Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 492.0    0Xt7.1-CAAR12826.3                          93 PI      76        308     1141                MGC82018 protein [Xenopus laevis]
     2 381.0    0Xt7.1-CABG11945.3.5                        63 PI      77        354      967                Unknown (protein for MGC:107743) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012077267 Xt7.1-TGas128b22.3 - 42 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas128b22.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCGCCTTGTATCTACTGCAGCCTCAAACTTGCTTCTCCCCATTTCGTGTGATCATTGGCCTCAGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTCCCCAGCTCTGCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTACAGAAATGCCTGCAGTTACATCATTCTATACGTGTCACTGATTGGTCTGTGCAGACAGCGGCGGAGCAGTGTCTGTAGCAGGGAGGATCCTGTGACTGTGGGTGAGTGTGAATGGTGAGCTAGTGTGACAGTAACACCGTGTCAGGGCTATCCTGCGTGCCACCCTCCAGCTGCTGAACTACAACATCCAGCACCCGCAACAGTCACAATGTGCTGGCAGTGCCCCCTGCTAGATGCCACAGGTTTATATATAGAGCGAACACAGTTGAAAACTATTATTGTATTTTCATTATTTCGTTTTTTTCTGCTTTCCCTGATAACATTCCTTAGTTAGTGGGCTATACCTACTAAGCAGGAATGCCAGCATTGCAAACCACATATGCCTAGAAAACTGCAGCCCTATATGGGCTGGGCATTGCCTGGTGTTAGTGTTTCTCCAGGCGATGGCAATACAGCACATACCCAGTTATTACAGCTGACTTCACTTTCATAGACTTGGCACTTGCATTATCACCTTTCATGCCAGGAGTCCATGCTTCTTTTCAGTAGGCCTTGTAATGATTTCCATGTTTACATAACCCAAACATTCTCTCAGCTTTGCTGTATCTATGTTACCTGTTGCTTAGAGTTCAGTTTATGTAGACA
                                                  Xt7.1-CHK-1008226551                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGTATCTACTGCAGCCTCAAACTTGCTTCTCCCCATTTCGTGTGATCATTGGCCTCAGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTCCCCAGCTCTGCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTACAGAAATGCCTGCAGTTACATCATTCTATACGTGTCACTGATTGGTCTGTGCAGACAGCGGCGGAGCAGTGTCTGTAGCAGGGAGGATCCTGTGACTGTGGGTGAGTGTGAATGGTGAGCTAGTGTGACAGTAACACCGTGTCAGGGCTATCCTGCGTGCCACCCTCCAGCTGCTGAACTACAACATCCAGCACCCGCAACAGTCACAATGTGCTGGCAGTGCCCCCTGCTAGATGCCACAGGTTTATATATAGAGCGAACACAGTTGAAAACTATTATTGTATTTTCATTATTTCGTTTTTTTCTGCTTTCCCTGATAACATTCCTTAGTTAGTGGGCTATACCTACTAAGCAGGAATGCCAGCATTGCAAACCACATATGCCTAGAAAACTGCAGCCCTATATGGGCTGGGCATTGCCTGGTGTTAGTGTTTCTCCAGGCGATGGCAATACAGCACATACCCAGTTATTACAGCTGACTTCACTTTCATAGACTTGGCACTTGCATTATCACCTTTCATGCCAGGAGTCCATGCTTCTTTTCAGTAGGCCTTGTAATGATTTCCATGTTTACATAACCCAAACATTCTTTCAGCTTTGCTGTATCTATGTTACCTGTTGCTTAGAGTTCAGTTTATGTAGACACAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     5     6     5     6     6     7     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8    10     8    10    10    11    10    11    10    11    10    11    10    11    10    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    12    11    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    11    12    11    12    11    12    11    12    11    12    11    12    10    12    10    12    10    11    10    11    10    11    10    11    10    11    10    11     9    10     8     9     9    10     9    10     8     9     8     9     7     8     8     9     8     9     6     8     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     8     4     6     4     7     5     8     5     6     5     6     7     7     6     6     7     7     7     7     7     7     7     8     9     9     9    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11    10    11    10    11    10    11    11    14    11    14    11    14    11    13    11    14    12    15    12    15    12    15    12    15    12    15    15    16    15    16    17    18    15    17    14    14    14    14    14    14    14    14    14    14    14    14    14    15    14    15    14    15    15    15    16    16    14    15    13    14    13    14    13    14    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    15    15    15    16    16    16    16    16    16    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    13    14    14    14    14    14    14    14    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2
                                               BLH ATG     257    1424                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     257     242                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     257     984                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     257      77                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Br ---- 9e-023     AAM92833.1 protein kinase C [Branchiostoma lanceolatum] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bb ---- 9e-023     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 5e-023     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Bf ---- 8e-032     AAM18889.1 unknown [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 2e-040     BAE06544.1 mitogen-activated protein kinase kinase [Ciona intestinalis] --------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 4e-076     NP_011970.1 Kinase that interacts with Cdc31p; N-rich kinase 1; Kic1p [Saccharomycescerevisiae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---= 2e-121     NP_001024141.1 Germinal Center Kinase family member (gck-1) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ==== 3e-132     NP_650596.1 CG5169-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 6e-137     XP_796319.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 5e-156     AAH89072.1 Unknown (protein for MGC:107743) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Gg ==== 7e-169     NP_001026288.1 similar to serine/threonine protein kinase MASK; STE20-like kinase MST4 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 1e-178     NP_998642.1 zgc:66137 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 0          NP_663440.1 serine/threonine protein kinase 24 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 0          NP_001027467.2 serine/threonine kinase 24 (STE20 homolog, yeast) isoform b [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          AAH73258.1 MGC80614 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === ?? ==== 0          NP_001085728.1 MGC80614 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas128b22.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------TGA---ATG---------------------------------------------------------------------------------ATG------------TGATGA------------------ATG------------------ATG------------------------TAA---TAG---------------ATGTAA------------------------------------ATG---------TGA------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------ATG---------TAA---------------------------------------------------TGA------------------------------TGA---------------------------------------------------------------------------------------ATG---ATG---TAA---------------------------------TAG------------------------TAA------------------------------TGA---------------------------------------------------ATG---------------------------------------------------------------------ATG------TAA------TAA---------ATG------------------------------TAG---------TGA---------------------------ATG------------------------------TGA---------------------------------------------------TGA------------------------------TGA---TAA------------------------------------------------------------------------------------------------TAGATG---------------TAG------------TGA---------------------------------------------TGATAA---------------------------------------------------------------------------------------------------------------------------ATG------------------------------TGA------------------------------------------------------------------------------ATG------ATG------TAA------------------------------ATG------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   1           TbA  FL                     TTbA056n06.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAACCGTGGTGACATCGCCTTGTATCTACTGCAGCCTCAAACTTGCTTCTCCCCATTTCGTGTGATCATTGGCCTCAGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTCCCCAGCTCTGCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTACAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld AbdN 5x                            IMAGE:7024471                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGAGAGGAACCGTGGTGACATCGCCTTGTATCTACTGCAGCCTCAAACTTGCTTCTCCCCATTTCGTGTGATCATTGGCCTCAGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTCCCCAGCTCTGCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAAATTGACAATAGGAACTCAGAAAAGTTGTTGCCCATAAAATTTATAGATCTGGGAAGAAGGCAGAAGATGAAATTAGAGGATATTCCGGCAAGAAAAATACTGTGGCTTAATTCAATGGTGAATAGCCCCCCTACGTTGAACCCAAATATTTAATGGGCCTCCTTTATTCTTTTAAGGGACCACCAAAAATTTTTTGGGGAATCACTTTTTGGGGGGAATAACCCCTTTTGGGAAGGGAAAGGGCCTTCCTGGCCTCCCTGGGGGATTTCTCTATATTTAAGAAAAACCCCTGGGGGGGCCCCCCTTTTTTTAGGAAGTGGGAAACAACCCCCCCAAGAGTATTGTGGCCAAACCCCACTTTATTCTTAAACGGGGGAGAAAAAATATCTCTTTCAAAAGAGGGGAGAATCTTTGGGACACATAACACTTTTGTGTCCTTTCTTTCTGGGGAGAAAAGAATGAAAAATATTTTCTCCCGGGGGGGGGTGTTTATTTTTAAAAAGAAGCTGGGCCCCCAAAAGGGGGGGGGCGCGCGTTTATAACCTCCGAGAACACACACGCGGGTGGGGAGGAGTGAGTAAAATATATATCTCCTTCACACACTTTTGTGTTGTGTGTGTCTCTCCGCAGGGAGGCAAACAATCTTATTACGTTGGGAGCCACACACTATGTGTATTCTTAATAAAAGGGAGCAACCCCCTCCTTTGTTTGTTTGGAAG
  5   1   2       bld TbA  FL   in                   TTbA056n06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACCGTGGTGACATCGCCTTGTATCTACTGCAGCCTCAAACTTGCTTCTCCCCATTTCGTGTGATCATTGGCCTCAGCCGCCGCCGGAAATCCTCCTCTCCAGCACAATAATAAAGCCAATCTCTTCCTGCTCCCCAGCTCTGCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGNGAGGTGAAATTAGCTGACTTTGGGTGTGCANNGACACTTACTGACACACAGAT
  5   1   2       bld TbA  5g3  in                   TTbA048n14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCATTTGGGCCCCTCCAGCCCCGCCCCGCCCGGGAAAATTCCTTCCCTCCTCCCAGCCACCAATGAATGAAAGCCCAATTCTCTTTCCTTCTTCCCCAGCTCTGCCCCCGGGTGGCTCCTCCTCCTTCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACCACCTCCTCGGTATCCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACCATCAGTATGAATCCCTCCCCCGGTGCACCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAAGAACTGTTCCGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAA
  5   1   2   10  bld Eye  5g3  in                         CCAX4867.b1 .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AATAATAAAGCCAATCTCTTCCTGCTCCCCAGCTCTGCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCA
  5   1   2   10  bld Te1  5g3  in                        CBWN10307.b1 .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTGGAGCTCTGCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAA
  5   1   2   12  bld Gas7 PIPE in                         XZG19419.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCCCCGGCTGCTCCTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTC
  5   1   2   14  bld Te4  5g3  in                         CAAN2846.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCCTCCTCCTGGGCCCGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTTGTCCTTATACC
  5   1   2   10  bld Te1  5g3  in                         CBWN6801.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACTCGTAGGCAGAGGGAAGCCCGGGGGACCGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAG
  5   1   2   24  bld Te3  5g                             CAAM14170.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGGGGGACGGGGAACACTCCTCGGTATCGCAGTGGATGTAAGGGCCGGGGTTGTGCTGCCGGCACATCAGTATGAGTCACTCCCCGGTGCAGCCCGGCCTGCCTGGGATACAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGANAGTCTTGTTCCTTATACCCAAGAATCATCCTCCCACACT
  5   1   2       bld Te4       out                        CAAN2927.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTTGTAATTTTTGTTTTGCAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTNTAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCCTACTTACAGAGCTCATAGACNGATACCAGAGAT
  5   1   2       bld Tbd1      in                         CBXT4034.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGTCTTAAAGCTGATCCAGAGGAACTGTTCAGAAAACTAGAGAAAATAGGCAAAGGCTCATTTGGAGAAGTCTTTAAAGGAATTGACAATAGGACTCAGAAAGTTGTTGCCATAAAAATTATAGATCTGGAAGAAGCAGAAGATGAAATAGAGGATATTCAGCAAGAAATAACTGTGCTTAGTCAATGTGATAGCCCCTACGTGACCAAGTATTATGGCTCTTATCTTAAGGACACAAAATTATGGATCATTATGGAATACCTTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGA
  5   1   0       add Tad5      in                         XZT25971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTCACATAAAGCCTAAAATTGTTGGGGGTCAAATGTAGCTTCTGAACTGCCTGATAGCTATGTGGTAGCTGAGCTTCAAGGGAAGCGGCTAGGATTCCTTATTGTGAACTCTGCAATCAGCTTGCATTTAATGTCCTCTTTAAAGTAGAGACTTCTCTTGGCAGCTATGTGCAGCACCTACATTCAAATTAATACCGGGAGGATTCATGACTTGCACACATTATGCCATAAAGTAACTTTGTGTCCCTTTTGGAGTCAATACACATTGCTATATATTGATGTAGATGCAGTGGTAACTCCTACAGGTTGATCTGTTTTATGATATATCAACACTTTTTTCTGGCCGATAACATTATACTGATTGGTAAAATGTATTGACAGTTAGCGTGCTGGCCTGTCAGTTAAAAATGTGTATAATGATTTGTAAAGTAAAAGCACAGAAAGTGGTCTCTTGGACTGAAGGTTAAAGAAAACCTAAATCTAAAGTAAACAGCTTGACCTTCTTACTGAAGATATGGACTCCCACATAGAGATCATGGGGTTTCTGCTAAATGACAAATACTTGGGAGTGGCCGGCTCATAAAACTAGCTGATATCTTTTGTTATACATAACTTATTGCTTGAACCTGTTCTAAATGGAAATATATGAACAATTTTTTTAACCTCTGCCAGAGACCCTCAGCTAAGGAACTGCTGANACACAAGTTTATTATGCGAAGTGCAAAG
  5   1   2       bld Liv1      in                         CAAR1975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGGAGGAGGCTCTGCTCTGGATCTATTAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAAAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCCAGAACAAT
  5   1   2       bld Egg                            TEgg111e07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGAACCTGGTCCTTTAGATGAAACACAGATTGCAACCATTTTACGGGAAATCTTAGAGGGACTTGACTACTTGCATTCAGAGAAGAAAATTCACAGGGATATTAAAGCTGCCAATGTGCTGTTATCTGAACACGGGGAGGTGAAATTAGCTGACTTTGGTGTTGCAGGACAACTTACTGACACACAGATCAAAAGGAACACCTTTGTTGGAACTCCATTCTGGATGGCACCAGAAGTTATAAAGCAGTCTGCATATGATTCCAAGGCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCTTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTT
  5   1   2       bld Gas7      in                         XZG16006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGATATCTGGTCCCTGGGCATAACTGCTATTGAACTGGCAAAAGGAGAGCCTCCTCACTCAGAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTTTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATATCCCTATCGTACTTGCCTCTGCTCATGGATATCAC
  3   1   2       bld Te4  5g3  in                         CAAN2846.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCTACATCCCATGAAAGTCTTGTTCCTTATACCCAAGAACAATCCTCCCACACTGGAAGGGAACTACAGCAAGGGTCTGAAGGAGTTTGTAGAAGCCTGCTTAAACAAGGAGCCCAGTTTTAGACCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAAGGTAAAAAC
  3   1   2       bld Eye  5g3  in                         CCAX4867.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTCAGCTAAGGAACTGCTGAAACACAAGTTTATTATGCGAAGTGCAAAGGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGT
  3   1   2       bld Liv1      in                         CAAR1975.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGAAGTGCAAAGAAAACCTCCTACTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAG
  3   1   2       bld Te1  5g3  in                        CBWN10307.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTAACAGAGCTCATAGACAGATACAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT4034.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGAGATGGAAGATAGAACAGGGCCATGAAGCCTCCAGCTCAGACTCTGAGGAGGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG24897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACGCGTCCGAAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAAGGTAAAAAAT
  5   1   2       bld Gas7      in                         XZG24897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAAGTAGATCAAGCTGCTGGCAGCGAGAAGGATTATTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAAATANAAAAAAAAAAAAAAAAAAAAAGG
  5   1   2       bld In66                            IMAGE:8962559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCGGGCCGCGAGAAGGATTATTTGGAACTTCACAAGAAGAAAGAGAGACTTGAAGAACTTGGAGCCCATTCCTGCACAGCCAGAAGAGGTTAAAGACATTCCCAAACGGCCATTGTCTCAGTGCTTATCTACAATTATGTCTCCTTTATTTGCAGAGCTGAAGGAGAAGAGTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCTCAGCTTTCTTCTCAAGCGGCTGTCAGCTCCCAGCATGCCCAGCAGTTGAAGGGTATGATACTGGGTATGCAATCACAGCAGCTGAGGACGTGGGCTGACTTCCAGCTTTACAGTTGACTTATTTAACTAAGGAGTTTGGCAACT
  5   1   2       bld Tad5      in                         XZT60776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCTGAAGGAGAAGATTCAAGCGTGTGGCGGGAACGTAGGCTCAATAGAGGAACTGAGAGAGGCAATTTATTTAGCTGAAGAGGCCTGTCCGGGTATCTCGGACTCCATGGTATCACAGCTTCTTATTAGGCTTCAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTAT
  5   1   2       bld Ova1      in                         CABE5573.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAGGTATTCCGTTAATGGAGTGGACTCTTCCTCGCACTGAAGAATGTTTTCCTCCTTTTTAAGGCAAAAATGGACCTTGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCT
  5   1   2       bld Gas       in                   TGas128b22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAG
  5   1   2       bld Thy1      in                        CBST3952.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAAA
  3   1   2      seed Gas       in                    TGas128b22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTATTATCCCTATCGTACTTGCCTCTGCTCATGGATATCACAGGACATGGACATTCNTGAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATAC
  3   1   2       bld Ova1      in                         CABE5573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGACATGGACATTCCTGAATGATGAGTGACTAAACATAGGAAATGGGAAAGCTATAGTTTTATGATTTTCTTTTCCTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTAC
  3   1   2       bld Egg                             TEgg055p13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATGATGAGTGACTAAACATAGGGAAATGGTGAAAGCTATAGTTTTTATGATTTTCTTTTCCTTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATTTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACTTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTGTTCAGAACACACGCAGTGGCATTTAGATATTTCTTCAGTACATTTATCGATACATATAATTTGTATATACTTTAAAAGACAGGAGGATCGGTAATGTCACAAAGGAGTTTTAATGTTTTTAATTTATACATACGTTTCAAATATGTAAGGCACAGCCTCATCAATCGTATAGGTTATGAGAATATTATATACCCTACA
  3   1   2       bld Tad5      in                         XZT25971.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCTTTTCCTTTTTTTTTTCTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGT
  3   1   2       bld Tad5      in                         XZT60776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAATCATAGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGT
  3   1   2       bld Thy1      in                        CBST3952.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTACGAATATATAAAAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTAC
  3   1   2       bld Te1  5g3  in                         CBWN6801.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATGTAAAAACAAAAAACTCTGCAAAGTACTGTGATAAGGCAAATGAAGATATTGTGAAACCTCAGGTATCTTGCTTTAAGCAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCAATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTACAGAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 PIPE in                         XZG19419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTCAGTTCTGCTGGAGATGGAATGAAAGCTCTGTGCATTCTTGTACAATAAATTACTCCATCAGATGCCTCAGCCTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTCCCG
  3   1   2       bld Gas7      in                         XZG16006.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATAAATTACTCCATCAGATGCCTCAGCTTTCCTTCCTCAAGCGGCTGTCAGCTCCCAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGACTATTTACTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTAAAAAAAAT
  3   1   2       bld TbA  5g3  in                    TTbA048n14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCATGCCCCAGCAGTTGAAGGGTATGAATACTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGGTGACATCCCAGCTTTACAGTTGACTATTTATTAGAGTTTGCCAACCTACAAAATGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCCCCCCCGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATTTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTTTTCAGAACACACGCAGTGGCATTTAGATATGTTTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCCCAATGGAGTTTTAATGTTTTTAATTTATAGATATGTTTGAAATATGTAAGGCCCAGCCTCATCCCTAGGATAAGTTATGGGAATATTATAACCCTATACGTTCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  FL   in                    TTbA056n06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATGCCCCAGCAGTTGAAGGGTATGAATATTGGGTAATGCAAATCACAGCAGCTGGAGGGACGTGGGCTGACATCCCAGCTTTACAGTTGATTATTTATTAGAGTTTGCCAACCTACAAACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTTTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATAC
  5   1   2       bld Gas7      in                         XZG54338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTGACCCAGGGCATCCCTAGTTGCAAGAGGGGAATGGAGCCACACACGCTTTGTGTATGGATTTCATGTTTGGCAGCCATACTTATGTTTTATGTTCATGGTTTAAGTCAAGCGCCAAGTGAGTTTTGTTACCTACATATAGAAGCCCCTTTGGACATCTGTTAGATAAAACCAGTTTAATGTTTTGTCAGAATACATATGACATTGTACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTACAGAAATGCCTGCAGTTACATCATTCTATACGTGTCACTGATTGGTCTGTGCAGACAGCGGCGGAGCAGTGTCTGTAGCAGGGAGGATCCTGTGACTGTGGGTGAGTGTGAATGGTGAGCTAGTGTGACAGTAACACCGTGTCAGGGCTATCCTGCGTGCCACCCTCCAGCTGCTGAACTACAACATCCAGCACCCGCAACAGTCACAATGTGCTGGCAGTGCCCCCTGCTAGATGCCACAGGTTTATATATAGAGCGAACACAGTTGAAAACTATTATTGTATTTTCATTATTTCGTTTTTTTCTGCTTTCCCTGATAACATTCCTTAGTTAGTGNGCTATACCTACTAAGCAGGAATGCCAGCATTGCAAACCACATATGCCT
  5   1   2       bld Tad5      in                         XZT21556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGTATTGCTATTTTCTTCAGAACACACGCAGTGGCATTTAGATATGTCTTCAGTACATTTATCGATACATATTATTTGTATATACTTTAAAAGACAGAGGATCGGTACTGTCACAATGGAGTTTTAATGTTTTTAATTTATAGATATGTCTGAAATATGTAAGGCACAGCCTCATCACTAGGATAAGTTATGAGAATATTATAACCCTATACGTACAGAAATGCCTGCAGTTACATCATTCTATACGTGTCACTGATTGGTCTGTGCAGACAGCGGCGGAGCAGTGTCTGTAGCAGGGAGGATCCTGTGACTGTGGGTGAGTGTGAATGGTGAGCTAGTGTGACAGTAACACCGTGTCAGGGCTATCCTGCGTGCCACCCTCCAGCTGCTGAACTACAACATCCAGCACCCGCAACAGTCACAATGTGCTGGCAGTGCCCCCTGCTAGATGCCACAGGTTTATATATAGAGCGAACACAGTTGAAAACTATTATTGTATTTTCATTATTTCGTTTTTTTCTGCTTTCCCTGATAACATTCCTTAGTTAGTGGGCTATACCTACTAAGCAGGAATGCCAGCATTGCAAACCACATATGCCTAGAAAACTGCAGCCCTATATGGGCTGGGCATTGCCTGGTGTTAGTGTTTCTCCAGGCGATGGCAATACAGCACATACCCAGTTATTACAGCTGACTTCACTTTCATAGACTTGGCACTTGCATTATCACCTTTCATGCCAGGAGTCCATGCTTCTTTTCAGTAGGCCTTGTAATGATTTCCATGTTTACATAACCCCAACATTCTCTCAGCTTTGCTGTATCTATG
  3   1   2       bld Gas7      in                         XZG54338.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACCCTATACGTACAGAAATGCCTGCAGTTACATCATTCTATACGTGTCACTGATTGGTCTGTGCAGACAGCGGCGGAGCAGTGTCTGTAGCAGGGAGGATCCTGTGACTGTGGGTGAGTGTGAATGGTGAGCTAGTGTGACAGTAACACCGTGTCAGGGCTATCCTGCGTGCCACCCTCCAGCTGCTGAACTACAACATCCAGCACCCGCAACAGTCACAATGTGCTGGCAGTGCCCCCTGCTAGATGCCACAGGTTTATATATAGAGCGAACACAGTTGAAAACTATTATTGTATTTTCATTATTTCGTTTTTTTCTGCTTTCCCTGATAACATTCCTTAGTTAGTGGGCTATACCTACTAAGCAGGAATGCCAGCATTGCAAACCACATATGCCTAGAAAACTGCAGCCCTATATGGGCTGGGCATTGCCTGGTGTTAGTGTTTCTCCAGGCGATGGCAATACAGCACATACCCAGTTATTACAGCTGACTTCACTTTCATAGACTTGGCACTTGCATTATCACCTTTCATGCCAGGAGTCCATGCTTCTTTTCAGTAGGCCTTGTAATGATTTCCATGTTTACATAACCCAAACATTCTCTCAGCTTTGCTGTATCTATGTTACCTGTTGCTTAGAGTTCAGTTTATGTAGACACAAAAAGGGTTTTTGATGGGTCGG
  3   1   2       bld Tad5      in                         XZT21556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGTGCCACCCTCCAGCTGNTGAANTACAACATCCAGCACCCGCAACAGTCACAATGTGCTGGCAGTGCCCCCTGCTAGATGCCACAGGTTTATATATAGAGCGAACACAGTTGAAAACTATTATTGTATTTTCATTATTTCGTTTTTTTCTGCTTTCCCTGATAACATTCCTTAGTTAGTGGGCTATACCTACTAAGCAGGAATGCCAGCATTGCAAACCACATATGCCTAGAAAACTGCAGCCCTATATGGGCTGGGCATTGCCTGGTGTTAGTGTTTCTCCAGGCGATGGCAATACAGCACATACCCAGTTATTACAGCTGACTTCACTTTCATAGACTTGGCACTTGCATTATCACCTTTCATGCCAGGAGTCCATGCTTCTTTTCAGTAGGCCTTGTAATGATTTCCATGTTTACATAACCCAAACATTCTTTCAGCTTTGCTGTATCTATGTTACCTGTTGCTTAGAGTTCAGTTTATGTAGACACAAAAAGTGTTTTTGATGAGAAAATGGAACCTGTTCCCAGCAGGAAGTTGAAGAGGCTTTTCATTTAAGCATGATTGGTTGGCTATGTGCATACCAAAGAGAGAGGAGTTTTTAGCTTGGCTGCCCCCCCCCTCCAAGTAATTTAGTCACTGGAACAGAAATAAAATGATTTACTTCTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)