Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ8070.5                           10 END     7          20       70                Similar to hypothetical protein MGC45404 [Xenopus laevis]
     2   2.0    0Xt7.1-CABE12534.3                           6 END     3           8       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012076346 Xt7.1-XZG52805.5 - 34 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG52805.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCTCCAGGCAGGCAAACGCAACAGAACAATCCCTGGCCGCCTTCACCGCAAGCTGTTCTTCCCCATTACAATCCATGTCCTCCTTATCCTCACAGTTTTCAACCTACACAGTATTCTCCAAAACAGCCTCAGATTCCACAGTCTGCTTTTAGATCTCCACCAACTTCACAGTGCACTTCTCCCTATAGTTCTCCACAACATCAAGTGCAGACCAACCAGCTGAGCCACCAGACATCACATGTGTTTCTGCCACCCAGCCCATCAACAGTGTCACCTCACCTATACCAGCAGGCACCTCCAGCCTATCCTAAGCAAAGTAGCCATTCTCTTGGGTATCTTCCCTATGGACCTGGTATGAACAAGGGATCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCTGCCTTGAATAGAAGTCCGTCCCCAATAAATAACCAGTCTTCTCAAAGGAGCCAACAGCATCCTGTTTATGCATCAAATGCACGGTCAGGGTCACCTTCAAGGGGAATATCTAGCCAGCCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCTCCTACAACAACTGGGACTCCAACACCTTCTTCACGTGTTTTAATGTCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTATACAGCCAATTTCCTTGTTGCCAGTTTCAGGTGGAGACAAAGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATAAAAAAGAGGAGCTGGAAAAGCTGAAAACAGAAGTTAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGCGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAACAAAAAAAAAAAAATAAGAATATAATGCACTGCATTTTTTTAAAAAAAAATTGTGTTTTTTCTTTTTGTTCGCAAAAAAACACCAAATTGAAACTCATATATGGTTTTAAAATCATGTTGGTACTTCTAATGCATCTAAATTCCTGTATTGTGAAGGTGATTGGTTTGCATCCTGCAAGTTGCTGAAGTAATAAAGCATCCAATTGTTT
                                                  Xt7.1-CHK-1008227529                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGCAGGCAAACGCAACAGAACAATCCCTGGCCGCCTTCACCGCAAGCTGTTCTTCCCCATTACAATCCATGTCCTCCTTATCCTCACAGTTTTCAACCTACACAGTATTCTCCAAAACAGCCTCAGATTCCACAGTCTGCTTTTAGATCTCCACCAACTTCACAGTGCACTTCTCCCTATAGTTCTCCACAACATCAAGTGCAGACCAACCAGCTGAGCCACCAGACATCACATGTGTTTCTGCCACCCAGCCCATCAACAGTGTCACCTCACCTATACCAGCAGGCACCTCCAGCCTATCCTAAGCAAAGTAGCCATTCTCTTGGGTATCTTCCCTATGGACCTGGTATGAACAAGGGATCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCTGCCTTGAATAGAAGTCCGTCCCCAATAAATAACCAGTCTTCTCAAAGGAGCCAACAGCATCCTGTTTATGCATCAAATGCACGGTCAGGGTCACCTTCAAGGGGAATATCTAGCCAGCCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCTCCTACAACAACTGGGACTCCAACACCTTCTTCACGTGTTTTAATGTCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTATACAGCCAATTTCCTTGTTGCCAGTTTCAGGTGGAGACAAAGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATAAAAAAGAGGAGCTGGAAAAGCTGAAAACAGAAGTTAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGCGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAACAAAAAAAAAAAAATAAGAATATAATGCACTGCATTTTTTTAAAAAAAAATTGTGTTTTTTCTTTTTGTTCGCAAAAAAACACCAAATTGAAACTCATATATGGTTTTAAAATCATGTTGGTACTTCTAATGCATCTAAATTCCTGTATTGTGAAGGTGATTGGTTTGCATCCTGCAAGTTGCTGAAGTAATAAAGCATCCAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    11    12    11    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    13    14    13    14    13    14    13    14    13    14    14    15    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    16    16    15    16    16    16    17    17    17    17    17    17    17    17    16    16    16    17    17    19    17    19    17    19    17    19    17    20    17    20    17    20    17    20    17    20    17    20    16    20    16    20    15    18    11    14    12    13    12    13    12    14    12    14    14    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    13    15    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    12    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    10    10    10    10    10    10    10     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                       ...PROTEIN --- Ce ---- 4e-008     NP_500523.3 AMAnitin resistant family member (ama-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 6e-010     NP_511124.1 RNA polymerase II 215kD subunit CG1554-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 4e-026     XP_796526.2 PREDICTED: similar to Map3k7ip2 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 2e-054     AAI29002.1 Unknown (protein for MGC:145386) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 8e-082     XP_686793.1 PREDICTED: similar to TAK1-binding protein 3 isoform 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 0          XP_416787.2 PREDICTED: similar to Mitogen-activated protein kinase kinase kinase 7 interacting protein 3 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Mm ---- 0          NP_080005.2 hypothetical protein LOC66724 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 0          NP_690000.2 mitogen-activated protein kinase kinase kinase 7 interacting protein 3 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Xl ---- 0          AAH44992.1 Similar to hypothetical protein MGC45404 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - ?? ---- 0          NP_001079583.1 hypothetical protein LOC379270 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG52805.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TGA---------------------------TGA---------------------TAG------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------TGA---------------------------------------------------------------------------------------------------------TGA------------------TAG---------------ATG---TAA---------------------TAA---------TGAATG---------------------------TAG---------------TGA---------------------------------------TAA---------------------------------------------------TGA------------------------------------------------------------------ATG---------------------ATG------------ATG---------------TAA---------------------------------TAG---------------------------------------------------------------------TGA---------------------------------------------------------------------ATG------------------------TAG---------------------------------ATG---------------------TGA------------------------TGA------------------------------------------------TAA------------------------------------TAG------------------------------------------ATG------------------------------TAA---------------TAA---------------------------------------------TGA---------ATG------------------------TAA------TAA------------TGA---TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Ova1      in                         CABE5914.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGACAGCCATCACAGAATTCTCCAGGCAGGCAAACGCAACAGAACAATCCCTGGCCGCCTTCACCGCAAGCTGTTCTTCCCCATTACAATCCATGTCCTCCTTATCCTCACAGTTTTCAACCTACACAGTATTCTCCAAAACAGCCTCAGATTCCACAGTCTGCTTTTAGATCTCCACCAACTTCACAGTGCACTTCTCCCTATAGTTCTCCACAACATCAAGTGCAGACCAACCAGCTGAGCCACCAGACATCACATGTGTTTCTGCCACCCAGCCCATCAACAGTGTCACCTCACCTATACCAGCAGGCACCTCCAGCCTATCCTAAGCAAAGTAGCCATTCTCTTGGGTATCTTCCCTATGGACCTGGTATGAACAAGGGATCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCTGCCTTGAATAGAAGTCCGTCCCCAATAAATAACCAGTCTTCTCAAAGGAGCCAACAGCATCCTGTTTATGCATCAAATGCACGGTCAGGGTCACCTTCAAGGGGAATATCTAGCCAGCCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCTCCTACAACAACTGGGACTCCAACACCTTCTTCACGTGTTTTAATGTCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTAT
  5   1   2       bld Te5       in                        CAAO11213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTCTCCAGGCAGGCAAACGCAACAGAACAATCCCTGGCCGCCTTCACCGCAAGCTGTTCTTCCCCATTACAATCCATGTCCTCCTTATCCTCACAGTTTTCAACCTACACAGTATTCTCCAAAACAGCCTCAGATTCCACAGTCTGCTTTTAGATCTCCACCAACTTCACAGTGCACTTCTCCCTATAGTTCTCCACAACATCAAGTGCAGACCAACCAGCTGAGCCACCAGACATCACATGTGTTTCTGCCACCCAGCCCATCAACAGTGTCACCTCACCTATACCAGCAGGCACCTCCAGCCTATCCTAAGCAAAGTAGCCATTCTCTTGGGTATCTTCCCTATGGACCTGGTATGAACAAGGGATCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCTGCCTTGAATAGAAGTCCGTCCCCAATAAATAACCAGTCTTCTCAAAGGAGCCAACAGCATCCTGTTTATGCATCAAATGCACGGTCAGGGTCACCTTCAAGGGGAATATCTAGCCAGCCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCTCCTACAACAACTGGGACTCCAACACCTTCTTCACGTGTTTTAATGTCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTATACAGCCAATTTCCTTGTTGCCAGTTTCAGGTGGAGACAAAGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATACTGCATC
  5   1   2       bld Gas                            TGas019g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAACGCAACAGAACAATCCCTGGCCGCCTTCACCGCAAGCTGTTCTTCCCCATTACAATCCATGTCCTCCTTATCCTCACAGTTTTCAACCTACACAGTATTCTCCAAAACAGCCTCAGATTCCACAGTCTGCTTTTAGATCTCCACCAACTTCACAGTGCACTTCTCCCTATAGTTCTCCACAACATCAAGTGCAGACCAACCAGCTGAGCCACCAGACATCACATGTGTTTCTGCCACCCAGCCCATCAACAGTGTCACCTCACCTATACCAGCAGGCACCTCCAGCCTATCCTAAGCAAAGTAGCCATTCTCTTGGGTATCTTCCCTATGGACCTGGTATGAACAAGGGATCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCTGCCTTGAATAGAAGTCCGTCCCCAATAAATAACCAGTCTTCTCAAAGGAGCCAACAGCATCCTGTTTATGCATCAAATGCACGGTCAGGGTCACCTTCAAGGGGAATATCTAGCCAGCCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCTCCTACAACAACTGGGACTCCAACACCTTCTTCACGTGTTTTAATGTCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTG
  5  -1   2       bld Liv1      out                       CAAR12627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAACTTCACAGTGCACTTCTCCCTATAGTTCTCCACAACATCAAGTGCAGACCACCCAGCTGAGCCACCAGACATCACATGTGTTTCTGCCACCCAGCCCATCAACAGTGTCACCTCACCTATACCAGCAGGCACCTCCAGCCTATCCTAAGCAAAGTAGCCATTCTCTTGGGTATCTTCCCTATGGACCTGGTATGAACAAGGGATCTATGAACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCTGCCTTGAATAGAAGTCCGTCCCCAATAAATAACCAGTCTTCTCAAAGGAGCCAACAGCATCCTGTTTATGCATCAAATGCACGGTCAGGGTCACCTTCAAGGGGAATATCTAGCCAGCCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCTCCTACAACAACTGGGACTCCAACACCTTCTTCACGTGTTTTAATGTCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTATACAGCCAATTTCCTTGTTGCCAGTTTCAGGTGGAGACAAAGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGGTACTAAAATCTGTCCATGAAATTGACTGTAGTAATATTATGTTTCTCAAATTAAGCTAATATAATTTAGGCATTTGGTGGTAATGGTGTATTCATTAAAGAAACAGTAATATCAACAAAGAAAGTGTTTTAAAG
  5   1   2       bld Brn4      in                        CAAL22213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAGATAGAAATCACAGTTGAATCACAACAAAGACCTGGACCTGCCTTGAATAGAAGTCCGTCCCCAATAAATAACCAGTCTTCTCAAAGGAGCCAACAGCATCCTGTTTATGCATCAAATGCACGGTCAGGGTCACCTTCAAGGGGAATATCTAGCCAGCCAAAGGCTTCATATAGTGGCAGCCCATTATTTATTACATATTCACAACCTCCTACAACAACTGGGACTCCAACACCTTCTTCACGTGTTTTAATGTCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTATACAGCCAATTTCCTTGTTGCCAGTTTCAGGTGGAGACAAAGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATAAAAAAGAGGAGCTGGAAAAGCTGAAAACAGAAGTTAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGCGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGNGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATC
  5   1   2       bld Te5       in                         CAAO1247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCCGTCAAATCCAACTGTGTTTAAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTATACAGCCAATTTCCTTGTTGCCAGTTTCAGGTGGAGACAAAGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATAAAAAAGAGGAGCTGGAAAAGCTGAAAACAGAAGTTAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGCGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTTGTATAGCTGTACTTTCCCTCATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTTGAGTTTTTATATTGATACTATCTAGCATGCA
  5   1   2       bld Brn3      ?                          CAAK8297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAAATCACTGTTGGACGTGCTCCAACTGAAAATCTATTAAATATAGTGGACCAAGAACAGCATCCCAGCACACCAGAGCCTATACAGCCAATTTCCTTGTTGCCAGTTTCAGGTGGAGACAAAGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATAAAAAAGAGGAGCTGGAAAAGCTGAAAACAGAAGTTAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGCGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGGGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTT
  5   1   2       bld Gas                            TGas119i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGAATCCATAAATATCACAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATAAAAAAGAGGAGCTGGAAAAGCTGAAAACAGAAGTTAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGCGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGCATATCAGTCACAATAATTAGAAGAAAAGTACTCAAGTGCTGGGAGCACCTGTTTTTCTATAGATCCTGTTATCCCTATTTAAATGAAAATGTTGTGTTTTT
  5   1   2       bld Ova1      in                         CABE9312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAAGTTCCAGCTCTGGGTCGGATGATTATGCATATACCCAAGCCTTATTACTGCATCAGAGGGCAAGAATGGAGCGGTTGGCTAAAGAGCTGAAACATAAAAAAGAGGAGCTGGAAAAGCTGAAAACAGAAGTTAATGGCATGGAGCATGATCTAATGCAGCGCCGCCTCCGGCGAGTGAGCTGTACAACAGCAATTCCAACTCCAGAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAG
  5   1   2       bld Tad5      out                        XZT59320.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGGGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAATATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGT
  3  -1   2       bld Ovi1      in                         CABI8370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAATGACCAGATTGAGAGGCCTGAACAGGCAACTCCAAATAAATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGG
  3   1   2       bld Ski1 5g3  out                        CABJ8070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGTTGACTGTACACAGAAAGAAATTGATCTGCTTCAGTCACGAGGAATGGGAAAGCTTGATGTCAAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGGGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAATATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAA
  5   1   2       bld Ova1      in                         CABE8391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGCAATGAGTAATTTTTATGACAACCTGTCACCTGGTCCTGCTGTTCCACCTAATACTTGTAAAAAGGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCNNTTATCAGGGTATTGTGTCCATATG
  3   1   2       bld Ova1      in                         CABE8391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAAAA
  3   1   2       bld Brn4      in                        CAAL22213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCATCAGAAACCACTTCAGGAGAAAGAAAAGCCAGAAGAATAAGTGTAACCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTAT
  3   1   2       bld Brn3 5g3  out                        CAAK1974.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGAAAGAAAAGCCAGAAGAATAAGTGTACCCTCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTAT
  5   1   2      seed Gas7      in                         XZG52805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGATTCGATTCGTCGACCCACGCGTCCGCCAAAATTAAATCTGACCCTCCTGATTTACAGACTTCTAGTGGTTTGGATATTGTTCACTGGCAGAGGTCCAGCCCAAGACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTG
  3   1   2       bld Gas7      out                        XZG16476.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACCAGCAAGAGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAAAAAAAGGGCGGCCGCA
  3   1   2       bld Te5       in                        CAAO11213.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCAAGGGATGAAGATTTTGAAGGGTCTCCCTGGAATTGTAATAGCTGTACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAATATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGG
  5   1   2       bld Ova1      in                         CABE1807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTTTCCTCAATCACCCAGCACTAAACCGCTGTGAACAGTGTGAGATGCCACGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATAAAACACAACCTTTATGTATGATTGCTCA
  5   1   2       bld Tad5                                 XZT25470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGATTCACCTGACTTCACTGTAAAAGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTT
  5   1   2       bld Gas       in                   TGas106h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCTTCATTTTGCTTGAAGTTTTTATATTGATACTATCTAGCATGCAAGTAAGGAACCTTACTTAAGTCAGATGGATCAACAAGCTGAGGCCAGCTCCAGAGCAGGACTTGGGATTATTGGTTACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAATATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAATTGC
  3   1   2       bld Gas7      in                         XZG52805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAAAACCAATAATGGGAGAACCGTGGTAATGATATGCCAGAATGCTCTCTACAATCTTGACCATGAATGATGGAGGTCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAAAAAAAAAAAAAAAGG
  3   1   2       bld Ovi1 5g3  out                        CABI7549.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTCAAGATGCTGGTCATTTGGTTGCCATCATTTGTTTCCCCAGAAGACAGACATAAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAG
  5  -1   2       bld Ovi1      in                         CABI8370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCATCATTGTTTCCCCAGAAGACAGAACATAAGCCAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAAC
  5   1   2       bld Ova1      out                       CABE12534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAGATTGTATAGAGGCGAATGAAGTGTTTCAGGTTCGCTGACCAATTATCTGGACGTATTAGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCCTTTTTAGATCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGGCAACAAAAAAAAAAAAATTAGAATATAATGCACTGCATTTTTTTAAAAAAAAATT
  3   1   2       bld Ova1      in                         CABE5914.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGAAACACAGGAGAAATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGATCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAAC
  3   1   2       bld Te5       in                         CAAO1247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAAC
  3   1   2       bld Te4  5g3  out                        CAAN9392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGACTAAAATGTTATATTCTGCTTCTTGTAAGCATCCTACTGAATGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGATCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAAC
  3   1   2       bld Gas       in                    TGas106h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAGACTTTAGTTGTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAA
  3   1   2       bld Ova1      in                         CABE9312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGAGCAGGTGTTGTAGTATAACTTGATTTTATGAAGCCTACTCAGAAAAAAGGAATTGCTGCTTTATTCAGGGTAATTGTGTCCATATGAAATAAGAAATGCTGTTATAAAAAAAAAATTGCGGGTGTGAAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAAC
  3   1   2       bld Ova1      in                         CABE1807.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAATCAAGGTTTTAGCCATACCTTTCTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAACAAAAAAAAAAAAATAAGAATATAATGCACTGCATTTTTTTAAAAAAAAATTGTGTTTTTTCTTTTTGTTCGCAAAAAAACACCAAATTGAAACTCATATATGGTTTTAAAATCATGTTGGTACTTCTAATGCATCTAAATTCCTGTATTGTGAAGGTGATTGGTTTGCATCCTGCAAGTTGCTGAAGTAATAAAGCATCCAATTGTTTTGTG
  5   1   2       bld Gas7      out                        XZG64331.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAACAAAAAAAAAAAAATAAGAATATAATGCACTGCATTTTTTTAAAAAAAAATTGTGTTTTTTCTTTTTGTTCGCAAAAAAACACCAAATTGAAACTCATATATGGTTTTAAAATCATGTTGGTACTTCTAATGCATCTAAATTCCTGTATTGTGAAGGTGATTGGTTTGCATCCTGCAAGTTGCTGAAGTAATAAAGCATCCAATTGTTTTGTGAAACAGAGAACTCAATCTTTCTGTAGCTGAAATCTGTAGAAAACAATGGGAGAGGGATGTTATATTGGATCATGGTTGCCC
  3   1   2       bld Te1  PIPE out                        CBWN7090.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAACATATTATACAAGTGATATTGCTGTCCCTTTGGTTAATGCTGCGTCCAGCAAGCTGTGTCATGAAACTACTGGTTATGTTAACAATCTTACTATAAAAAGCTGAAGATGGAGATATTGCTGCATGTACTTAGTCTTTCTTCCCACCCTATTCAAGTTATACCCAAAAGCTTTGTAGGCACATTAAACACAACCTTTATGTATGATTGCTCAGGAGGAGCTTAGGGCAAAGATGCCAAAACACTGATGTACTGGTATTTGGAATATACACACTAATGACATGTTATTCATACATACATACATAGATAGATAGGTATATATATATATATTCACCATACATGCATAGATACACATTCTGCGTGTGAGCTTACCATTCTGTGAATCATGCTTGATGTTTACAGCACAGAAGGTACTTTGTGCCCCTATCAACCCACTTGACATAATTTTCTATAAGAGCTGAAGATCCTTTTAAGATTCAGTAGAGCTGTGTTATTTGCACATTGTTAAAATGCCTGCTTATACAAATGAAGGCAAACAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)