Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CABC7229.3                           22 END     6          18       27                (no blast hit)
     2   1.0    0Xt7.1-CABC8258.3                            9 END     1           3       11                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 191.0    0Xt7.1-CABD14417.5                         148 PI      79        937     1195                LOC733921 protein [Xenopus tropicalis]
     4 482.0    0Xt7.1-TEgg056g07.3                        104 PI      78       2193     2916                transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) [Xenopus tropicalis]
     5 275.0    0Xt7.1-ANBT192.5.5                          67 PI      73        899     1465                Unknown (protein for IMAGE:7585163) [Xenopus tropicalis]
     6 901.0    0Xt7.1-CBXT1130.5                            6 PI      93       2310     2899                transducin-like enhancer of split 1 [Homo sapiens]

 This cluster: approximate FL confidence score = 99%

 1012078213 Xt7.1-TGas107e13.3 - 32 ESTs
                                                                       ...-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas107e13.3                                            CCTCAATGTTGTGAATATGTATCAGAATGTTAATGATTTGCTGCTGCTAAATTTGGTCATAGAAGTCACCTACACAGATCGCGGTGTGGGAGCTGCTCGGAACGGCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGTACCCCCAGACCAGGCACCCGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCAGCGGCCGCTGCAGCTGCAGCAGCTGCTGCTTATGGAAGATCCCCAGTGGTTGGTTTTGACCCACATCACCATATGAGGGTTCCTGGCATACCTCCTAATCTAACAGGCATCCCAGGTGGAAAACCCGCCTATTCATTCCATGTAAGTGCCGATGGTCAAATGCAGCCAGTCCCTTTCCCTCCTGATGCACTTATAGGACCAGGCATTCCAAGACATGCACGGCAGATAAACACACTAAATCACGGGGAGGTAGTGTGCGCAGTTACCATCAGTAACCCCACGAGACATGTGTACACTGGTGGGAAGGGATGTGTCAAAGTCTGGGACATCAGTCATCCAGGGAACAAAAGTCCAGTATCTCAGCTGGATTGCCTGAACAGAGATAACTACATACGTTCCTGCAGATTGCTTCCTGATGGGCGCACCCTTATTGTAGGAGGGGAAGCCAGCACATTATCCATTTGGGACCTGGCAGCTCCTACTCCACGTATAAAAGCAGAACTGACATCATCTGCTCCAGCCTGCTATGCTCTGGCCATCAGCCCTGATTCCAAGGTCTGCTTCTCCTGCTGTAGTGATGGCAACATTGCAGTGTGGGATTTGCACAACCAGACTCTAGTAAGGCAGTTCCAGGGCCACACAGATGGAGCCAGCTGTATTGACATTTCTAACGATGGGACTAAGTTGTGGACAGGAGGCTTGGACAACACAGTAAGGTCCTGGGACCTGCGTGAAGGACGGCAGCTCCAGCAGCATGACTTTACATCACAGATCTTCTCATTGGGTTATTGTCCAACTGGGGAATGGCTGGCTGTGGGTATGGAAAACAGCAATGTTGAGG
                                                  Xt7.1-CHK-1008227898                                                  TGTTGTGAATATGTATCAGAATGTTAATGATTTGCTGCTGCTAAATTTGGTCATAGAAGTCACCTACACAGATCGCGGTGTGGGAGCTGCTCGGAACGGCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGTACCCCCAGACCAGGCACCCGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCAGCGGCCGCTGCAGCTGCAGCAGCTGCTGCTTATGGAAGATCCCCAGTGGTTGGTTTTGACCCACATCACCATATGAGGGTTCCTGGCATACCTCCTAATCTAACAGGCATCCCAGGTGGAAAACCCGCCTATTCATTCCATGTAAGTGCCGATGGTCAAATGCAGCCAGTCCCTTTCCCTCCTGATGCACTTATAGGACCAGGCATTCCAAGACATGCACGGCAGATAAACACACTAAATCACGGGGAGGTAGTGTGCGCAGTTACCATCAGTAACCCCACGAGACATGTGTACACTGGTGGGAAGGGATGTGTCAAAGTCTGGGACATCAGTCATCCAGGGAACAAAAGTCCAGTATCTCAGCTGGATTGCCTGAACAGAGATAACTACATACGTTCCTGCAGATTGCTTCCTGATGGGCGCACCCTTATTGTAGGAGGGGAAGCCAGCACATTATCCATTTGGGACCTGGCAGCTCCTACTCCACGTATAAAAGCAGAACTGACATCATCTGCTCCAGCCTGCTATGCTCTGGCCATCAGCCCTGATTCCAAGGTCTGCTTCTCCTGCTGTAGTGATGGCAACATTGCAGTGTGGGATTTGCACAACCAGACTCTAGTAAGGCAGTTCCAGGGCCACACAGATGGAGCCAGCTGTATTGACATTTCTAACGATGGGACTAAGTTGTGGACAGGAGGCTTGGACAACACAGTAAGGTCCTGGGACCTGCGTGAAGGACGGCAGCTCCAGCAGCATGACTTTACATCACAGATCTTCTCATTGGGTTATTGTCCAACTGGGGAATGGCTGGCTGTGGGTATGGAAAACAGCAATGTTGAGGTGCTCC
                                                      consensus depths                                                 2     2     2     2     2     2     2     2     2     2     2     2     4     4     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     7     9     6     8     6     8     7     9     6     8     6     8     5     6     5     6     4     5     4     5     5     5     5     5     6     6     6     7     6     8     5     8     5     8     5     7     6     9     6     9     6     9     6     9     6     9     6     9     6     9     7    10     7    10     7    10     7    10     8    11     8    11     8    11     9    12     9    12     9    12     9    12     9    12     9    12     9    12    12    12    12    13    12    13    13    14    13    14    11    14    14    16    15    17    15    17    15    17    15    17    14    17    14    17    14    16    12    16    13    15    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    12    14    11    14    11    13    11    13    11    13    11    14    11    14    11    13    10    12    10    12    11    12    11    12    11    13    11    13    11    13    11    13    11    13    11    13    11    13    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     2     3     2     2     3     3     3     4     3     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAGC
                                                                   SNP                                                                                                                                            --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----C-------
                                               BLH ATG     863    1191                                            
                                               BLH MIN     863     325                                            
                                               BLH MPR     851     325                                            
                                               BLH OVR     863    1088                                            
                                               CDS MIN     863     325                                            
                                               ORF LNG     863     180                                            
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Br ---- 2e-009     AAM88902.1 guanine nucleotide-binding protein [Branchiostoma lanceolatum] ---------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Br ---- 2e-009     AAX54700.1 receptor of activated protein kinase C 1 [Branchiostoma belcheri tsingtaunese] -----------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Bf ---- 4e-010     AAM18877.1 unknown [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Sc ---- 4e-013     NP_010007.1 general repressor of transcription (with Cyc8p); mediates glucose repression;Tup1p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Ce ==== 8e-091     NP_491932.1 transducin-like enhancer of split groucho, UNCoordinated locomotion UNC-37,LEThal LET-76 (65.6 kD) (unc-37) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Ci ==== 0          BAE06478.1 Groucho [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dm ==== 0          NP_733133.1 groucho CG8384-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 0          XP_792326.2 PREDICTED: similar to co-repressor protein groucho [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 0          CAJ81868.1 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_571855.1 groucho 3 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 0          NP_035730.2 transducin-like enhancer protein 4; transducin-like enhancer of split 4;transducin-like enhancer of split 4, E(spl) homolog (Drosophila); B lymphocytegene 1; groucho-related protein 4 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 0          NP_008936.2 transducin-like enhancer protein 4; transducin-like enhancer of split 4;enhancer of split groucho 4; B lymphocyte gene 1 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 0          NP_989568.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH79799.1 TLE4 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                    Xt7.1-TGas107e13.3                                                 ATG---TGA------------ATG---ATG------------TAA---------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAA---------------------------------------------------------------------------TGA---------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------ATG------------TGA---------------------------------------------------------------------TAG---------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  0   1   1           Gas  FLt3                   TGas107e13.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCCTCCTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGTACCCCCAGACCAGGCACCCGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCAGC
  5   1   1         - Gas7      in                         XZG33701.5p AACATTTCTGGACTACATCTCCCAGCAGGGCCAAGCGCTTTCGCCTCAATGTTGTGAATATGTATCAGAATGTTAATGATTTGCTGCTGCTAAATTTGGTCATAGAAGTCACCTACACAGATCGCGGTGTGGGAGCTGCTCGGAACGGCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGNGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATG
  5  -1   1         - Gas7      out                        XZG31147.5p                                            CCTCAATGTTGTGAATATGTATCAGAATGTTAATGATTTGCTGCTGCTAAATTTGGTCATAGAAGTCACCTACACAGATCGCGGTGTGGGAGCTGCTCGGAACGGCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGT
  5   1   1         - Tail      in                         CBSW8065.b1                                                                                                            GTCACCTACACAGATCGCGGTGTGGGAGCTGCTCGGAACGGCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCC
  5   1   1         - Tad5      in                         XZT56615.5p                                                                                                                CCTACACAGATCGCGGTGTGGGAGCTGCTCGGAACGGCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGC
  5   1   1         - HdA                            THdA048p24.p1kSP6                                                                                                                               GTGTGGGAGCTGCTCGGAACGCCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCATCGTGGGAAGGGACTAGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCAC
  5   1   1         - Gas                            TGas108l08.p1kSP6                                                                                                                                    GGAGCTGCTCGGAACGCCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCATCGTGGGAAGGGACTAGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCG
  3  -1   1         - AbdN      out                      IMAGE:6998334                                                                                                                                           CTCGGAACGCCACTCTGGCTGCCTGGTTTTTTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAACAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCACTCACCCCTCCCGTGGCCTCCTGNCATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCAGCGGCTTGGATA
  5   1   1         - Tbd1      in                        CBXT17574.b1                                                                                                                                                                                                                                                    CAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGTGGGGAAGAAGTAAGAGGTGTGCAAAGAGCAGCTAAAGAGGAAGCCCAGCGGGAGGGAGCAGGGCCGGTCTGACTGACTGCATCTGCCCAGGAATAAGTTGGTGTCAGAGCGGGGCGCACCGTGGGAAGGGACTCGTCGGAAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGTACCCCCAGACCAGGCACCCGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGT
  5   1   1         - Tad5      in                          XZT9430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTCGGAAGTTGCTGTGAGGAGGCTGCTGCTTTGTTTGTTTCACGGGAGCCTGGCTCTGGATCTCGGCTCTTTCGGGGCCCCTGGATTGGCCCCTGTTTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGTACCCCCAGACCAGGCACCCGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCANACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCA
  5   1   1   10    - Fat1 5g3  out                        CABC7229.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTCCTGGGGCAGGTCTCACCCCGTGGATCCCGGAGCGAGGGTGGAAAAGATTAAGGCGGCTTGCGGATAATGAGATTCCACGCGTGACAGCCGCTTCCTGTGGGATGTGTAAGGGTTCGGTCGGGGGAGCAGGTCTTGCCTGGGGCTGAGCTGCATTAGGCTTACTATTAACACAAGGAGTCCGGGGCTACAGCCTCAGTGAGCAGCACAATTAGCTGGATTCCAAGCCTCCACCCTCCCTTTGTGCTGGGGGCTCTTCCCACTCACCCCTCCCGTGGCCTCCTGCAATTAGTCCATGACCCTCAGTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGTACCCCCAGACCAGGCACCCGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGCCAGTCCCATCTTCCATTAAGGATGAGAAAAGCACCATGACAGCGACCATCA
  3  -1   1       chi Gas8      in                         st108a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATCGCGGTGTGGGAGCTGCTCGGAACGGCACTCTGGCTGCCTGGTTTATTTATTTATAATTTTGCTACCAAACCTTGGATTGTCTTTCTGGTTCCACAACCTACCCACCTCCTCTCCCCGCAACAAAAGTGCGCGGTTGTCGATCGGATGAGAGAGACGGAAGTGGGAAATCACCGGAGCTCGTCTGAAAGGAGAAAGCGAGTACGATAACCTGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGCCAGTCCCATCTTCCANTTAAGGATGAGAAAAGCACCATGACAGCGACCATCA
  5   1   1         - Gas  FLt3 in                   TGas107e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGCCTCCTGCTCTGGGCCAGGAACCTCCCCAGCGGCTTGGATGATTCGAGACTTGAGCAAGATGTACCCCCAGACCAGGCACCCGGCGGCTCCTCATCAGCCAGCACAGCCCTTCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAAT
  5   1   1         - Neu                            TNeu034j06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGGCAAATTCACCATATCAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAATGATGACAACCTG
  5   1   1         - Lun1      out                       CABD12033.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAGTCGTGTGATCGGATTAAGGAGGAGTTTCAGTTTTTACAGGCTCAGTACCACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTT
  5   1   1         - Te5       in                         CAAO1239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATTATGGGAAGATTAATATTAGAAAGTACAAATATTTTATTTAGAGCAGGCTGTGGATCACTTGGTGGTTATAAACCTCAGAGCGCATATTGCCCATGTATATAGATGCAAGCACATTTGGGATGTCTCGTGTTGTGTATTTTAAACCACGGCCTGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCT
  5   1   1         - Brn4      in                        CAAL22116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTT
  5   1   1         - Abd0                               IMAGE:7000376                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTTTGAAGCTGGAATGTGAAAAGCTGGCCAGTGAGAAGACAGAGATGCAGCGACATTATGTTATGTACTACGAGATGTCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTNCACCTCCAGCCATTCCTCCTATTGNAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAAGTGGCCAGTCCCATCTTTCAATTTAAGATGAGAAAAGCCACATGACAGCGAACTTCAAAGAGAAAGAAATTCCTTCCAGAGTCTTCTGGATCCCCCTCCGAAGTTTCAAAGCTCAGAAAAAATCCAAATTCTCCAAATTTTCCCCAAACCCCAAAACCAAAAACTGAAAAAAAAATTTCCCCCCTTTTAAAGGTGGGGGAAAAATGGGAAAACCCGGGGGGGATTTTCCAAAAAGCCCCCCCCCCCAAAAACCCCCCCTTCCCGGAAAAAGGGGGAAAACCCTTTAAAAAA
  5  -1   1       chi Gas8      in                         st108a12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGTATGGACTGAACATTGAGATGCACAAACAGGCAGAAATTGTCAAGAGGCTGAATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGTGAGTAGCTATTATAATAACAAAATTATAATTTTTCCTTGCATCTCTTATTCTAAAAAACAGACGTTTAAGGATATATGTCTTCCCCTCTGCAAGTTGAGGAGATGTATGTGACGCCTAGATCTCAAGTTCATTTAGCCACAGAACAGGCTATTAAAGTTATAGCAAACACCCGTTACCATAATTCTGTGTGTTTTATTTTTTTATGGTTTCGCGTAATCCTGATCGCTGAGCGTGCA
  3   1   1         - Gas  FLt3 in                    TGas107e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGCTATCTGTGCACAAGTCATTCCTTTCTTGTCCCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAA
  3   1   1         - Gas7      in                         XZG33701.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAGAGCACCAACAGCAAGTGGTACAAGCTGTGGAACGTGCCAAACAGGTGACCATGGCAGAGCTGAATGCCATCATTGGGCAGCAACTCCAGGCACAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCNTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCA
  3   1   1         - Tbd1      in                        CBXT17574.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCATTTGTCTCACGGACATGGTCTCCCAGTGCCTCTCACTCCGCATCCTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCA
  3   1   1         - Tad5      in                          XZT9430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGTCTGCCAGTGCCTCTCACTCCGCATCTTTCTGGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAA
  3   1   1         - Brn4      in                        CAAL22116.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACTTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCA
  3   1   1         - Te5       in                         CAAO1239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAACCTCCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCA
  3   1   1         - Tail      in                         CBSW8065.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGTGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCA
  3   1   1         - Tad5      in                         XZT56615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCATTCCTCCTATTGGAAGCAGTGCAGGATTGCTGGCTCTCTCCAGTGCCCTAGGCGGCCAGTCCCATCTTCCAATTAAGGATGAGAAAAAGCACCATGACAGCGACCATCAAAGAGATAGAGATTCCATCAAGAGTTCTTCTGTATCCCCCTCCGCAAGTTTCAGAGCTGCAGAAAAACATCGAAATTCATCAGATTATTCCTCAGACAGCAAAAAGCAGAAGACTGAAGAGAAAGATATTGCAGCTCGTTATGACAGTGATGGTGAAAAAAGTGATGACAACCTGGTGGTGGATGTTTCCAATGAGGACCCTTCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGCAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCA
  3  -1   1         - Int1      out                       CAAP12412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGTCTCCCAGAGGAAGCCCAGCGCATTCTCCGCGGGAAAATGGCTTGGATAAACCACNGCCTTTTAAAGAAAGATGCCCCCATCAGTCCAGCCTCCATTGCCTCATCCAGTAGTACCCCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCAGCGGCCGCTGCAGCTGCAGCAGCTGCTGCTTATGGAAGATCCCCAGTGGTTGGTTTTGACCCACATCACCATATGAGGGTTCCTGGCATACCTCCTAATCTAACAGGCATCCCAGGTGGAAAACCCGCCTATTCATTCCATGTAAGTGCCGATGGTCAAATGCAGCCAGTCCCTTTCCCTCCTGATGCACTTATAGGACCAGGCATTCCAAGACATGCACGGCAGATAAACACACTAAATCACGGGGAGGTAGTGTGCGCAGTTACCATCAGTAACCCCACGAGACATGTGTACACTGGTGGGAAGGGATGTGTCANAGTCTGGGACATCAGTCATCCAGGGAACAAAAGTCCAGTATCTCAGCTGGATTGCCTGAACAGAGATAACTACATACGTTCCTGCAGA
  5   1   1         - Spl1      out                       CABK10598.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCATCGATTCGCTCCATTGCCTCATCCAGTAGTACCCNCTTCTTCAAAATCCAAAGAACTCAGCCTTAATGAGAAGTCCACGACTCCTGTTTCAAAATCAAACACTCCCACTCCACGAACTGATGCTCCTACACCTGGCAGCAACTCATCTGGATTGCGACCTGTTCCTGGCAAGCCACCAGGTGTTGATCCATTAACAGGTCTTAGGACACCGATGGCTGTTCCATGCCCTTATCCAACCCCATTTGGGATCGTACCACATGCTGGGATGAATGGGGATTTGACCAGTCCAGGGCCTGCTTATGCCAGTCTTCATAACATCTCCCCACAAATGAGTGCAGCGGCCGCTGCAGCTGCAGCAGCTGCTGCTTATGGAAGATCCCCAGTGGTTGGTTTTGACCCACATCACCATATGAGGGTTCCTGGCATACCTCCTAATCTAACAGGCATCCCAGGTGGAAAACCCGCCTATTCATTCCATGTAAGTGCCGATGGTCAAATGCAGCCAGTCCCTTTCCCTCCTGATGCACTTATAGGACCAGGCATTCCAAGACATGCACGGCAGATAAACACACTAAATCACGGGGAGGTAGTGTGCGCAGTTACCATCAGTAACCCCACGAGACATGTGTACACTGGTGGGAAGGGATGTGTCAAAGTCTGGGACATCAGTCATCCAGGGAACAAAAGTCCAGTATCTCAGCTGGATTGCCTGAACAGAGATAACTACATACGTTCCTGCAGATTGCTTCCTGATGGGCGCACCCTTATTGTAGGAGGGGAAGCCAGCACATTATCCATTTGGGACCTGGCAGCTCCTACTCCACGTATAANAGCAGAACTGACATCATCTGCTCCAGCCTGCTATGCTCTGGCCATCAGCCCTGATTCCAAGGTCTGCTTCTCCTGCTGTAGTGATGGCAACATTGCAGTGTGNGATTT
  3  -1   1         - Eye       out                        CCAX7678.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGCTGCAGCAGCTGCTGCTTATGGAAGATCCCCAGTGGTTGGTTTTGACCCACATCACCATATGAGGGTTCCTGGCATACCTCCTAATCTAACAGGCATCCCAGGTGGAAAACCCGCCTATTCATTCCATGTAAGTGCCGATGGTCAAATGCAGCCAGTCCCTTTCCCTCCTGATGCACTTATAGGACCAGGCATTCCAAGACATGCACGGCAGATAAACACACTAAATCACGGGGAGGTAGTGTGCGCAGTTACCATCAGTAACCCCACGAGACATGTGTACACTGGTGGGAAGGGATGTGTCAAAGTCTGGGACATCAGTCATCCAGGGAACAAAAGTCCAGTATCTCAGCTGGATTGCCTGAACAGAGATAACTACATACGTTCCTGCAGATTGCTTCCTGATGGGCGCACCCTTATTGTAGGAGGGGAAGCCAGCACATTATCCATTTGGGACCTGGCAGCTCCTACTCCACGTATAAAAGCAGAACTGACATCATCTGCTCCAGCCTGCTATGCTCTGGCCATCAGCCCTGATTCCAAGGTCTGCTTCTCCTGCTGTAGTGATGGCAACATTGCAGTGTGGGATTTGCACAACCAGACTCTAGTAAGGCAGTTCCAGGGCCACACAGATGGAGCCAGCTGTATTGA
  3  -1   1         - HdA                             THdA031l17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCTGCTGCTTATGGAAGATCCCCAGNTGGGGTTGGTTTTGACCCACATCACCATATGAGGGTTCCTGGCATACCTCCTAATCTAACAGGCATCCCAGGTGGAAAACCCGCCTATTCATTCCATGTAAGTGCCGATGGTCAAATGCAGCCAGTCCCTTTCCCTCCTGATGCACTTATAGGACCAGGCATTCCAAGACATGCACGGCAGATAAACACACTAAATCACGGGGAGGTAGTGTGCGCAGTTACCATCAGTAACCCCACGAGACATGTGTACACTGGTGGGAAGGGATGTGTCAAAGTCTGGGACATCAGTCATCCAGGGAACAAAAGTCCAGTATCTCAGCTGGATTGCCTGAACAGAGATAACTACATACGTTCCTGCAGATTGCTTCCTGATGGGCGCACCCTTATTGTAGGAGGGGAAGCCAGCACATTATCCATTTGGGACCTGGCAGCTCCTACTCCACGTATAAAAGCAGAACTGACATCATCTGCTCCAGCCTGCTATGCTCTGGCCATCACCCCTGATTCCAAGGTCTGCTTCACCTGCTGTAGTG
  5   1   1         - Int1      out                        CAAP6350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGTTTTGACCCACATCACCATATGAGGGTTCCTGGCATACCTCCTAATCTAACAGGCATCCCAGGTGGAAAACCCGCCTATTCATTCCATGTAAGTGCCGATGGTCAAATGCAGCCAGTCCCTTTCCCTCCTGATGCACTTATAGGACCAGGCATTCCAAGACATGCACGGCAGATAAACACACTAAATCACGGGGAGGTAGTGTGCGCAGTTACCATCAGTAACCCCACGAGACATGTGTACACTGGTGGGAAGGGATGTGTCAAAGTCTGGGACATCAGTCATCCAGGGAACAAAAGTCCAGTATCTCAGCTGGATTGCCTGAACAGAGATAACTACATACGTTCCTGCAGATTGCTTCCTGATGGGCGCACCCTTATTGTAGGAGGGGAAGCCAGCACATTATCCATTTGGGACCTGGCAGCTCCTACTCCACGTATAAAAGCAGAACTGACATCATCTGCTCCAGCCTGCTATGCTCTGGCCATCAGCCCTGATTCCAAGGTCTGCTTCTCCTGCTGTAGTGATGGCAACATTGCAGTGTGGGATTTGCACAACCAGACTCTAGTAAGGCAGTTCCAGGGCCACACAGATGGAGCCAGCTGTATTGACATTTCTAACGATGGGACTAAGTTGTGGACAGGAGGCTTGGACAACACAGTAAGGTCCTGGGACCTGCGTGAAGGACGGCAGCTCCAGCAGCATGACTTTACATCACAGATCTTCTCATTGGGTTATTGTCCAACTGGNGAATGGCTGGCTGTGGGTATGGAAAACAGCAATGTTGAGGTGCTCCATGT
  5   1   1         - In62                            IMAGE:8953710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTACTCCACGTATAAAAGCAGAACTGACATCATCTGCTCCAGCCTGCTATGCTCTGGCCATCAGCCCTGATTCCAAGGTCTGCTTCTCCTGCTGTAGTGATGGCAACATTGCAGTGTGGGATTTGCACAACCAGACTCTAGTAAGGCAGTTCCAGGGCCACACAGATGGAGCCAGCTGTATTGACATTTCTAACGATGGGACTAAGTTGTGGACAGGAGGCTTGGACAACACAGTAAGGTCCTGGGACCTGCGTGAAGGACGGCAGCTCCAGCAGCATGACTTTACATCACAGATCTTCTCATTGGGTTATTGTCCAACTGGGGAATGGCTGGCTGTGGGTATGGAAAACAGCAATGTTGAGGTGCTCCATGTAACCAAGCCAGATAAATACCAGCTACATCTGCATGAGAGCTGTGTCCTCTCGCTTAAATTTGCACACTGTGGAAAATGGTTTGTGAGCACAGGAAAAGATAATCTTCTCAATGCCTGGAGAACACCTTATGGAGCAAGTATATTCCAGTCCAAAGAATCCTCATCAGTGCTGAGCTGTGACATCTCCGTGGATGATAAATACATTGTCACTGGGTCAGGGACAAGAAGGCCACAGTTTATGAAGTTATTTATTAGAGACAAACTCTGCCAATGGACGCTTACTAGTAGCACTTTTCTGTATAATTTCTCCTACCACCTCCCAAGTCCAAAGATTCCAAAAACTATAAGCCACAAGTTATGATGCTCGTCCCCTTCTTTGCAACGTGCTCTACCCAGATTCTTTATATTTCGAATGCTTATTAGACTTGAAATGACTCCAGATACCCTTTAGCAAGTCCACAGAAGAGCATGCTAACTTGACTGTTGATTCCTGATTGATTATACCTGTACTATTTATTTGGTCAGACTCACATGATACGTGTTTATGAGTTGCGATCACAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)