Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012076139 Xt7.1-CABJ7068.3.5 - 57 ESTs
                                                                       .........-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ7068.3.5                                                                                                                                                                                                                                                                                        CTGAAAAAAAACCCATAGCACAGCCCCCATACATCTGCCTGCCCACCCCAAGCACAGTCCCCATCTATACATCTGCCTGCCCACCTTAAGAAAAACCCCTTCCAAACATCTGCCTGCTGTCCTCAAGTAAAGACCTTCCCCCATACATCTGCCTGCCCACCCCAACAGAGACCACCCCAAACATCTGCCAGCCTACCCCAAGCACAATACCCCACCTATACATCTGCCTGCCCACCCCTACACAGACCCCTCATTACCTCTACCAGACCTTCCCAAGCTTAGACCCTCGAGGGCTTCTACTGACACACAGCGGGCACTCACTGACACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225146                                                                                                                                                                                                                                                                                              AAAAACCCATAGCACAGCCCCCATACATCTGCCTGCCCACCCCAAGCACAGTCCCCATCTATACATCTGCCTGCCCACCTTAAGAAAAACCCCTTCCAAACATCTGCCTGCTGTCCTCAAGTAAAGACCTTCCCCCATACATCTGCCTGCCCACCCCAACAGAGACCACCCCAAACATCTGCCAGCCTACCCCAAGCACAATACCCCACCTATACATCTGCCTGCCCACCCCTACACAGACCCCTCATTACCTCTACCAGACCTTCCCAAGCTTAGxxxxxxGAGGGCTTCTACTGACACxxxxxGGGCACTxxCxxxCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                             2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     4     2     4     2     4     2     4     2     5     2     6     2     7     2     8     2     9     3     9     3     9     3    10     4    10     6    10     8    12     8    12     8    12     9    12     8    12     9    12     9    12    10    13    10    13    10    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    14    14    14    14    15    15    15    15    14    14    14    14    13    14    13    14    13    14    12    14    13    14    14    15    13    14    14    15    14    15    14    15    14    15    14    15    13    15    14    15    14    15    13    14    12    14    12    14    12    14    13    14    13    14    13    14    12    14    10    13    12    14    12    14    11    14    12    13    12    13    14    17    15    18    15    18    15    18    14    17    13    16    13    17    15    19    16    21    15    19    16    19    13    20    13    20    13    20    13    19    13    19    12    18    14    19    14    19    14    19    14    19    15    20    16    21    16    22    17    22    17    22    18    23    18    23    18    23    18    23    17    21    17    21    17    21    17    21    17    21    17    22    17    22    18    22    18    22    18    22    18    22    17    21    17    21    17    20    17    20    17    20    16    20    16    21    15    19    14    18    14    18    14    17    14    17    13    16    13    16    13    16    13    16    13    16    13    16    13    16    13    17    13    16    13    17    14    18    13    17    13    17    13    17    13    17     5     5     3     4     3     4     3     4     3     4     3     4     3     4     5     6     5     6     5     6     6     7     6     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     8     8     8     8     9     8     9     8     9     8     9     7     8     7     8     7     8     6     8     8    10     8    10     8    10     8    10     8    10     8    10     9    11     7    12     7    12     7    12     8    12     9    11     9    11     9    11     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     9     9     9     9     9     9     9     9     8     8     6     6     5     6     5     6     4     5     3     4     3     3
  5   1   2  SIG                                      Xt7.1-CABJ7068.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TTpA071i05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAACCAAACCCCCAAACGTATCTACCTGTACACCCAACATAGATACCTAAATCCTGGCTTGCCTGAAGGTAGCAGCCCCAGTCCCCAGATCCTGATTGCTGTCTCTTTTGCAGGCAGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTGAGTACGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTCCTTTTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGCCACTTTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------G--A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----T------
                                               BLH ATG     495    1437                                                                                                                                                                                                                                                                                        
                                               BLH MIN     495     165                                                                                                                                                                                                                                                                                        
                                               BLH OVR     495     503                                                                                                                                                                                                                                                                                        
                                               ORF LNG     495      43                                                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 2e-008     NP_510223.1 helix Loop Helix containing protein, MAX-like bHLHZip transcription factorBIGMAX (mxl-3) [Caenorhabditis elegans] =================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 3e-009     NP_525062.2 diminutive CG10798-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 1e-015     BAE06566.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sp ==== 4e-038     NP_999744.1 myc protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Bb ==== 3e-050     BAD93381.1 Myc [Branchiostoma belcheri] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dr ---- 9e-113     NP_997779.1 zgc:85706; v-myc myelocytomatosis viral related oncogene, neuroblastoma derived(avian); wu:fb57a02 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 3e-141     NP_005369.2 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived; OncogeneNMYC; v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived[Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 4e-144     NP_032735.2 neuroblastoma myc-related oncogene 1 [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 2e-155     NP_001026262.1 v-myc myelocytomatosis viral related oncogene, neuroblastoma derived [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          CAA41525.1 N-myc protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          AAH76996.1 V-myc myelocytomatosis viral related oncogene, neuroblastoma derived [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ7068.3.5                                                                                                                                                                                                                                                                                                       TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------TGA---------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TAG---------------------------------------------------TGA---------------------------------------------------------------------------TGA---TAA---------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------TAG---------------------------TAA---------------------------------------------TGA---------------------------------------------------------------------------------ATG---------------TAA---TGA---------------ATG---ATG------------------TAG---------------------------TGA------------------------------------------------------------------ATG------------------------TAG---------------------ATG------------TGA------------------------------------------------------------TGA---------------TGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2  SIG                                      Xt7.1-CABJ7068.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008287014                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTACTGACACACAGCGAGCAGGGGCACTCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Neu0 FL                     IMAGE:6995572.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCCGGGTGTGTCGACTTTTTTTTTTTTTGGTTAATAATATCCAACAGCTTGTAAGTGTGTGCAGTGAGAGTGTGCGCACTGGGCTGCCCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATATGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGATGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg105p20.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGAGTGTGCGCACTGGGCTGCCCTGCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAAAA
  5   1   2   14  add Ovi1 5g3  in                        CABI12853.5p .............................................................................................................................................................GGATTTTGGCTGAATGGCTGGTGTCTTTTTGGTTGCATGCAAAGCATGATGCAGGGTGGGAGTTGCTCCTGATGGGTGGTGTTGAGCTCTAGCAGTGAAGCGGACCCCCCTCAAACATTTCCCTGAAAAAAAACCCATAGCACAGCCCCCATACATCTGCCTGCCCACCCCAAGCACAGTCCCCATCTATACATCTGCCTGCCCACCTTAAGAAAAACCCCTTCCAAACATCTGCCTGCTGTCCTCAAGTAAAGACCTTCCCCCATACATCTGCCTGCCCACCCCAACAGAGACCACCCCAAACATCTGCCAGCCTACCCCAAGCACAATACCCCACCTATACATCTGCCTGCCCACCCCTACACAGACCCCTCATTACCTCTACCAGACCTTCCCAAGCTTAGACCCTCTCCAAATACCTGCCCACTTATCCCAAGCATAAAGTGCCCCCATACATCTTTCTTCCCTTTCTAACCAAACCCCCAAACGTATCTACCTGTACACCCAACATAGATACCTAAATCCTGGCTTGCCTGAAGGTAGCAGCCCCAGTCCCCAGATCCTGATTGCTGTCTCTTTTGCAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCC
  5   1   2       add Egg  5g                        TEgg098o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGCTGCCCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATATGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACT
  5   1   2       add Neu0 FL                            IMAGE:6995572                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGTCGACTTTTTTTTTTTTTGGTTAATAATATCCAACAGCTTGTAAGTGTGTGCAGTGAGAGTGTGCGCACTGGGCTGCCCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATATGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCTACCACCTAGTTCAACAGTGGGGCAGCCACTGTTGTCCAAGGCGCTGGGGGTGGGACATGTAATTAATTTCCACCCCGCACCATTGGTGGTTGAATTCCCCACCCGGGGGGTCCTTTTCC
  5   1   2       add TpA  5g                        TTpA021a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCACTGACTAATGGCTAGGGCACTCACGTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAATAAGGGCTGGGGCACTCACTGAATAAGGGCTGGGGCACTCACTGAGTAACGGCTGGGGCACTCGGGCAGCTGCCGAGCCAATGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAGCCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATATGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCATTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAACTGTTGCTGTTGCCTCCAGAGACTGATCTACTANGAGGTTCTGGCTGGGGAGAAC
  5   1   2       add Egg  FL                        TEgg105p20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGAGTGTGCGCACTGGGCTGCCCTGCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGT
  5   1   2       ext Gas8 5g3  in                          st21a05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTGCGCACTGGGCTGCCCTGCTGCTGCTGCCACTGAACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAAAGCCAGCCATTCCTCACCCACCTAGTTCA
  5   1   3        nb Egg       in                   TEgg047b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCACTGGGCTGCCCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACTGATCGAGCAAGGGCACTCACTGGGCTGGGGCACTCACTGACTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCCGGCAGCTGCCAAGCCAAGGGGAGACACATGCTGCAAGCACTGAGCCGAGCCTACTGACTGGGCTGGAA
  5   1   2   12  add Tad5 5g3  in                         XZT18977.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCTTGTAAGTGTGTGCAGTGAGAGTGTGCGCACTGGGCTGCCCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAAC
  5   1   3        nb Tbd0 5g                            IMAGE:6979783                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGAATTCCGGGATGGGGCACTCACTGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGNGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCATTCACAGGNGGAGAGCTGCAGACTGCCCCGCTGGTCTGCTGCAGCATGCCATCCTCACCTGN
  5   1   4   10 seed Ovi1 5g3  in                        CABI11968.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGNGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGAT
  5   1   3        nb Gas8      in                          st75m15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCACAGAGCGGAGCCTACTGACTGGGCTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCANAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGANCTGCACCCAGCCT
  3   1   3        nb HeRe      in                     EC2CAA10AF12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATATGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAG
  5   1   3        nb HeRe      in                     EC2CAA10AF12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGTTGGTGAGCAGAAATCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATATGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGA
  5   1   3        nb TpA                            TTpA053b23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTANAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTNCAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACG
  5   1   3        nb TbA                            TTbA058j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGAGGTTCCTGGCTGGGGAGAACTTGGACCTATCTTTCTGCAATGTAAAATCCCATCATTATCCAGGACTGTATGTGGAGTGGCCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAACCCGCCATTTCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCCGGGCGTGGGGTGGACATGAATAATCCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCCTTCCCATTCAACAAGGGGGAAAGCTGCAGGACTGCCCCGGCTGGTTCCTCTGCCAGCAGTGCCAATCCTCCCCCCTGCACAACCACATCTGTGCCAGCCCCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAG
  5   1   2       ext Ski1      in                         CABJ7068.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATNTAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAANGTCGTCATCCT
  5   1   2       ext Tbd1      in                        CBXT13480.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACG
  5   1   0       chi Tad0      in                       IMAGE:6982354                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGTTCATAACCAGCCAAGATAGACATTACGTCAAGTGTCTTTGGCCTGGTTTTTAATGTATTTTTAAAACTTTTAATCCAATATGTGCACAACACATGGTTTTGGGTCTTTTAAGCCAATAGGTGTGTAATACATGGTTGTAAGTACTGTGTAGGAGATGTCATCTCAAGACTGAAGTTCTCCAAACACATAAAAGATAAGGATTCATGATTTGGAAATTGCCCCAAACTGTTTCAGTTAGAACATTATAAACCTCTCCAAAATTGTATTGTAATGTGTTTTTCTCTCTCTCTGATGTAGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGATGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAAACACAACATATTGGAACGCCAACGN
  3   1   0       chi Tad0      in                       IMAGE:6982354                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTTTGGACAAAGGTTAACTTGTTTTGAAGGAGAGAATGGTTCTATCTTTCAAGAGAGCCAGAAAATTTCTTCCCAAAACCCCTTTATAAAAGGGTTAGGGGATTTTCGAGGGATTTGAGGAAATTTGCCCCCAAAATCTTTTTCCGGTTAGGAACATTTATAAACCCTTTCCAAAAATTGGTATGGAAAAGGGGTTTTCTCTCTCTCCGAGGTAGATGATGATGAAGAAGAAGAAGGAAGAAGAGGACGAGGAAGAGGATGATGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATTTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTTTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTTGTTCATCCTGAAAAAAAGCCACTGAGTACGTTCATTTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTCCTTTTAGTATTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCNCTCTCCCCTGAACTGTTGATGCCACTTTGCAC
  5   1   2       add Tad5      in                         XZT23410.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGATGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACT
  3   1   3        nb Gas8      in                          st75m15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGCTGCAGGACTGCCCCGGCTGGTTNTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATNTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTNTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTNTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCA
  5   1   0       chi Egg       in                   TEgg032h22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTCTCCCGGGTGTGTCGACTTTTTTTTTTTTTGGTTAATAATATCCAACAGCTTGTAAGTGTGTGCAGTGAGAGTGTGCGCACTGGGCTGCCCTGCTGCTGCTGCCACTGACTGAGGGCTTCTACTGACACACAGCGAGCAGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCACTGAGTAAGGGCTGGGGCACTCGGGCAGCTGCCGAGCCAAGGGGAGACACAGGCTGCAAGCACAGAGCGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAA
  3   1   2       ext Ski1      in                         CABJ7068.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAA
  3   1   2       add Tad5 5g3  in                         XZT18977.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTT
  3   1   2       add Ovi1 5g3  in                        CABI12853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTT
  3   1   4      seed Ovi1 5g3  in                        CABI11968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTT
  3   1   2       add Tad5      in                         XZT23410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAGAGNNAAGAGGAGGAGGAAGAGGATGATGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTT
  5   1   2       ext Ova1      in                         CABE6385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGAGGGTCACAGTGACTCTGATGATCATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                         CABE6385.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTT
  3   1   2       ext Tbd1      in                        CBXT13480.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGACTCTGATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAA
  5  -1   3        nb Egg                            TEgg125l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Egg       in                    TEgg047b17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGACCCCGCAGAATGAGGTGATCTTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTAAGCAGCTCCCTCTCCATACGTGGAGACAGAAGATGTGGCTCCACCTCAAAAAAAGCAGATGAATGAATTGCCGCGCCTAGTAAAGAGTGTGGTGCCAACCATGGCAAAAAGTTCCAGTCCTCGCAATTTCGACTCTGAGGACAGTGAAAGGCGGAGGAACCACTACATATTTGGACGCCACAGGGGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTGCCAGAACTCATTAAATAACGAGAAAGCAGCTAAAGTAGTCATCCTGAAAAAAGCCAATGAGTGGGTTCATTCCTTGCACGCCGACGAACAGAAACTCTTATTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGGTAAACTTTTTCCTTTTAGTATTTTTTGCTCACGCCGGTTTTTGGATATTGTTAGATTGGTTTTCCTCTCCATGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext TbA                            TTbA001i01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGGTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCT
  5   1   3        nb TpA                            TTpA037o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTT
  5   1   2       ext Ova1      in                         CABE8732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTC
  3   1   2       ext Gas8 5g3  in                          st21a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GNCAAAANGTTCCNTTCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTT
  5   1   3        nb TbA                            TTbA066l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAAATGGTTGGTTTCATTTCATTCCCAGTTAACTCCCACAGTTTTGGGGGGTTTTTTTCCGGGAAAAATGTTTTTCTCCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGNCCTTTTTTTTTTTTTTTTTTTTGNACTTTTTCTTGGGCTACCAGGTANCCCCCACCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTAC
  5   1   3        nb HdA                            THdA003n12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAAGAAAGAAAGAAGAGAAACATTTTGACGTTAAGAATGTTGGTTTCATTTCATTCCAGTTAACTCCACAGTTTTGGGGGGTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAAACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTTTTGAACTTTTTCTTGGGCTAGCCAGGGAGCCCCACCCCCACTTACCAATAATT
  5   1   2       ext TbA       in                   TTbA019m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTA
  5   1   3        nb TbA       in                   TTbA020m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAGTTTTGGGGGTTTTTTTTCGGGAAAAATGTTTTTCTCTTGCGTTGTTTGAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTG
  5   1   2       add TbA       in                   TTbA061k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATGTTTTTCTCTTGCGTTGTTTGAACACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACAGTACACTTTTATATGGTCGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTATGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATG
  3   1   2       ext Ova1      in                         CABE8732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAACAACTGGATGATGCTTCGAGGTGTTGAGTAGACTGCCAAAATCATTTACTGTACACTTTTATATGGTTGTTTTTTTTAACATTTTTAGTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGAC
  3   1   2       ext TbA       in                    TTbA019m05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTTAACATTTTAGTTTTTCCCAATCCCCTAGATAAGAGGGTTGCATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       add Egg       in                    TEgg032h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTTATTTTGGTTAGCCTCTCTGGCGAATTTATTTTTGAGCTGCTGTTTTTTCATTCCTCTCCCCATTTTCTTTATGGTGCTCATATTTTTGGTGATGTTACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCNCATGCCATTGCCTTTTTTTTTTTTATGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCAACCCCCCCCACTTCCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGAAAAAAAAAAAAAAAAAAA
  3   1   3        nb Kid1      in                        CABA10130.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTGAA
  5   1   3        nb Kid1      in                        CABA10130.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACTCAAGAGGACTAGCACTTATTCCCTCTGGGTACATTTTTGTAAATACCCACTCTCCATGCCATTGCCTTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAA
  3  -1   3        nb Tbd1                                CBXT11659.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTTTTTTTTTTTTTGTACTTTTTCTTGGGCTAGCCAGGTAGCCCCACCCCCACTTACCAATAATTAGACTGGAAGCTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGCGCATGTTTTGTATACAAATATATTGTTAATCTCTCGTTATGTACTGTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCAAAAAACTGGATCCTTCCGTAAAATATAAA
  3   1   2       add TbA       in                    TTbA061k08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTACTTTTTTTTGGGCTAGCCAGGGTAGGCCCACACCCCCCCCCTTTCCAATAATTAGACTGGAAGTTCAGACCTAAGTACTGTAATTACCTCAATGTTTGAGGGGCATGTTTTGTATACAAAAATATTGTTAATTTCTCGTTAGGTACGGTAATAATTTTTACACGGCCGGTATACTTTAGTATGATCCGGATACATAACTAAATTTGATACTTATATTTTGGTATGAAAAAGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGGTATGAAATTTTTT
  5   1   2       ext Tbd1                                CBXT18064.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACTAATTCTTACACTGCCTGTATACTTTAGTATGATCCTGATACATAACTAAATTTGATACTTATATTTTCGTATGAAAATGAGTTGTGAAAGTTTTGAGTAGATATTACTTTATCACTTTTTTGAGCTATGAACTTTTTTTGTAAAGAAAATTATTATATATATTCCTTGTTTTCTTAGCCTGTTCCTCCTTGTTTTTATGTCTTTTTGTTCATGTTTTGCAGCATAGAACTGGATCATTTCAGAGTTTATGTGTGTTTCTGTTTGACTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACATTAGTGCTTTATCTATTAGCACTTTGAAATACCTCATGTTTATGAAAATAAATAGCGACAAAACTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   3        nb TbA       in                    TTbA020m05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGGGGGTTTCGGTTGGAGTTTCCTTTCTTTTTCTCCTTTCCAAACAATGTACAATAGTGCTTTATCTATTAGCACTTTGAAATACCTCCATGTTTATGAGAATAAATAGGGACAAAACTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2  SIG                                    Xt7.1-TTpA071i05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTT
                                                  Xt7.1-CHK-1008287012                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGAT
  5   1   4      seed TbA  5g3  in                   TTbA037p14.p1kSP6                                                                                                                                                                                                                                                                CGGACCCCCCTNNCAAACATTTCCCTGAAAAAAAACCCATAGCACAGCCCCCATACATCTGCCTGCCCACCCCAAGCACAGTCCCCATCTATACATCTGCCTGCCCACCTTAAGAAAAACCCCTTCCAAACATCTGCCTGCTGTCCTCAAGTAAAGACCTTCCCCCATACATCTGCCTGCCCACCCCAACAGAGACCACCCCAAACATCTGCCAGCCTACCCCAAGCACAATACCCCACCTATACATCTGCCTGCCCACCCCTACACAGACCCCTCATTACCTCTACCAGACCTTCCCAAGCTTAGACCCTCTCCAAATACCTGCCCACTTATCCCAAGCATAAAGTGCCCCCATACATCTTTCTTCCCTTTCTAACCAAACCCCCAAACGTATCTACCTGTACACCCAACATAGATACCTAAATCCTGGCTTGCCTGAAGGTAGCAGCCCCAGTCCCCAGATCCTGATTGCTGTCTCTTTTGCAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGC
  5   1   0       add Tad0 5x                            IMAGE:6983515                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCTAACCAAACCCCCAAACGTATCTACCTGTACACCCAACATAGATACCTAAATCCTGGCTTGCCTGAAGGTAGCAGCCCCAGTCCCCAGATCCTGATTGCTGTCTCTTTTGCAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCCCAAACCTGGACCTGTAGTTTCACCTCACCCAACCTTGCTTCTTTAGCAATGACGCCTTATTTTTGCCCGTGAACTTCATTTTTTACTACTTCCCCAGACCGCTTTATGGTTCATAGCGTCTTTATATTCTAATACACTTTCTCCCTGTCCAGCGTAAATGTGCCCCCTATTTTCCCCCCTATTTCTCCTTTATTGAGCTCTAACCCCCTGATCTGCTCTCCCGCAGATGGCCATTTTTCTGCCTGTCTTTTTTTTTTCTACACCGCCCTTTTATCCCCTTTTTTGTCTCCCCCACTTTTTTTTTTTTTCCTGCCCCCTTTACAACACTCCCTTCCTACCTACCACCTTTTTTATTCCCGCCCCCCCTGTCCTTCTCTGTCCTCCTACCCACCTCTAGTATGCCTCTTTCAAGATTACTCATGATATCCTCCTTTTCATCCACCAATCTATCTACCTTTATACTTCCTTCACAGCCCGCTACATATTCCGACAACCGACACTTCCACGCGTACTCGTTTTTTTTTTATTTTCCCCGCCCCCCCACCACTGCCCCCCCCCTATCTTCCCTATTCTTATTGCTCTCTACCCACCTTTTTTATTTCTCCACCCACCCCCCTTCCCCCTGCTCCTGTN
  5   1   2       ext TpA  5g3  in                   TTpA071i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGAACAGAGGCAGGACACTGGAGCTCAGAGGTTGGCACTAAGATGCCAGGGTTGGTGAGCAGAAACCTGGATCTGGAGTTTGACTCCCTGCAACCTTGCTTCTACCCGGATGAAGATGATTTTTACCTGTGTGGCCCAGACTCTGCCCCCCCAGGGGAAGACATCTGGAAGAAGTTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGCCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTATCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGGCGCACTCCTCCNACAAATCTGTAACGTCT
  5   1   3        nb Neu                            TNeu049g17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGAATTGCTTCCTACACCCCCACTTTCCCCCAGTCGTTCTGGGCTGCATGGTGATCCTCTCTCTCCAGGGCTGCCTGGGGATTATGGGGATTCATTGGACTGGGCATCTGAGCTGTTGCTGTTGCCTCCAGAGACTGATCTACTAGGAGGTTCTGGCTGGGGAGAACTTGGACTGTCCCCCTGCAATGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGGCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGATGAAGANGAAGAAATTGATGTGGTCACAGTTG
  5   1   3        nb TpA                            TTpA011l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGGGAGAACTTGGACTATCCCCCCTTTTTGTAAAATCCATCATTATCCAGGACTGTATGTGGAGTGTCTTCTCTGCCCGGGAGAAGCTGGAGAGGGCAGTCAGCGAGAAGCTGGGCAAAGCATCATGCACCGCAGAGCCAGCCATTCCTCACCCACCTAGTTCAACAGTGGGCAGCACTGTGTCAGGGCGTGGGGTGGACATGAATAATCCAGCAGCACATTGTGTTGATCCAGCCGTGGTCTTTCCATTCCCATTCAACAAGGGGGAGAGCTGCAGGACTGCCCCGGCTGGTTCTGCTGCCAGCAGTGCCAATCCTCCACCCTGCACAACCACATCTGTGCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCANAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTC
  3   1   2       ext TpA  5g3  in                   TTpA071i05.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCAGCCGCCGCTACAGCTAGGAGCTGCACCCAGCCTTGCTCAACCAGCTGCAGCTCTGGTGAGGAAAGTCACAGTGACTCTGATGATGATGAAGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTTGAGAAAAGGCGCAACTCCTCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTTGGATTCTTTAAAAAAAAAAAAAAAAA
  3   1   4      seed TbA  5g3  in                    TTbA037p14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATGATGATGAAGAAGAAGAAGAAGAGGAGGAGGAAGAGGATGACGAAGAGGAAGAAATTGATGTGGTCACAGTGNAGAAAAGGCGCAACTCCTCCCAACAAATCTGTAACGTCTCTTACAATCACCGTACGACCTAAAAACACCATCTTGGTGTCTGCCAAGACCACGCAGAATGAGGTGATCCTCAAGCGATGCGCTCCAGTCCATCAGCAGCACAATTACGCAGCTCCCTCACCATACGTGGAGACAGAAGAGGTGGCTCCACCTCAAAAAAAGCAGAAGAATGAATTGCCGCGCCTAGTAAAGAGCGTGGTGCCAACCAAGGCAAAAAGCTCCAGTCCTCGCAATTACGACTCTGAGGACAGCGAAAGACGGCGGAACCACAACATATTGGAACGCCAACGGCGCAATGACTTGAGGTCGAGTTTCCTGACATTAAGGGACCATGTACCAGAACTCATTAAAAACGAGAAAGCAGCTAAAGTCGTCATCCTGAAAAAAGCCACTGAGTACGTTCATTCCCTGCACGCCGACGAACAGAAACTCTTACTGGAAAAAGAAAAACTGCAGCTCCGACAGCAACAATTGGTCAAGAGAATCGAACACTTGCGGACTTGCTAAACTTTTTCCTTTTAGTATTTTTTGCTCCGCCGTTTTTTGATATTGTTCGTTTCGTTTTCCTCTCCCTGAACTGTTGATGCCACTTTGCACATTTTGGATTCTTAAAAAAAAAAAAAAAAAAAAGCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)