Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012077140 Xt7.1-CACX814.5 - 38 ESTs
                                                                       ......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CACX814.5                                                         CTGTCTGCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCATA
                                                  Xt7.1-CHK-1008227068                                                               GCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATC
                                                      consensus depths                                                              2     6     5    11     5    12     7    12     7    12     7    13     7    13     9    15     9    16    13    17    14    17    14    17    15    17    15    18    15    18    15    18    16    18    16    18    16    18    16    18    16    19    16    19    16    20    16    20    16    21    17    21    17    21    18    21    18    21    18    21    18    21    17    21    18    21    18    21    18    21    18    21    18    21    19    21    19    21    20    22    20    22    20    22    21    23    21    23    21    23    21    23    21    23    21    23    23    24    22    24    22    24    22    24    22    24    21    24    21    24    18    24    19    24    18    24    16    24    16    24    16    24    16    24    18    25    17    25    15    25    19    27    18    27    18    27    17    26    16    24    15    24    13    24    15    24    15    24    14    25    14    24    12    22    12    18    17    24    18    24    17    24    17    23    15    23    15    23    15    21    16    20    17    21    17    21    16    20    17    20    16    20    16    20    16    18    16    17    16    17    16    17    16    17    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    13    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    13    14    12    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    10    10    10    10    10    10    10    10     5     6
                                                                   SNP                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                             -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                               BLH ATG     140     562                                                         
                                               BLH MIN      80      92                                                         
                                               BLH MPR      -1      92                                                         
                                               BLH OVR     140     290                                                         
                                               ORF LNG     140      25                                                         
                                                                                                                                                                                                                                                                        PREDICTED = Sp ==== 6e-035     XP_786900.1 PREDICTED: similar to Histamine N-methyltransferase (HMT) [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PREDICTED - Dr ---- 3e-082     XP_686712.1 PREDICTED: similar to histamine N-methyltransferase, partial [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PREDICTED = Gg ==== 3e-095     XP_422143.2 PREDICTED: similar to Histamine N-methyltransferase [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 3e-101     NP_008826.1 histamine N-methyltransferase [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 4e-102     NP_536710.1 histamine N-methyltransferase [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 1e-144     AAH54281.1 Hnmt-prov protein [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 1e-144     NP_001080614.1 histamine N-methyltransferase [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 6e-168     AAI21452.1 Histamine N-methyltransferase [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CACX814.5                                                                                                  TGA------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------ATG------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------TAG---------------------------------------------------------------------------------TAA------------------ATG---------------------------------------------------------------------------------------------------------TAG------TAA---------ATG---ATG---TAG------------------TGA---------------------------------TAA------------------------------TAA------------------------------------------------------------------------------------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Te5  FL                         CAAO11185.FL-MGC                                                               GCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCAGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCGCCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGACGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCTATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCATAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       add In54                            IMAGE:8841107.5p GTGTCAAGCATTAAACGGATTTGCCTCCGATAACTTAATTCGTCCCCCCTGCTATTCACCAAATCCGCAGTTATTGGAACTGTATGAATACTGACCCACAGCAGAACCCAAAAGATTCAGAACCCAACTGGACACACACAGGCAAAATGATGACGATGATATAAAACAAACACCAGGTGGCGCTGTTACACCCTCATCCCTAGTCATTACTGTTCCTATTGAAACCTCTTCCCCAGATTATGAGCCTCATTTCCTAACAGTGGCCAAAGGTCCAAGTGCAACAATAAATAAATCATGTTTACTTTCAGGTACACGGGTATTACACTAAGGCACATGTGCCCCATACCCAAGCTACTCGGCACAGATACCTTCTTCATGGCATTTTTACCCTCTCGCCATTGTTTCACTGAGCCCAAGGCAGAGGAACCAGACCCTGCACGTGTTAAGGGGCCCAGAAAATATCTAATATTGGGGTACTGACTGATAAGCCGTTCCAGTATAGGTTTATAATAAATGCAGTGGAGTAACTTGATGGTGCCGAGCCCCCCCTGCGAAAAACCTTAGGAGGGGCCAGGCACACAGAAATTACAACCCAGAAATCTGGACTAGACCACACCCCCCCGCAACCATTTGGGTCTGCTTCCTCTATAGTTTACATCATACTCTGTACCTAGAAATAGGTAATATGGGAAATTAGCCCAAATCTTTTCTCGCTCACAGTAACAGTGGGTGGTCCATGCTAATGAAGAAATCACGGCCCGCGGCTTCTGCTTGAACGACTCTGCCTGTAAGTTCGGCGGGGGACATCGCCCAATGCTGATTCAATGGGCGTCCGGTTCAGATCTACGAACTGTCGACTGGACATGACATCCAGATGTGTTCTCT
  5   1   2   14  bld Brn4 5g3  in                        CAAL11247.5p ........TTTTCGTGATGGCAGTGCCGGAATGTTCCGTGTTGGATGGAGACGAGCCCAGGAATATCCTGCAGTGAGGCATTTCTGCTCCTCAGCAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCTCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCTCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTTCATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCA
  5   1   2       bld In66 5g                         IMAGE:8965185.5p           AATTTTTACTAACAAAAGACCCATCGAAATCAAATTCGTCCCATTCCTCTGTCTGCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGACACACAGGGATCTAGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGCGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCATGGGAAGCTCTTGATCATTCTCGTATCAGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGCCCGCGGCTCCCGCTGAACGACTCTGCCTGTACGTTACGCGGGGGACATCGCCAGATGCTGAGTCAATGGGCACCCGTCAGAGCTACGAACTGCGTCTGACTGGACATCACGGATGTTCATCGAGGGACAGACGGTAATGCCTGTGACCTTCTGAACGAAACCTGCGCA
  5   1   2       bld In60 5g                         IMAGE:8947348.5p                                                   ATTCCTCTGTCTGCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCTCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCACGTAACAGTGGGTGGTCCATGCTATGGAAGAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGACTGCGTCTGACATGACATCACCGAATGTTTCATCGAGGGGACAGACGGAAATGCTGTTGGACTTCTGACCGGAACTGCACTTTAAGAGAATGGCTCCGCTGATCCCTCAGGGCA
  5   1   2   14  bld Met5 5g3  in                          CACX814.5p ...................................................TTCCTCTGTCTGCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCTCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGGTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAGAGAAATGCCCCCGCTGATCTCAGGGA
  5   1   2       bld In66 5g                         IMAGE:8966243.5p                                                        AGTTCTTGCAGCTTTGGACACAGCAGCTTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGACACACAGGGATCTAGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGCGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGGTTCCAGAGCTACGACTGCGTCTGACATGACATCCACGGATGTTCATCGAGGGGATGACGGGAAATGCTGTGGACTTCTGACGAGACTGCACTTAGAGAATGCCTCGCTGATCCTCAGAGCAAATTCTCCTGCCAACTTAAAAAGCCCCG
  5   1   2       add In66 5g                         IMAGE:8965358.5p                                                            TTCTTGCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGACACACAGGGATCTAGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGCGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACTCAAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGGTCCGCGGCTCCTCGCTGACGACCTCTGCCTGTACGTACGGCGGGGGGACATCGCCCAGATGCTGAGTCAATGGGCACTCGGTTCAGAGCTACGACTGCGTCTGACATGGACATCACGGATGTTCATCGAGGGGGACGGACGGGGAAATGCTGTTGGACTTCGACGAGACTGGCACTAGAGATGCCCCGCTGATCTCAGGGAGCAGAATTCTCTCTGGCACCCTAAAAGT
  5   1   2       bld In66 5g                         IMAGE:8966661.5p                                                            CTTGCAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCATGGGCGCCCGGTCAGAGCTACGAACTGCGTCTGACATGACATCACGATGTTCATCGAGGGACAGACGGGGAATGCTGTGACTTTCTGACGAACTGCACTTAGAGAATGCCCCCGCTGATTCAGAGCGATTCCTGCACTAAAGCCCGATGTATACGACAGATGAAGTATCTAACACAACTATGAATGTGAAGCAGTCTCATGGACTGATCTTGTCATCTAAGGATGCCATGCATACTAACGCGAGA
  5   1   2       bld Te5  FL   in                        CAAO11185.5p                                                                CAGCTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCAGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCGCCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTT
  5   1   2       bld In54 5g                         IMAGE:8945592.5p                                                                   CTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCAGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGCGGGGACATCGCCCAGATGCTGAGTTCAATGGGCGCCCGTTCAGAGCTACGACTGCGTCTGACTGACATCACGATGTTTCATCGAGGGGACAGACGGAATTGCTGTGACTTCTGACCGAGACTGCACTAGAGATTGCCCGCTGATTCAGGAGCAGAATTCCTCTCGCCAACTTAGA
  5   1   2       bld In60 5g                         IMAGE:8947639.5p                                                                     CTTGGACACAGCAGCTGCTCCCCCCGCACAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGACACACAGGGATCTAGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGCGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCAGAGCTACGAACTGCCGTCTGACATGGACATCACGATGTTTCATCGAGGGGACAGACGGAAATGCTGGTGACTTCTGACGAGACTGCGACTAGAGAATGGCCCCGGCTGAATCTCAGAGCAGATCTCTTGGCGACCTTAAAAAAG
  5   1   2   20  bld Thy1 5g                              CBST709.fwd ...........................................................................GGGCATTTCTGCTCCTCAGCAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCGCCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAA
  5   1   2       bld In63 5g                         IMAGE:8961023.5p                                                                                                                 TGGGAAAGATCCCAAGTCAAGTTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGTAACAGTGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCTCAGATGCTGAGTTCAATGGGCGCCCGGTTCAGAGCTACGACTGCCGTCTGACTTGACATCACGATGTTTCATCGAGGGGGACAGACGGGAAATGCTGTGACTTTCTGACGAGACTGCACTTAGAAAATGGCTCCGCTGATCTCAGGAGCCAAATTCTCTGCAACTAAGCCCGATTCATACGACAGATGCAGTAATCTTAAACACACTATGTGATTGTGGTGAAGGACTAA
  5   1   2   10  bld Int1 5g3  in                         CAAP7561.5p ........................................................................................................................................AGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCGGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCTCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTG
  5   1   2       bld In60 5g                         IMAGE:8947900.5p                                                                                                                                         GTATTTTTTTTTGGAGGGAACTAAAAGATTTCGAATTCGTCCCCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGCGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGACAGGACGGGGAAATGCTGTTGGACTTTCTGACCGAGACTGCGACTTTAGAGAATGCCCCGCTGATCTCAGAGCAGATCTCTGCGACTAAAAGCCCGATGTAGTACGACAGGATGGAGTGATCTTACACACTATGTGATGTGTGGAAGGGATAGTCATCCAGTGGGAACTGATCTTGTACACTAATGATGCAATGGCTACTAGCACGCAGTACTCTGATTCACGTCATCATTGGGCGTCTTAGGCATAGCCTTACAACGGTGGGGATGGATAT
  5   1   2       bld In60 5g                         IMAGE:8948528.5p                                                                                                                                                       TTTATTAAACACAAAGAAATACAATAGAAATCGTATTCGTCCCGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCGCCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGACGGGGAAATGCTGTTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAATGCCCCCGCTGATCTCAAGAGCAGATTCTCTGCACCTAAAAGCCCGATGTAGTACGACAGGGATGGGCAGTGATCTTTTACAACAACTAATGTGATTGGGGTGTAGAGGATAGTTCACTCATGGTGGAACAATGAATTCCTTTGGCTCTTAACTCACCTTAG
  5   1   2       chi Tad5 PIPE                            XZT69340.5p                                                                                                                                                                    GTTCCGTGTTGGATGGAGACGAGCCCAGGAATATCCTGCAGTGAGGCATTTCTGCTCCTCAGCAATGAGAGAATCCGGCTGAGGGGGGAAGATCCCAGTCAGTGAGAGAAGCTGCTGAGCAGGAGAAACACACAGGGATCTGGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCGCCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTANAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACACAACCTTAGTGTGATTGTGGTGG
  5   1   2       bld In54                            IMAGE:8840955.5p                                                                                                                                                                                                          AGAATTTAATATAAGGATTACATCTTATTAAGAATTCGTCCCGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGTATAGGGAAGGACAAGTCGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGCGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAAGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGATGGGAAGGTGATTCTTTACACAACCTTATGTGAATTGTGGTGGAAGAAGGGAATTAGTCATCTCATGGTGGGGACATGAATTCCTTTGTCTACTTACTAAAAGTGATTGCACATATGCCAGGTAATCCCATAGCAATACTTCGACTCGAT
  5   1   2       chi Int1      in                        CAAP13978.5p                                                                                                                                                                                                                                                                                                        AGTGAGAGAAGCTGCTGAGCAGGAGACACACAGGGATCTAGGCAGCAGCTACACACAGAGAAATGGACTCCGGCCTGAGGTCCCTGCTCTCCGACCACAGCAGATACGTGGAATCCTTCCGGCTGTTCCTGCTCAACTCCACCGAGCACCAGTGCATGCAGCGCTTTATCGACACCCAGTTTCCCCACATCGTCTCCAGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTANAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCAT
  5   1   2       bld In62                            IMAGE:8957212.5p                                                                                                                                                                                                                                                                                                                                GTCCTTCCCCAGTATAGGGAAGGACAACGTTTGGTGATTGATATCCTGGGCATTGGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGCGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCATATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGTGATCTTTACACACTTAGTGTGATGTGGTGAGAGGGATAGTCATCTCATGTGGGACATGAAATCTTTGCTAACTACTAGATGATGCACTAATGCAGTAACCATAGCACAGCAGCAGTACTTCTGATGAGTCTAAGGCAG
  5   1   2       bld In62                            IMAGE:8953094.5p                                                                                                                                                                                                                                                                                                                                              ACCCACCGACCGTAGAGGATCCCCTCGCCTCGTTTCGTCCCGAAGTGGATCAGGTGAGATCGACCTGCAGATGATTGGCAAGATCCAGTCTCGACACCCAGGGGTCGCCATTAGCAACCAGATTGTGGAACCAAGCGCTGAGCAAATCATTGGCTACAAGGAGCGCGTGGCTAAGGCCCCCAACCTGGGCGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCTCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGATGGGAACGTGATCTTTACACAACCTTAGTGTGATTGTGGTGGAGAAGGGATTAGTTCATCTCATGTGGGGACATGAAAATCTTTGTCTACCTACATAAGTGATTGCACTAGTGCAGTAACCATAGCACAGCAGCAGTACTTCTGATGAGTCTACGCAGTTCAATTACTACATGGGGGCTGTTCTTTCTAAGGAGTGAAGGCCCTTAGTCC
  5   1   2       bld Brn4      in                          CAAL428.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCGGTCTCCTTCTCGTGGCACCGCCAGACCTCCAGCGAGTATGAGCGCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCGCCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGG
  5   1   2       bld Tad0      in                       IMAGE:6981666                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGGATCAGCGAGTATGAGCTCCAAGTCAATGAGGAGAAACAGATGAGAAGTTATGATTTCATTCACATGATCCAGATGTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAAGGTCAGCTAGAGG
  5   1   2       bld Tad0      in                     NISC_no08c06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTATATTATGTAAAGGATGTTCCAGCAACATTACGGTTCTTTAAAAGCTGCCTGGCACCCAATGGGAAGCTCTTGATCATTCTCGTATCAGGTAACAGTGGGTGGTCCATGCTATGGAAGAAACACGGCCCGCGGCTCCCGCTGAACGACCTCTGCCTGTACGTTACGGCGGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCT
  3   1   2       bld Tad0      in                       IMAGE:6981666                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              NCGGGGACATCGCCCAGATGCTGAGTTCAATGGGCACCCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTATCCCTTG
  5   1   2       bld Brn3      in                        CAAK10049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGANATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCACTTCCATAATTACTTACCGA
  5   1   2       bld Brn3      in                         CAAK1869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGTTCCAGAGCTACGAACTGCCGTCTGACATGGACATCACGGAATGTTTCATCGAGGGGGACAGGAACGGGGAAATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGACGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCTATAATTACTTACCGA
  3   1   2       bld Brn4 5g3  in                        CAAL11247.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGCTGTTGGACTTTCTGACCGAGACCTGCGACTTAAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCATAC
  5   1   2       bld Tad5      in                         XZT18548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTCTGACCGAGACCTGCGACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGA
  3   1   2      seed Int1 5g3  in                         CAAP7561.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTTAAGAGAAATGCCCCCGCTGATCTCAGGGAGCAGATTCTCTGCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCC
  3   1   2       bld Int1      in                        CAAP13978.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGACCTAAAAAGCCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCATACT
  3   1   2       bld Brn3      in                        CAAK10049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCATAC
  3   1   2       bld Brn3      in                         CAAK1869.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGACGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCTATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCATAC
  3   1   2       bld Met5 5g3  in                          CACX814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCAT
  3   1   2       bld Tad5      in                         XZT18548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGATGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCAT
  3   1   2       bld Te5  FL   in                        CAAO11185.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTAAAAAGCCCCGAGTGTAGTACGACCAGGGACGGGAAGGTGATCTTTAACAACAACCTTAGTGTGATTGTGGTGGAGAGGGATTAGTTCATCTCATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTCTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTCTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTCTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGTGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCTATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCAT
  3   1   2       bld Brn4      in                          CAAL428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGTGGGGAACATGAAATCCTTTGTCTAACTACATAGAGTGATTGCACTAGTGCAGTAACCCATAGCAACCAGCCAGCAGTTACTTTTGATGAGTCTACAGCAGTTCATTTACACATTGGGGGGCTGGTCCTTCTAGAGGGACTGAGGGCCTTAGTCAGAAGCCTGGTTGGGGGGATAGTTGAGTAGATTACATGTTTGCCCTCATAGATACTTCTGGAAGCCCACTTTGAAGGTCAAGCTAGAGTGAGAGTTGGGATAAACACTGATTATCTCTACCATAGAATTCTGTAAGGGGAGGGTCCTGATCAAATGTTTTTCAAATGGGGGCTTGTACCAAAAAATAGTCAGAAGATCACTGGTTTCCAGCAAGCTAGAGAACAGATTAATCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGACTAATCCCTTGAGATGGGGATGATCTAGAACCCTCTAGAAACTCTATGAAGGTTGTTCACCCCTGAAATAGACAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTACCCCCCCTTGGATTTGTCTTTACAGTGCCCTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTACCGACCCCACAGCCAAGGTTCCTTACTGAGCTAATAAACACCGGATCTCCATTCTTTG
  3   1   2       bld Tad0      in                     NISC_no08c06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACCAGATTATTCCCTTGAGATGGTGCAAGATAGATAGTATATAGGCAGCTTAATCCCTGGAGATGGTGATGATCTAGACCCCTTTAGAAACTTTATGAAGGTTGTTCCCCCCTGAAATAGCCAATGAAAGCTAATTCGTGATTGGTTGCTGTGGGTTTTGTGACTAATGTCCCCCCCCTTGGATTTGTTTTTACAGTGCCTTAATCCTACATAGACCGCATTCCCCCACTTCCATAATTACTTCCCGCCCCCCCACCCAAGGTTCCTTATTGAGTTAATAACCCCCGGTTCTCCATCCAAAACCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)