Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 79%

 1012077476 Xt7.1-TTbA019b12.5 - 43 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA019b12.5             ATGGCCGCTCTCGGGGAGCACTTCACGTTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTCTGGGGAAGAGGGACGTGCGGCTGCTTCAGCTCTGCCTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAG
                                                  Xt7.1-CHK-1008226468                   GCTCTCGGGGAGCACTTCACGTTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTCTGGGGAAGAGGGACGTGCGGCTGCTTCAGCTCTGCCTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTT
                                                      consensus depths                  2     2     3     3     5     5     7     7    10    10    10    10    12    12    12    12    12    12    12    12    12    13    12    13    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    14    14    14    14    14    15    13    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    15    16    16    16    16    16    15    16    15    16    16    16    16    16    16    16    16    16    14    16    14    15    15    16    15    16    13    15    13    15    13    15    13    15    13    14    13    13    11    12    11    13    11    13    11    13    11    13    11    13     8    12     8    11     9    11     9    11    10    12    10    12    10    12    10    12     9    11     8    10     8    10     7    10     7    10     8    10     7     9     7     8     6     7     6     7     6     7     6     7     7     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     7     8     8     8     9     9     7     8     7     8     7     8     6     8     7     8     8     9     7     9     7     9     7     7     7     7     7     7     6     6     6     6     5     5     5     6     5     6     5     6     6     7     6     7     6     7     6     7     7     8     8     9     8     9     8     9     8     9     8     9     9    10    11    11    11    11    12    12    11    12    13    14    13    14    13    14    15    16    14    16    14    16    14    16    14    16    14    16    14    16    14    16    15    17    15    17    14    18    15    18    14    16    14    16    14    16    15    16    12    16    15    16    15    16    15    16    15    16    13    16    15    16    15    16    15    16    15    16    12    16    15    16    15    16    15    17    14    16    12    15    15    18    15    18    15    18    15    18    15    18    14    18    14    18    14    17    14    17    15    17    15    17    15    17    14    17    12    17    14    17    13    17    14    17    14    17    13    17    14    17    13    16    12    15    11    14    11    13     9    12
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                               BLH ATG       0     222             
                                               BLH MPR       0     129             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 4e-011     XP_001197895.1 PREDICTED: similar to LOC432185 protein, partial [Strongylocentrotus purpuratus] --------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PREDICTED = Dr ==== 1e-140     NP_001025234.1 hypothetical protein LOC321700 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PROTEIN === Mm ==== 3e-158     NP_598463.1 RIKEN cDNA 1500002M01 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PREDICTED = Hs ==== 7e-162     NP_056277.2 DKFZP586L0724 protein [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PROTEIN === Gg ==== 4e-167     NP_001006210.1 similar to DKFZP586L0724 protein [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PREDICTED = ?? ==== 0          NP_001085113.1 hypothetical protein LOC432185 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PROTEIN === Xl ==== 0          Q6INI5 Nucleolar protein 11 [Xenopus laevis]  =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA019b12.5             ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGTGA------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       bld BrSp 5g                          EC2BBA31BA10.g1 GGGAGTGACAAGATGGCCGCTCTCAGGGAGCACTTCACGTTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCATATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCATTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTCGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGGGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTCACCAGTTCAGTCCAGTTTGTGTTTGTAAAATATCACCTGAAACCAA
  5   1   2       bld TbA  5g   ?                    TTbA059n05.p1kSP6             ATGGCCGCTCTCGGGGAGCACTTCACGTTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGANAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCG
  5   1   2       bld 1030                            IMAGE:7092974.5p                 GCGCTCTCGGGGAGCACTTCACGTTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAACTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGGTTTGTAATATCTCCTGAACCCAACACGGAATGTTCCCTATCCTGGACTGTTCGGGGCCATGAAAAATAAATATTCCCCTCCTAACTTTTACCTGGCGGCAGTTTGCCGGGTC
  5   1   2       bld Te4                                  CAAN5195.5p                          GGGAGCACTTCACGTTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGANAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGNGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGA
  5   1   2       bld Te5       in                         CAAO7301.5p                                ACTTCACGTTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGA
  5   1   2       bld Te4                                  CAAN1864.5p                                        TTGTGCGGACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCCT
  5   1   2       bld Ovi1      in                         CABI6365.5p                                               GACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGATCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTGTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTCACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCT
  5   1   2       bld Brn3      in                         CAAK7872.5p                                                    CTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGATCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTGTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTCACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTC
  5   1   2      seed TbA                            TTbA019b12.p1kSP6                                                        CCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGG
  5   1   2       bld TbA                            TTbA020b12.p1kSP6                                                        CCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCA
  5   1   2       bld Gas       out                  TGas124k02.p1cSP6                                                                            AACCGAGATCTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGC
  5   1   2       bld TbA                            TTbA059n07.p1kSP6                                                                             CCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACATGCCGTGACTCTGTATAAGGTCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACGAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTATAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCTCTCCATACACTCTTTACTCGCAGCCCCCCATCATGAAATTGAAAGCGTTCTGCCACTCTGAGAGAGGATTGTGAGGTCACACATCTTTGCGGATGAAGGGCAGCCCCTGATGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCACTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCAT
  5   1   2       bld In66                            IMAGE:8962353.5p                                                                                                                                     GTGATCAGGCCGGGACTTTTGTATAAGGGCTCTGATCAGAAGCCGCTCGGAGCCTGGGCAGTAAAACAAGGACAAAGCATCACCTGCCCGGCCGTATGGAATTACCAGTCTGGGGAATTTGTTGTTGTTCATGATGACAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAAAGAGGATTGTGTGGTCAGAAATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAACAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTTCCATTCCCAGTGGTCGTTCATTAATCAGAAAGCGAGAGGGTCGGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGTCGATAGAAGGGGAACCTGAAGTCTGATGGTTCCACGTACTGTGCTTGTGCATCTGCATCAACCGAAGACTGCCTTCCGTATGGAACCCCAATCACCTTGCGGCGTGGGATGATTCCAACAAGCCACTGGTGGCTTGACCGTATGCCATGCAGCTGCAGGCCTAACTTGAGTCCGCTGACCTGACTG
  5   1   2       chi Neu0      in                     NISC_ng23c05.y1                                                                                                                                                  TCTTCACGTTGTGCGTACTTCTTACCGCGGCCGAGCATCGTACAACCGAGATACTTGGAGTGGAAGCGGCAGGGGAGCCGGACAGGGTGTTGGTGACTGACTCTGTACAGGCCGTGACTCTGTATAAGGTTCTAAGAATATGGAGAGAAGATGATGTGAATTTGGATACAGCGTTTAAAGCCACGCTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTCACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCAT
  5   1   2       bld Tad5      in                         XZT43920.5p                                                                                                                                                                                                                                                                                                  AGAAGATGATGTGAATTTGGATACACGCGTTTAAAGCCACACTCTCGGCCGACGTCTGTCGAATCCACACTCTGCCTGGCGCTGACCCGCTCGTGCTGTTCAGAGGAGGAGCCGTCCACTCCATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTCACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCTCCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAA
  5   1   2       bld Gas7                                  XZG4580.5p                                                                                                                                                                                                                                                                                                                                                                                                                            ATAGACTCTTTACTCGCAGCCCCCCAGCAGGAAATTGAAAGCGTTCTGCCAGTCGGAGAGAGGATTGTGTGGTCAGAGATCTTTGCGGATGAAGGGCAGCCCCTGGTGGTCTACATTACAGAGCAGCTCTCCGATTATTTTGTGTACATTAACCAGTTCAGTCCAGTTTGTGTTTGTAAATATCACCTGAAACCAAACACGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGAGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAA
  5   1   2       bld Gas7      in                         XZG36706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGAAGGTTCCACTATCCTGGACTGTTCGGGGTCCATGAAAAGTAAAATATTCACCCTCCTAACCTTATACTCTTGCGGGCAAGTTTGCCAGGCTCCATTCCCAGTGTCGTCCATTAATCAGGAAAGCGAGAGGGTCGTTTCGGCATCACCCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTG
  5   1   2       bld TpA                            TTpA064m24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTAATAGGAAAGCGAGAGGGTGCGTTTCTTGCATCACCTCCTGTTGCAGCTGTCTGGCCCGATAGAAGGGGGAGCCCTGAAGTTCCATTGATGAGTCACCACGTATCTGTGCTTGTGCCTTCTGCGGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCATACGTTGGCGGCTGTGAGTGAGTTCTCCCATAATACGAGCGCACAGCTGTGGAGCTGTGTGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGACTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGATAGCCAAACCCCCCATAAAACTGAGCATGGACAGAAAAACTTATGGAAGTGCATGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACGGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAGTTCTACCCACAGAGTTCCCTTG
  5   1   2       bld Neu                            TNeu064c22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCGATTCGAATTCCCCGGGCTGAAGTTCCTTGATGAGTCCCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCT
  5   1   2       bld Ski1                                 CABJ7686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGTAGCTGTGCTTGTGCCATCTGCAGCCAAACAGAAAGACTGCCTCTCCGTATGGAACACCACATTTCAGACGTTGGCGGCTGTGAGTGAGTTCTCCCAGAAGACGAGCGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTCTGGGGAAGAGGGACGTGCGGCTGCTTCAGGTCTGCCTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAG
  5   1   2       bld In63                            IMAGE:8959118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAGTGAAGTTCTCCCAGAAGACGAGTTGCACAGCTGTGGTGCTGTGGCAGCCGCCTGTATGTGCCCCATGGCAAGGCCTTGCTAGCGGTCCCATATAGCTGTGAGGTCTCCTGCTTGGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCTTTTTTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTCTGGGGAAGAGGGACGTGCGGCTGCTTCAGGTCTGCCTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCTCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGACTGATAGAGAGAGTTTGCCTCAGACGGCCAAAGGCACTGCTCATGAGCATAGAAGAGCCGTGCTGGTACTCGTGCTATGCTCTACGCGAGAGTTCTTCCTGCCCACCTGAAGGAATCTGTCAGGGGAGACATG
  5   1   2       bld Tad5      in                         XZT11576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCATCTGTACTGGGAAAAAGCCGAAACCTCCAGCCTTCAGTTCTAGAAAAGATTCCTTTAGTAAATTGGGACACACTAGTAGGAAAGGATCCAGAAGCCAAACAGCCCAGAAAACAGAGCAAGGAGAGAAAAACAAATGGAAATGCAGGAAACAGCACAGAATGCACAGTGTACCCCTTGGATGTACAGAATATTCCCCAGTCACAGACTGAAGCCCTTGTGCAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTCTGGGGAAGAGGGACGTGCGGCTGCTTCAGCTCTGCCTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCA
  5   1   2       bld TpA                            TTpA073n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGCACAGTGTATTCCATGGATGTACAAAATATTCCCCACTCACACACTGAAACGCTTGTGCACTGACTCCTCCTGGGAAAGGGAGATACAGATTTCTTGGTGACTGTGGGCGAAATAACCCATAGTTCGGTGAGGCTCTGTATGGCTGATCCCAACTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCATACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTC
  5   1   2       bld Brn4      in                        CAAL22910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCGACTCCTCCTGGGAAAGGGAGATACAGATTTCCAGGTGACTGTGGGCAAAATAACCCAGAGTTTGGTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTCTGGGGAAGAGGGACGTGCGGCTGCTTCAGCTCTGCCTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGA
  5   1   2       chi Gas7      in                         XZG50802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGAGGCGCTGTATGGCTGATCCCAAGTTCTACCCACAGAGTTCCCTTGTGCAGCTTGTTCAGACCAACACCCTGTCCTACAGTCTGTGCCCGGAGTTGCTGCCACTCTGTCTGGGGAAGAGGGACGTGCGGCTGCTTCAGCTCTGCCTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAACTGCCCTGTAGCATTCCCTGGTGATCCTGCCCATAGCCATCCAATAGCGTGAGCCCTTTATCTCTCACATAGCCATCCAATAGCGTGAGCCCTTTATCTCTCACATAGCCATCCAATAGCGTGAGCCCTTTATCTCTCACATAGCCATCCAATAGTGTGAGCCCTTTATCCTGCCCATAGCCATCCAATAGCGTGAGCCCTTTATCTCTCACATAGCCATCCAATAGAGTGAGCCCTTTATCTCTCACATAGCCATCCAATAGTGTGAGGCTGTGCTCAGTTGGCCAGGGTTGCCGTGGGCGGNGACTGTAGCAGAGGCTGTGTCATTGCGCGTTGTACTTGTGCTTCCCTAACCAATCAAACAGAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGG
  3   1   2       bld Neu0                               IMAGE:6992181                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAACTGATAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGTATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTG
  5   1   2       bld Ovi1                                CABI11920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCCATTCCTTCCCTGATGTGCCGGAAGCCATTCTCTGCTCGTGCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGNTGGCCCCTCTGCAGCCCCCATGAACT
  3   1   2       bld Ovi1      in                         CABI6365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCTTAAGGCCTTCCTGAGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGT
  3   1   2       bld Gas  5x3  ?                     TGas124k04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGTCAGTGAGCAATGGATGAACGCTGCACAGATAGACTCGCACTCGGCCGCCGCTTATATTGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTGCATAACAAATAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8                                 st110k06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATGTGGGAGATCAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTNTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTNTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCC
  3   1   2       bld Gas7      in                         XZG36706.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGACTAAAGAGCCCAAACGTACGGAGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGTATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGAAAGAAAAAAAAG
  3   1   2       bld Thy1                                CBST8211.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAGCCAGAGGGGCCCCGCGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCNCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGTATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGT
  3   1   2       bld Brn4      in                        CAAL22910.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTGGTACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGT
  3   1   2       bld Tad5      in                         XZT43920.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGAATGGCTTCAGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGTATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTTTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGT
  5  -1   2       bld Neu                            TNeu016a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCCAAATGCCCAGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATATATATTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTT
  3   1   2       bld Brn3      in                         CAAK7872.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCAGCAGGAGGAGAGCTCGGATGAACTGATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTTTGCCCCACCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTTTTTTCCGGTATTTGCAGTACTTGCATTTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGTTTTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTTTATTGGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTTTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTTTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATTTTTTCTTTCCTGGGATTTTTGCACCCTTTGTTTTTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTTTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTTTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGC
  3   1   2       bld Tad5      in                         XZT11576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGGAGGAGAGCTCGGATGAACTAATAGAGGAGAGTTTGCCCCAGACGGGCCAAAGGGCAACTTGCCCAATGAGCATTAGAAGAGCCGTGCTGGTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTCTGCCCCTCCTGAAGGATCTGTCAGGGGAGCAAGTGATGTTTCTTCTCCGGTATTTGCAGTACTTGCATCTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTGTCATCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCACGGTGGTGATGCTCTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATTTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGCTA
  3   1   2       bld Te5       in                         CAAO7301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAACTCGGTGCTAATGTCTCCTTACAGCGAGAGTTTCCTTTTGCCCCACCTGAAGGTTCTGTCAGGGGAGCAAGTGATGTTTTTTCTCCGGTATTTGCAGTACTTGCTTTTGAAGTGCATTGGAAATGTTACAGGAAACCTTCCAGGGAAGCACGTGCCCACTTTCAGCCAGGTAGTGGATTGGATGAGCCTGCTGCTGGATGCCCACTTTGCCCCGGTGGTGATGTTTTCAGACGCCAAGGCCCTGCTCAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTTTATTCGGAGCTGAACAAGATCGAGGGCTTTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTTTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTTTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATTTTTTTTTTCCTGGGATTTTTGCACCCTCTGTTTTTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTTTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTTTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGT
  3   1   2       bld Gas7      in                         XZG50802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCCTCAAAAAGCTGCAACTTTTCTTTTTTTTTTAATTCCCACTGTTTTCTGCAGTTTTTTCTCCGGTATTTGCAGTACTTGTATTTGAAGTGCATTGGAAATGTTCCGGGAACCCTTCCAGGGAAGCACGTGCCCACTGTCAGCCGGGTAGTGGATTGGATGAGCCTGCTGCTGGATCCCCATTTTGCCCCGGTGGTGATGCTCTCAGTCCCCAAGGCCCTGCTCAATAAATTCCAAAAGATTGTGAAGAGCCAGTTGAAGTTTTTCTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCAGAAGGAACCCAAGTGCCCCTTTGTGAGCCCCCATGAACTGCCCCCATGAACTGCCCCT
  3   1   2       bld Neu0      in                     NISC_ng23c05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATAAAATCCAAAAGATTGTGAAGAGCCAGTTGAAGTTCTACTCGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAGAGTTATTTGCTGTAAAAAAAAAAAAAAAAAAAAAAAG
  5  -1   2       bld Liv1      in                        CAAR10980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTGAAAAGCCTCGG
  3   1   2       bld HeRe                             EC2CAA42AA02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCTGAACAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCTCCTCT
  3  -1   2       bld Liv1      in                        CAAR10980.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGAGCTGAAAAGATCGAGGGCTGTTTGGCGGAGCTGAAGGAACCCAAGTGCCCCTCTGTGAGCCCCCCGGGCAGATATTCTATAGAAGTGCTCCAGCTCTACTAGTGACCCCCCCCACTTCTGTACAGACTTGCTTTATTTCTTTGTATAAAGTGGAAATCTTCTCTTTCCTGGGATTTCTGCACCCTCTGTTTCTCTTGCCAGTTGCCCTGACTTGGTGGCCCCTCTGCAGCCCCCATGAACTGCCCCCATGAACTGCCCCTCCTCTGCCCTGTGTGTCTTGTTCCCTTGATAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)