Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.1% 0.1%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas116o05.3                         71 END     1           4        1                PREDICTED: zinc finger, CCHC domain containing 6 [Gallus gallus]
     2   2.0    0Xt7.1-CCAX5914.3                            4 END     4          18      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 355.0    0Xt7.1-CCAX5914.3                            4 PI      92       1359     1596                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012077717 Xt7.1-XZT65382.5 - 22 ESTs
                                                                       -70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT65382.5                                                                       GGCAGGGCGCCCGGCTCATTACCTCCTTGGGTTTTGCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATTAGGGCAACTAATAATCCTTAGATTATGGCTGAACCTTATTACACCGTGAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTTGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGACGACAGATGTTTTATACGGAACAGAAAGTAAATATAAAGGCAAAGCTAAACCTAACTATAATAAAAAATCCAGGAAACCGATAGAAATATAAAAAAAAGACTTGAGTATATGAATATACCCCCCCCAGTTTGTTTGTGGTGGGGCTTACGTCTCTGTTTTTGTATAATTTTCTTGAGCTCAGACCCAAACCCGGAATTGTGTTTTTTTTAATAAATTCCGTATTTACTTTTGTTTTTGAATTTCAGTTTACAAAAAGAAACATTTGTTGTAAGAAACTGTTTTTTTTGTAAAACCAACACCCCCCCCCCCGCTGTTAGCGAATCCTGCGCCAATAAACGGGAGCGACTCGCAGGGACCTCCTCTCATGTAATGGGAGACAAACAATGCGCTTGTTGTTTTTTTGCTCTTAGTGCG
                                                  Xt7.1-CHK-1008230070                                                                             GCGCCCGGCTCATTACCTCCTTGGGTTTTGCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATTAGGGCAACTAATAATCCTTAGATTATGGCTGAACCTTATTACACCGTGAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTTGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGACGACAGATGTTTTATACGGAACAGAAAGTAAATATAAAGGCAAAGCTAAACCTAACTATAATAAAAAATCCAGGAAAACGATAGAAATATAAAAAAAAGACTTGAGTATATGAATATACCCCCCCCxxxxxxTTTGTGGxGxxxxTTACGTCTCTGTTxTxxxATxxTxTTCTTGAGCTCAGACCCAAACCCGxxxTxxTGTTTTTTTTAAxxxAxTCCGTATTTACTTTTxTxxxTxxAxxTxAxxxxAxxAAAAGAAACATTTGTTGTAAxxAxxTGTTTTTxTxxxAxAxCCxxCxCCCCCCCCCCCGCTGTTAGCGAATCCTGCGCCAATAAACGGGAGCGACTCGCAGGGACCTCCTCTCATGTAATGGGAGACAAACAATGCGCTTGTTGTTTTTTTGCTCTTxGTGCGAGCTGG
                                                      consensus depths                                                                            2     2     2     2     2     2     5     8     8    11     9    12     9    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    14    13    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    17    17    17    16    17    16    17    16    17    16    17    16    16    16    16    14    15    14    15    14    15    14    15    14    15    13    14    14    14    14    14    14    14    14    14    12    12    11    11     9     9     7     7     6     6     6     6     5     6     5     6     5     5     4     5     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     7     6     7     6     7     5     7     6     7     6     7     6     7     6     7     5     7     5     7     4     7     6     7     6     7     6     7     6     7     6     7     5     6     4     6     5     6     5     5     4     4     3     4     2     4     4     5     4     4     3     4     2     3     2     4     1     2     1     2     1     2     1     2     1     2     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                           ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------C
                                               BLH ATG      95     785                                                                       
                                               BLH MIN      95      88                                                                       
                                               BLH OVR      95      67                                                                       
                                               CDS MIN      95      52                                                                       
                                               EST CLI      34      52                                                                       
                                               ORF LNG      95       1                                                                       
                                                                       PROTEIN --- Ci ---- 4e-026     AAS00647.1 potassium channel-interacting protein KChIP; Kv channel-interacting protein [Ciona intestinalis] -----------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED = Sc ==== 2e-033     NP_010661.1 Product of gene unknown; Frq1p [Saccharomyces cerevisiae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN --- Bf ---- 2e-036     AAP78742.1 frequenin-like [Branchiostoma floridae] -----=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 1e-042     NP_492651.1 neuronal Calcium Sensor (22.0 kD) (ncs-2) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED = Sp ==== 1e-049     XP_783112.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN -== Dm ==== 6e-052     NP_788543.1 Neurocalcin CG7641-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Gg ==== 8e-073     NP_990845.1 calcium binding protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xt ==== 7e-075     AAH82346.1 MGC79749 protein [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 3e-075     AAH75232.1 MGC84424 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === ?? ==== 3e-075     NP_001086398.1 MGC84424 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Dr ==== 4e-090     NP_001025419.1 hypothetical protein LOC570333 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Mm ==== 2e-092     NP_033064.1 recoverin; guanylate cyclase activator; cancer associated retinopathy protein[Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Hs ==== 1e-092     NP_002894.1 recoverin [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT65382.5                                                                                                                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TAA------------------------TAA---------------------------------------------------------------------------------------------------------TAA------------------------------TGATAA------------------------------------------------TGA---------------------------TAA---------TAG---------------------TAA------------------------------------------------TAA------------------------------------TAATAA------------------------------------------------------------------------------------TGA---------------ATG------------------------------------------------------------------------TAG------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAG---------------TAA------------------------------------------------ATG---------------------TAG
                                                                   ORF                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  0   1   1           HeRe FLt3                 EC2CAA25DA01.FL-Pollet                                                                       GGCAGGGCGCCCGGCTCATTACCTCCTTGGGTTTTGCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCAATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACATGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACGTTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATACGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGAATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           HdA  FL                     THdA011m01.FL-Sanger                                                                                                           CCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATTAGGGCAACTAATAATCCTTAGATTATGGCTGAACCTTATTACACCGTGAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTCGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGACGACAGATATTTTATACGGAACAGAAAGTAAATATAAAGGCAAAGCTAAACCTAACTATAATAAAAAATACAAGAAAACGATAGAAATATAAAAAAAAGACTTGAGTATATGAATATACCCCCCCCCCCAGTTTGTTTGTGGCGCTTACGTCTCTGTTTTTGTATAATTCTCTTGAGCTCAGACCCAAACCCGGAATTGTCTCGTTTTTTTTAAATTCCGTATTTACTTTTGTTTTTGAATTTCAGTTTACAAAAAGAAACATTTGCTGTAAATAGAAACTGTCTCTGTACAACCAACACCCCCCCCCCCCGCTGTTAGCGAATCCTGCGCCAATAAACGGGAGCGACTCGCAGGGACCTCCTCTCATGTAATGGGAGACAAACAATGCGCTTGTTGTTTCTCTGCTCTTAGTGCGACTGGATTAATTAATGAGTCCAATTAAAGTGAGAATTGTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe FLt3 in                     EC2CAA25DA01.b1                                                                      GGGCAGGGCGCCCGGCTCATTACCTCCTTGGGTTTTGCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCAATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACATGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACGTTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATACGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGAATCATGAACAACAAGG
  5   1   2       bld HeRe FLt3 in                     EC2CAA25DA01.g1                                                                       GGCAGGGCGCCCGGCTCATTACCTCCTTGGGTTTTGCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCAATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACATGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACGTTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATACGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAAATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGAATCATGAACAACAAGGAAATTCTCCGCTTG
  5   1   2   10  bld Eye  5g3  out                        CCAX9847.b1 .......................................................................................................TGCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCTCAG
  5   1   2   10  bld Eye  5g3  in                         CCAX1984.b1 ........................................................................................................TGCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACGTTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATACGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGC
  5   1   2       bld HdA  FL   out                  THdA011m01.p1kSP6                                                                                                          CCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTACACAATACACTCGGGTTGTGCTTCTCTGTCTG
  5   1   2   30  bld Eye  5x3                             CCAX9304.b1 .........................................................................................................GCCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCC
  5   1   2   32 seed Tad5 5g                              XZT65382.5p ..........................................................................................................CCTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATAGGGCAACTAATAATC
  5   1   2   30  bld Eye  5x3                             CCAX4965.b1 ..........................................................................................................CTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGCGTTAC
  5   1   2   10  bld Eye  5g3  out                        CCAX5914.b1 ...........................................................................................................CTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACGTTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATACGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGT
  3  -1   2       bld Eye       out                        CCAX7350.g1                                                                                                            CTTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGGAGGGAGCTCTGCACGTGGGTACCAGTCCTTCCTCAAGGGAGTGGCCCCACCGGGGCGGGATCTCCAAGCAGCAGT
  5   1   2   30  bld Eye  5x3                             CCAX4387.b1 ............................................................................................................TTCGACCACACGAGACGTTTCTCGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGCGTTACACAAACTCA
  5   1   2   30  bld Eye  5x3                             CCAX5918.b1 ..................................................................................................................................CGCCCTTCAGACTCCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACGTTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATACGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTG
  5   1   2       bld TpA  5x3  out                  TTpA060p04.p1kSP6                                                                                                                                         ATGGAGGAGGAGGTTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACA
  5   1   2   30  bld Eye  5x3                             CCAX9328.b1 ...............................................................................................................................................CCGATCCTGTTTTTTTCCCAGCATGGGGAACAGCAAAAGCAGCGCCTTATCCAAGGAGATCCTGGAAGAACTGCAACTCAACACCAAGTTCAGCCAGGAGGAGCTCTGCACGTGGTACCAGTCCTTCCTCAAGGAGTGCCCCACCGGGCGGATCTCCAAGCAGCAGTTTGAGGGCATCTACTCCAAGTTCTTCCCCGACGCCGACCCCAAAGCCTACGCCCGCCATGTCTTCCGGAGCTTCGACTCCAACAACGACGGCACATTGGACTTTAAGGAATACATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGCGTTACACAAACTCACCTGA
  5   1   2       bld Tad5                                 XZT45806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       CATGATCGCCCTCCACATGACTTCCTCCGGCAAAGCCAACCAAAAGCTGGAGTGGGCTTTCTCCTTATATGACGTCGACGGCAACGGGACCATCAACAAATCCGAAGTCCTTGAGATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATTAGGGCAACTAATAATCCTTAGATTATGGCTGAACCTTATTACACCGTGAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTCGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGA
  5   1   2       bld Tad5      in                         XZT67715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATAATTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGCGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATTAGGGCAACTAATAATCCTTAGATTATGGCTGAACCTTATTACACCGTGAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTTGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGACGACAGATGTTTTATACGGAACAGAAAGTAAATATAAAGGCAAAGCTAAACCTAACTATAATAAAAAATACCAGAAAACGATAGAAATATAAAAAAAAGACTTGAGTATATGAATATAC
  5   1   2       bld Eye                                  CCAX2988.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACCTTACGGCCATATTCAAAATGATAAATACTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATTAGGGCAACTAATAATCCTTAGATTATGGCTGAACCTTATTACACCGTGAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAAATAATTCCTTATCAATAACGGTGCGAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTTGTATCATATCCGCTCACGTATGGGTTGAGCAGAACGACGACAGATGTTTTATACGGAACAGAAAGTAATAT
  5   1   2       bld Eye                                  CCAX7855.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGAAGACCAGAAGCATCTCCCCGAGGATGAAAATACTCCAGAGAGGAGAACAAATAAAATATGGGATTTCTTTGGAAAGAAAGATAATGATAAGCTCACTGAGGGGGAATTCATCCAAGGCATCATGAACAACAAGGAAATTCTCCGCTTGATCCAGTTTGAGCCCCAGAAAGTAAAGGAAAAGCTAAAAGAGAAAAAGCATTAAACGAAGAGCCAAAACCCATTTTGCTAAGACTGTTCAATCAGCACCGTTTCCGACTGTCTACACCAGCGAGACCGTCACAGATCCCAGTGTTACACAAACTCACCTGAAACCCTTGTTGCCCTTAATCTTCGTTAACACAATACACTCGGGTTGTGCTTCTCTGTCTGATAATTAGGGCAACTAATAATCCTTAGATTATGGCTGAACCTTATTACACCGTGAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTTGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGACGACAGATGTTTTATACGGAACAGAAAGTAAATATAAAGGCAAAGCTAAACCT
  3   1   2       bld Tad5      in                         XZT67715.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGGTCACCGACTATAATCTCATTTCATTAACTCCAACTCTAGGCTCTCTGTGCGTTTAACTCCTAAACACCCGGAGTAAATCTCATTCCAGCTATAACCGTTGGTAAATCCAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAATTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTTGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGACGACAGATTTTTTATCCGGACCAGAAAGTAAATATAAAGGCAAAGCTAACCCTACCTTTATTAAAAAATCCAGGAAACCGATGGAAATTTAAAAAAAAGCCTTGGGTTTATGAATATACCCCCCCCAGTTTGTTTGTGGCGCTTACGTCTCGGTTTTTGTATAATTCTCTGGAGCTCAGACCCAAACCCGGAATTGTCTTGTTTTTTTTAAATTCCGTATTTACTTTTGTTTTTGAATTTCAGTTTACAAAAAGAAACATTTGCTGTAAATAGAAACTGTTTTTGTACAACCAACACCCCCCCCCCCCCCGCTGTTAGCTAATCCTGCGCCAATAAACGGGAGCGACTCGCAGGGACCTCCTCTCATGTAATGGGAGACAAACAATGCGCTTGTTGTTTCTCTGCTCTTAGTGCGACTGGATTAATTAATGAGTCCAATTAAAGTGAGAATTGTTT
  3   1   2       add TpA                             TTpA060p02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCTGTGTGGGTTTAACTCCTAAACCCCCGGATTAAATTTCATTCCAGCTATAAACGTTTGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAGAATTTTGCCCCTCAGGGGGCAGTCACGAGGGTATTCGTATCATATCCGCTCACGTATGGGTTGAGCAGAACGACGACAGATTTTTTATACGGAACAGAAAGTAAATATAAAGGCAAAGCTAAACCTAATTTTAATAAAAAATACAAGAAAACGATGGAAATATAAAAAAAAGACTTGAGTATTTGAATATACCCCCCCCCCCAGTTTGTTTGTGGGGCTTACGTCTCTGTTTTTGTATAATTTTCTTGAGCTCAGACCCAAACCCGGAATTGTTTCGTTTTTTTTAAATTCCGTATTTACTTTTGTTTTTGAATTTCAGTTTACAAAAAGAAACATTTGTTGTAAATAGAAANTGTTTTTGTAAAACCAACACCCCCCCCCCCGCTGTTAGCGAATCCTGCGCCAATAAACGGGAGCGACTCGCAGGGACCTCCTCTCATGTAATGGGAGACAAACAATGCGCTTGTTGTTTTTTTGCTCTTAGTGCGAGCTGGATTAATTAAGTGAGTTCCAATTAAAGGTGAGAATTTGTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  in                         CCAX1984.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCGTTTAATCTCCTAAACACCCGGAGTAAATTCTCATTCCAGCTATAAACGTTAGTAAATACAAGTAATATAAATACCCAGACCCGCCCAGCAACATTCCCACCTAATAATTCCTTATCAATAACGGTGCGAAGAACTCTGCCCCGCAGGGGGCAGTCACGAGGGTATTTGTATCATATCCGCTCACGTATTGGTTGAGCAGAACGACGACAGATGTTTTATACGGAACAGAAAGTAAATATAAAGGCAAAGCTAAACCTAACTATAATAAAAAATCCAAGAAAACGATAGAAATATAAAAAAAAGACTTGAGTATATGAATATCCCCCCCCAGTTTGTTTGTGGCG
  3   1   0       add TpA       out                   TTpA022d19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGGGAGTTAGGAGGGTATTTGTTTTATATAAGATAAAGTATTGGTTGAGAAGAAGGATGAAAGATTTTTTATTTGGAAAAGAAAGTAAATATAAAGGGAAAGTTAAAATTAATTATAATAAAAAATAAAAGAAAAGGATAGAAATATAAAAAAAAGATTTGGGTATATGAATATATATNNNNAAGTTTGTTTGTGGGGGTTATTTTTTTGTTTTTGTATAATTTTTTTGAGTTAAGAAAAAAAAGGGGAATTGTTTTGTTTTTTTTAAATTAGTATTTAATTTTGTTTTTGAATTTAAGTTAAAAAAAGAAAAATTANNGAAAATAGAAANNGTNTNGANAAAAAAACACCCCCCCCCCCCCCGCTGTTAGCTAATCCTGCGCCAATAAACGGGAGGGACTCGCAGGGACCTCCTTTCATGTAATGGGAGACAAAACAATGCGCCTTGTTGTTTTTTCTGCTCTTAGGTGCGAGCTGGATTAATTAATGAGTCCCAATTAAAGGTGAAAGATTGTTTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)