACTTGATGGAAATTACAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     6     5     5     5     5     6     6     6     6     5     6     5     6     4     5     5     6     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     9     7     9     7     9     8    10     8    10     8    10     9     9     9     9     9     9     8     8     9     9    10    10    10    11    12    12    11    12    12    12    12    12    13    13    14    14    13    14    14    14    15    15    16    16    16    17    16    17    18    20    20    20    20    20    20    20    20    20    22    22    22    22    22    22    22    22    22    22    22    22    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    20    20    20    19    20    21    21    21    21    19    20    19    20    19    20    18    19    17    19    16    18    16    18    16    18    16    18    16    18    16    18    19    22    19    21    19    21    18    20    18    20    17    19    17    19    17    19    17    19    17    19    17    18    16    18    17    18    14    18    14    16    12    14    11    13    10    12     3     8     4     4     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                       ...PROTEIN --- Xl ---- 7e-051     Q9DE14 Serine/threonine-protein kinase atr (Ataxia telangiectasia and Rad3-related protein) (Xatr) [Xenopus laevis]  ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-090     XP_001201767.1 PREDICTED: similar to rapamycin associated protein FRAP2, partial [Strongylocentrotus purpuratus] ------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 0          NP_491552.2 lethal protein 363, LEThal LET-363 (305.8 kD) (let-363) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 0          XP_701115.1 PREDICTED: similar to FKBP12-rapamycin complex-associated protein (FK506-binding protein 12-rapamycin complex-associated protein 1) (Rapamycin target protein) (RAPT1) (Mammalian target of rapamycin) (MTOR) [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 0          NP_012719.2 Tor2p [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...REMOVED --- Dm ---- 0          NP_524891.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_417614.2 PREDICTED: similar to FKBP-rapamycin associated protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_064393.1 FK506 binding protein 12-rapamycin associated protein 1;FKBP-rapamycin-associated protein; FKBP-rapamycin-associated protein FRAP [Musmusculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 0          NP_001070679.2 FK506 binding protein 12-rapamycin associated protein 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004949.1 FK506 binding protein 12-rapamycin associated protein 1; FK506 binding protein12-rapamycin associated protein 2; rapamycin target protein; FKBP12-rapamycincomplex-associated protein 1; FKBP-rapamycin associated protein [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA049m02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------ATGATG------------------------------------------ATG------------------------------------------------------------ATG---------------------------ATGATG------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------ATG------------ATG------------------------------------------------ATG------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TGA---------------------------------------------------------------TGA---------TAA---ATG---------------TGAATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---TAA---------------------------------------------------TAATAA------------------TAG---------------------------ATG------------------ATG------------------TAA------------------------------ATG---------------------------------TGA---------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  3  -1   2       bld Lun1      in                         CABD3029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAATACCTTCGGACACACTGAGAGTCCTTACGCTGTGGTTTGATTATGGGCACTGGCCAGATGTAAATGAGGCACTAGTGGAAGGAATCAAAACTATTCAGATAGATACATGGTTACAGGTGATTCCACAGCTTATTGCAAGGATAGACACGCCAAGGGCTCTTGTAGGCCGTCTTATTCATCAGCTTCTCACAGATATTGGCAGATACCATCCACAGGCTTTAATTTACCCACTCACAGTGGCCTCTAAATCAACAACCACCGCTCGCCACAATGCAGCCAATAAAATTCTAAAGAACATGTGTGAACATAGCAACACGTTAGTGCAGCAAGCCATGATGGTAAGTGAAGAGCTTATTCGTGTGGCTATTCTTTGGCATGAGATGTGGCATGAAGGCCTAGAAGAAGCATCACGCTTATATTTTGGCGAAAGGAATGTGAAAGGGATGTTTGCTGTACTTGATCCACTGCATGCCATGATGGAGAGGGGACCTCAGACTCTTAAGGAAACCTCTTTTAATCAGGCATATGGTAGAGACCTTATGGAAGCTCAGGACTGGTGTAGAAAGTACATGAAATCTGGAAATGTAAAGGATCTCACACAGGCCTGGGACCTATATTACCATGTTTTCCGAAGAATCTCAAAGCAGCTGCCTCAGCTCACTTCTTTGGAACTTCAGTATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTC
  5   1   2       bld Gas7                                  XZG8841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAATGAGGCACTAGTGGAAGGAATCAAAACTATTCAGATAGATACATGGTTACAGGTGATTCCACAGCTTATTGCAAGGATAGACACGCCAAGGGCTCTTGTAGGCCGTCTTATTCATCAGCTTCTCACAGATATTGGCAGATACCATCCACAGGCTTTAATTTACCCACTCACAGTGGCCTCTAAATCAACAACCACCGCTCGCCACAATGCAGCAAATAAAATTCTAAAGAACATGTGTGAACATAGCAACACGTTAGTGCAGCAAGCCATGATGGTAAGTGAAGAGCTTATTCGTGTGGCTATTCTTTGGCATGAGATGTGGCATGAAGGCCTAGAAGAAGCATCACGCTTATATTTTGGCGAAAGGAATGTGAAAGGGATGTTTGCTGTACTTGATCCACTGCATGCCATGATGGAGAGGGGACCTCAGACTCTTAAGGAAACCTCTTTTAATCAGGCATATGGTAGAGACCTTATGGAAGCTCAGGACTGGTGTAGAAAGTACATGAAATCTGGAAATGTAAAGGATCTCACACAGGCCTGGGACCTATATTACCATGTTTTCCGAAGAATCTCAAAGCAGCTGCCTCAGCTCACTTCTTTGGAACTTCAGTATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTCGAAAATTAACCTTAATGNGTAGCAATGGGCATGAATTTATGT
  3   1   2       bld Brn2      out                       CAAJ14580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCCACAGGCTTTAATTTACCCACTCACAGTGGCCTCTAAATCAACAACCANCGCTCGCCACAATGCAGCCAATAAAATTCTAAAGAACATGTGTGAACATAGCAACACGTTAGTGCAGCAAGCCATGATGGTAAGTGAAGAGCTTATTCGTGTGGCTATTCTTTGGCATGAGATGTGGCATGAAGGCCTAGAAGAAGCATCACGCTTATATTTTGGCGAAAGGAATGTGAAAGGGATGTTTGCTGTACTTGATCCACTGCATGCCATGATGGAGAGGGGACCTCAGACTCTTAAGGAAACCTCTTTTAATCAGGCATATGGTAGAGACCTTATGGAAGCTCAGGACTGGTGTAGAAAGTACATGAAATCTGGAAATGTAAAGGATCTCACACAGGCCTGGGACCTATATTACCATGTTTTCCGAAGAATCTCAAAGCAGCTGCCTCAGCTCACTTCTTTGGAACTTCAGTATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTCGAAAATTAACCTTAATGGGTAGCAATGGGCATGAATTTATGTTCCTGTTAAAGGGGCATGAGGATTTGCGTCAAGATGAGAGGGTAATGCAGCTCTTTGGGTTGGTGAACACATTGCTGGCCAATGACCCGGCATCTTTACGTAAAAACTTGAGTATCCAGCGATATGCTGTAATCCCCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCGCATTGTGACACACTTCATGCATTAATTCGAGACTATCGTG
  3   1   2       bld Brn2      out                       CAAJ20494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACAGTGGCTCTAAATCAACAACCACCGCTCGCCACAATGCAGCAAATAAAATTCTAAAGAACATGTGTGAACATAGCAACACGTTAGTGCAGCAAGCCATGATGGTAAGTGAAGAGCTAATTCGTGTGGCTATTCTTTGGCATGAGATGTGGCATGAAGGCCTAGAAGAAGCATCACGCTTATATTTTGGCGAAAGGAATGTGAAAGGGATGTTTGCTGTACTTGATCCACTGCATGCCATGATGGAGAGGGGACCTCAGACTCTTAAGGAAACCTCTTTTAATCAGGCATATGGTAGAGACCTTATGGAAGCTCAGGACTGGTGTAGAAAGTACATGAAATCTGGAAATGTAAAGGATCTCACACAGGCCTGGGACCTATATTACCATGTTTTCCGAAGAATCTCAAAGCAGCTGCCTCAGCTCACTTCTTTGGAACTTCAGTATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTCGAAAATTAACCTTAATGGGTAGCAATGGGCATGAATTTATGTTCCTGTTAAAGGGGCATGAGGATTTGCGTCAAGATGAGAGGGTAATGCAGCTCTTTGGGTTGGTGAACACATTGCTGGCCAATGACCCGGCATCTTTACGTAAAAACTTGAGTATCCAGCGATATGCTGTAATCCCCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCACATTGTGACACACTTCATGCATTAATTCGAGACTATCGTG
  5   1   2       bld Gas7                                  XZG7244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCTCACTTCTTTGGACTTCAGTATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTCGAAAATTAACCTTAATGGGTAGCAATGGGCATGAATTTATGTTCCTGTTAAAGGGGCATGAGGATTTGCGTCAAGATGAGAGGGTAATGCAGCTCTTTGGGTTGGTGAACACATTGCTGGCCAATGACCCGGCATCTTTACGTAAAAACTTGAGTATCCAGCGATATGCTGTAATCCCCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCACATTGTGACACACTTCATGCATTAATTCGAGACTATCGTGAAAAAAAGAAAATTTTGCTGAATATTGAGCATCGAATTATGTTAAGGATGGCTCCAGATTACGATCACCTAACGTTAATGCAAAAAGTGGAGGTTTTCGAGCATGCTGTGAACAATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCTAGCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGTGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGATGTTGGATCGACTCAGTGNGAAAATCCTACATATAGACTTTGGGGATTGTTTTGAGGTGGCCATGACAAGAGAGAAAGTCCCAGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGCTATGGAGGTGACAGGACTTGAT
  5   1   2       bld Ova1      in                         CABE4551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGTATCCCCAAAATTACTTATGTGTCGAGATCTGGAGTTAGCTGTGCCAGGAACATATGACCCAAATCAACCAATCATACGTATTCAGTCTATTGCACCATCTCTTCAGGTCATAACCTCCAAACAGAGGCCTCGAAAATTAACCTTAATGGGTAGCAATGGGCATGAATTTATGTTCCTGTTAAAGGGGCATGAGGATTTGCGTCAAGATGAGAGGGTAATGCAGCTCTTTGGGTTGGTGAACACATTGCTGGCCAATGACCCGGCATCTTTACGTAAAAACTTGAGTATCCAGCGATATGCTGTAATCCCCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCACATTGTGACACACTTCATGCATTAATTCGAGACTATCGTGAAAAAAAGAAAATTTTGCTGAATATTGAGCATCGAATTATGTTAAGGATGGCTCCAGATTACGATCACCTAACGTTAATGCAAAAAGTGGAGGTTTTTGAGCATGCTGTGAACAATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCCAGCCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGCGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGAATGTGGATCGACTCACTGGGAAAATCCTACA
  5   1   2       bld HdA                            THdA052j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATAACCTCCAACAGAGGCCTCGAAAATTAACCTTAATGGGTAGCAATGGGCATGAATTTATGTTCCTGTTAAAGGGGCATGAGGATTTGCGTCAAGATGAGAGGGTAATGCAGCTCTTTGGGTTGGTGAACACATTGCTGGCCAATGACCCGGCATCTTTACGTAAAAACTTGAGTATCCAGCGATATGCTGTAATCCCCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCACATTGTGACACACTTCATGCATTAATTCGAGACTATCGTGAAAAAAAGAAAATTTTGCTGAATATTGAGCATCGAATTATGTTAAGGATGGCTCCAGATTACGATCACCTAACGTTAATGCAAAAAGTGGAGGTTTTTGAGCATGCTGTGAACAATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCCAGCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGTGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGATGTTGGATCGACTCAGTGGGAAAATCCTACATATAGACTTTGGGGATTGTTTTGAGGTGGCCATGACAAGAGAGAAGTTCCCAGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGGCTATGGAGGTGACAGGACTTGATGGAAATTACAGAATAACATGCCATACAGTGATGGAGGGTATTAAGGGAGCATNAAGACAGTGTCATGGCTGTGCTAGAGGCTTTGGTATATGATCCTCTACNTAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCT
  5   1   2       bld Tad5      out                         XZT8888.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGCATCTTTCGTAAAACTTGAGTATCCAGCGATATGCTGTAATCCCNCTTGTCCACAAACTCAGGACTGATTGGATGGGTACCACATTGTGACACACTTCATGCATTAATTCGAGACTATCGTGAAAAAAAGAAAATTTTGCTGAATATTGAGCATCGAATTATGTTAAGGATGGCTCCAGATTACGATCACCTAACGTTAATGCAAAAAGTGGAGGTTTTTGAGCATGCTGTGAACAATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCCAGCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGTGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGATGTTGGATCGACTCAGTGGGAAAATCCTACATATAGACTTTGGGGATTGTTTTGAGGTGGCCATGACAAGAGAGAAGTTCCCAGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGCTATGGAGGTGACAGGACTTGATGGAAATTACAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACAT
  5   1   2       bld TpA                            TTpA013k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAGAAAATTTTGCTGAATATTGAGCATCGAATTATGTTAAGGATGGCTCCAGATTACGATCACCTAACGTTAATGCAAAAAGTGGAGGTTTTTGAGCATGCTGTGAACAATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCCAGCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGTGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGATGTTGGATCGACTCAGTGGGAAAATCCTACATATAGACTTTGGGGATTGTTTTGAGGTGGCCATGAC
  5   1   2       bld TpA       in                   TTpA043h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATACTGCTGGCGATGACCTAGCAAAGTTACTTTGGCTAAAAAGCCCCAGCTCTGAGGTCTGGTTTGACAGACGAACAAATTACACACGTTCCTTGGCAGTGATGTCTATGGTGGGATACATCCTTGGACTGGGAGACAGGCACCCATCTAACCTGATGTTGGATCGACTCAGTGGGAAAATCCTACATATAGACTTTGGGGATTGTTTTGAGGTGGCCATGACAAGAGAGAAGTTCCCAGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGCTATGGAGGTGACAGGACTTGATGGAAATTACAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGA
  5   1   2       bld TpA       in                   TTpA049m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGAATCCCCGGGCAAGAGAGAAGTTCCCAGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGCTATGGAGGTGACAGGACTTGATGGAAATTACAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACA
  5   1   2       bld Tbd1      in                        CBXT10988.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAAAGATCCCATTCCGCCTAACACGAATGTTAACCAATGCTATGGAGGTGACAGGACTTGATGGAAATTACAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTAGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCT
  5   1   2       bld Gas7                                  XZG9497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTACAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGNGGATGGTTTNGGTGCACCAGAAGC
  5   1   2       bld TpA       in                   TTpA069j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAATAACATGCCATACAGTGATGGAGGTATTAAGGGAGCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTT
  5  -1   2      seed Lun1      in                         CABD3029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCATAAAGACAGTGTCATGGCTGTGCTAGAGGCTTTTGTATATGATCCTCTACTAAACTGGAGACTCATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTAT
  5   1   2       bld Gas7                                 XZG21211.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGATACCAACATAAAGGGCAATAAGCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGTAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAAGTGGTTGCTGATCTGGCTGCACCTGTATGAAACCTTACAGTTTCCTGTTAGCC
  5   1   2       bld Tbd1      in                        CBXT15988.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGCTCTCGCACACGGACAGATTCCTACTCAGCTGGACAGTCTGGAGAAATAATGGAAACTGTAGAACTTGGGGAGACTGCACATAAGAAAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTAGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAC
  5   1   2       bld Neu                            TNeu014h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAACTGGAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTNTGTAGGATTATGTTTGTGTACCACAGAGTTCTATG
  3   1   2       bld TpA       in                   TTpA049m02.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGCACAGTTCCAGAGTCCATTCATACCTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTTTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTAAGTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8                                  st82h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGCCTTGCAGTTGGGGATGGTTTGGTGCANCCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTANCAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGATTTTATAAAGGGGTTCAGAACAAAC
  3   1   2       bld Tbd1      in                        CBXT15988.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACTTTATTGGGGATGGTTTGGTGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTAGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGCAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE4551.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAACCAGAAGCTTTAAATAAAAAAGCCATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATCGAAAAAAACACAGTTTGAATGAATGATGGGATCTACAGCGAATTACAGGGAATACTTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTATCTCT
  3   1   2       bld Gas8      out                         st55e04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCAAATCATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGANGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGATTTNATAAAGGGGTTCAGAACAAACTA
  5   1   2       bld Tad5      in                         XZT67480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTAATCGGGTACGAGACAAGCTAACAGGTCGAGACTTTTCTCATGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATCGAAAAAAACACAGTTTGAATGAATGATGGGATCTACAGCGAATTACAGGGAATACTTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAANAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAANACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTC
  3   1   2       bld TpA       in                    TTpA043h16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATCGAAAAAAACACAGTTTGAATGAATGATGGGATTTACAGCGAATTACAGGGAATACTTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTTTTTTTTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTTTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTCCCTTTGTAGGATTATGTTTGTGTACCACAGAGTTTTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAACCCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAGTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                 XZT61144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAACTCTAGATGTAGCCACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGATTTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAG
  3   1   2       bld Tbd1      in                        CBXT10988.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACACAAGTGGAGCTCTTAATAAAACAAGCCACATCTCATGAGGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATTTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATT
  3   1   2       bld TpA       in                   TTpA069j10.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGATTTTATAAATGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTAA
  3   1   2       bld Tad5      in                         XZT67480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAACAAGCCACATCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATCGAAAAAAACACAGTTTGAATGAATGATGGGATCTACAGCGAATTACAGGGAATACTTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGT
  5   1   2       bld Tbd1                                 CBXT4754.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCCACGCGTCCGCTCATGAGAACCTTTGTCAGTGTTACATTGGATGGTGCCCTTTCTGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAACTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAACATTCAAACCTTGAAAATGAACAATAATGCTCCGTGCTTAAAACAGGAACAATGATTTTATAACGGGGTTCATAACATACTTAATTCAATCTTTCACAGAATACAAGC
  3   1   2       bld Liv1      in                         CAAR6803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGATTTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTATCTCTTC
  5   1   2       bld Liv1      in                         CAAR6803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTAAACAGGCTTTTGAGGGACCTTTTATGGTTTTGGCATATATTACATTGATTTGGCCGCGCTCAGTGAGCTGAACATTTGAAGATCCGATTAAAGAATGGAAAAAAACATAGTTTGAATGAATGATGGGATCTACAGTGAATTACAGGGAATAATTTTATATAACCCTTTTAAACAATTATTTTATTTTGTGAGGGTTTTGCTTACCACTCTCTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGATTTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTATCTCTTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas                            TGas041c08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTCTACTTCAATCATGCATACAAATTGAAAGCTGAGCAAGTGGTTGCTGATCTGGCTGCACTGTATGAAACCTTACAGTTTCTGTTAGCTGGAATGTTGTAAGTGGACCATAGATTTTGTGTCAAATCAAAGAGAAGTAAATTCAGGACATGCTAATAAAATGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTNAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANGGAAAGCGG
  3   1   2       bld BrSp      in                     EC2BBA16DD05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAG
  3   1   2       bld BrSp      in                     EC2BBA17AD08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAG
  5   1   2       bld BrSp      in                     EC2BBA16DD05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp      in                     EC2BBA17AD08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTTAGTGTACCTTTGTAGGATTATGTTTGTGTACCACAGAGTTCTATGGTTTGTTTTGTAAATATTATGTTACGGCAAAAAGATACTTAAACATTATGCTTTAGCATTCAAACCTTGAAAATGAACAATAATGCTCTGTGCTTAAAACAGGAAGAATGAATTTATAAAGGGGTTCAGAACAAACTTAATTCAATCTTTCAAAGAATAAAAGCCTGTTTTAAGTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)