Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ12886.3                           4 END     1           4       25                Fragile X mental retardation 1 [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZT44333.3                            2 END     1           4       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 387.0    0Xt7.1-CAAO5585.3                           67 PI      77          7      650                Unknown (protein for MGC:83457) [Xenopus laevis]
     4 273.0    0Xt7.1-XZG4457.5.5                          45 PI      74         26      669                EphA2 [Xenopus tropicalis]
     5 339.0    0Xt7.1-TGas082d04.3                         32 PI      75          4      652                eph receptor tyrosine kinase [Xenopus laevis]
     6 280.0    0Xt7.1-CAAL19895.5                          12 PI      76        146      655                epha4b; Eph receptor a4b; eph-like receptor tyrosine kinase 2 [Danio rerio]
     7 206.0    0Xt7.1-XZG42466.5                            5 PI      75        230      643                Cek8 [Gallus gallus]
     8 391.0    0Xt7.1-XZT44333.3                            2 PI      94       1442     1680                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012078841 Xt7.1-CABD5196.3 - 21 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     4     4     4     4     3     4     4     4     3     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     8     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9    13    13    12    13    12    13    12    13    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    11    11    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    11    11    11    12    11    12    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    10    11    10    11    10    10    10    10     9    10     9    10     9    10    10    10     7     7     5     5     5     5     5     5     5     5     5     5     3     3     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------A-
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 2e-020     NP_009411.1 Promotes the exit from mitosis by directly switching on the kinase activity ofDbf2. Required for mitosis and sporulation, cell division cycle blocked at 36C.; Cdc15p [Saccharomyces cerevisiae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 2e-042     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bf ---- 7e-049     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-080     NP_494807.1 ephrin receptor type-A, Variable ABnormal morphology VAB-1 (124.7 kD) (vab-1)[Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 6e-098     BAB68344.1 EPH receptor tyrosine kinase [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-114     NP_726591.2 CG1511-PB, isoform B [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-118     BAE06403.1 ephrin receptor [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 6e-125     XP_001196893.1 PREDICTED: similar to Cek8, partial [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bb ---- 8e-127     BAA84734.1 Eph1 [Branchiostoma belcheri] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 1e-160     XP_708456.1 PREDICTED: similar to chicken embryo kinase 5 protein isoform 2 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_775623.2 Eph receptor B1; ELK homolog [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004432.1 ephrin receptor EphB1 precursor; eph tyrosine kinase 2; ephrin receptor EphB1[Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001084070.1 receptor tyrosine kinase [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_422685.2 PREDICTED: similar to Cek6 protein [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAA93527.1 Eph receptor tyrosine kinase [Xenopus laevis]  ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD5196.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------ATG---------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------ATG------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------TGA------------------------------------------TAG---------------------------------ATG------------------------------TGA---------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TGA------ATG---------------------------------------------------------------------------------------------------------TGATGA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld Tad5                                 XZT47367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTACAAAGGGCGCCTGAAGCTCCCTAGCAAGAGGGAAATCTATGTGGCTATCAAAACCCTCAAGGCTGGATACTCAGAAAAGCAGCGAAGAGACTTCCTGAGCGAAGCAAGCATTATGGGCCAGTTTGATCACCCCAATATCATTCGCCTGGAAGGTGTGGTGACCAAAAGCAGGCCTGTTATGATTATCACTGAGTTCATGGAAAATGGAGCCCTGGATTCTTTTCTACGGCAAAACGATGGGCAGTTTACAGTCATTCAGCTGGTGGGAATGCTTAGAGGCATTGCAGCTGGCATGAAGTACCTTTCTGAAATGAACTATGTGCACCGAGACCTGGCGGCAAGAAATATCTTGGTGAATAGCAACTTGGTCTGCAAGGTGTCGGATTTTGGCCTATCCCGGTATCTGCAGGATGACACTTCAGATCCCACATACACCAGTTCCCTGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCT
  5   1   2       bld Gas1      in                     NISC_mq03c02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGATCAAGAGGGAAATCTATGTGGCTATCAAAACCCTCAAGGCTGGATACTCAGAAAAGCAGCGAAGAGACTTCCTGAGCGAAGCAAGCATTATGGGCCAGTTTGATCACCCCAATATCATTCGCCTGGAAGGTGTGGTGACCAAAAGCAGGCCTGTTATGATTATCACTGAGTTCATGGAAAATGGAGCCCTGGATTCTTTTCTACGGCAAAACGATGGGCAGTTTACAGTCATTCAGCTGGTGGGAATGCTTAGAGGCATTGCAGCTGGCATGAAGTACCTTTCTGAAATGAACTATGTGCACCGAGACCTGGCGGCAAGAAATATCTTGGTGAATAGCAACTTGGTCTGCAAGGTGTCGGATTTTGGCCTATCCCGGTATCTGCAGGATGACACTTCAGATCCCACATACACCAGTTCCCTGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCA
  5   1   2       bld Lun1      in                         CABD5196.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGATCACCCCAATATCATTCGCCTGGAAGGTGTGGTGACCAAAAGCAGGCCTGTTATGATTATCACTGAGTTCATGGAAAATGGAGCCCTGGATTCTTTTCTACGGCAAAACGATGGGCAGTTTACAGTCATTCAGCTGGTGGGAATGCTTAGAGGCATTGCAGCTGGCATGAAGTACCTTTCTGAAATGAACTATGTGCACCGAGACCTGGCGGCAAGAAATATCTTGGTGAATAGCAACTTGGTCTGCAAGGTGTCGGATTTTGGCCTATCCCGGTATCTGCAGGATGACACTTCAGATCCCACATACACCAGTTCCCTGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCA
  5   1   2       bld Tad5      out                        XZT44333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATGGAGCCCTGGATTCTTTTCTACGGCAAAACGATGGGCAGTTTACAGTCATTCAGCTGGTGGGAATGCTTAGAGGCATTGCAGCTGGCATGAAGTACCTTTCTGAAATGAACTATGTGCACCGAGACCTGGCGGCAAGAAATATCTTGGTGAATAGCAACTTGGTCTGCAAGGTGTCGGATTTTGGCCTATCCCGGTATCTGCAGGATGACACTTCAGATCCCACATACACCAGTTCCCTGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACC
  5   1   2       bld Brn4      in                         CAAL7474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACTAGCAACTTGGTCTGCAAGGTGTCGGATTTTGGCCTATCCCGGTATCTGCAGGATGACACTTCAGATCCCACATACACCAGTTCCCTGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCAACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAATTCAGGTGACAACATTTTATCAAGCA
  5   1   2       bld Brn2      in                        CAAJ17294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTATCTGCAGGATGACACTTCAGATCCCACATACACCAGTTCCCTGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCCACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAAATCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTT
  5   1   2       bld Neu       in                   TNeu053k13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTATTTGTTTTGGGATTGCTTTTGCAGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGAC
  5   1   2       bld Neu                            TNeu041l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTATTTGTTTTGGGATTGCTTTTGCAGGGTGGTAAAATCCCAGTCAGATGGACAGCTCCAGAAGCCATTGCTTATCGGAAATTCACTTCAGCTAGTGATGTATGGAGTTACGGTATTGTCATGTGGGAAGTCATGTCGTATGGGGAACGGCCATATTGGGACATGTCGAACCAGGATGTTATAAATGCCATTGAGCAAGATTATCGCCTTCCTCCACCCATGGACTGTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCANGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGANGGTCCAAAT
  5   1   2      seed Tad5      in                         XZT32386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCAGCTGCCCTTCATCAGCTTATGCTGGACTGCTGGCAGAAAGATCGCAACAGCCGTCCGCGCTTTGGGGAGATTGTCAACACCTTAGACAAGATGATCCGGAACCCTGCCAGTCTGAAGACAGTGGCTACTATCCCCGCTGTGCCTTCCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCCACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAAATCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGNAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTT
  5   1   2       bld Ova1      in                         CABE1979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTCCAGCCGCTGCTCGACCACTCCATCCCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCAACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAATTCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCCTTCATATTGAAGATGAAGTTGTATG
  3   1   2       bld Neu       in                    TNeu053k13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCCACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAATTCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGAAGGGGTTGTATGGAAGAACGAACATTTTTTTTCTTCTTCTTTGAGGGGCATTTTTTGGCAAAACCAAGGAAAATATATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn2      in                        CAAJ17294.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCCACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAAATCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATGAAAAAATAAACATT
  3   1   2       bld Brn4                                CAAL12112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACATTACAGCCTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCCACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAAATCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAACATATATGAAAAAATAAACATT
  3   1   2       bld Lun1      in                         CABD5196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACATTACAGCTTTTACCTCAGTAGATGACTGGTTGAGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCAACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAATTCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATGAAAAAATAAACATTAAAAAAAAGATCAGGAAGAAAACCTGATGATGTGTCTACCTTTGTGTCCTATATGTTAAAAAATAAAAAATAAATGAGCTGCAAAAAAA
  3   1   2       bld Brn4      in                         CAAL7474.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTGCTATCAAGATGGGACAATACAGAGACATCTTCCTGAGCTCCGGTTTCACCTCCCTGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCAACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAATTCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATGAAAAAATAAACATTAAAAAAAAGATCAGGAAGAAAACCTGATGATGTGTCTACCTTTGTGTCCTATATGT
  3   1   2       bld Tad5      in                         XZT32386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAGCTTGTCGCTCAGATGACCTCAGAGGATCTCCTCAGGATAGGGATAACGTTAGCGGGGCACCAGAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCCACCTCTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACACGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAAATCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATGAAAAAATAAACATTAAAAAAAAGATCAGGAAGAAAACCTGATGATGTGTCTACCTTTGTGTCCTATATGTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Ova1      in                         CABE1979.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAAAATCCTGAACTCTATTCAATCCATGAGGGTCCAAATAAGCCAGTCTCCAACCTTTATAGCATGAGACTTTGGGGACATTGAGGGTCAGGGACTACCCGAGGGTGGGTAGGGGAAATGTAGAGGTCAAGAGGAGGAATGGATTATGCAGTGGGGAAACAGAACTTTGCAATTCAGGTGACAACATTTTATCAAGCATGGAACTTCCATAAAAAGCATAAGGCACTCACAGTGAGTGTTTTTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTTTAAGCCTTATAGCTGGAGGCCCTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTTCCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATTTGTTGCGTGGATGCCCTGTGTCCCCTCATTTTCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTTTGCACACTTCCATTTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATGAAAAAATAAACATTAAAAAAAAGATCAGGAAGAAAACCTGATGATGTGTCTACCTTTGTGTCCTATATGTTAAAAAATAAAAAATAAATGAGCTGCAAATTC
  3   1   2       bld Gas1      in                     NISC_mq03c02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGCAATTCAGGTGACAACATTTTATCAAGCATGGAACTCCCATAAAAAGCATAAGGCACTCACAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTTTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATGAAAAAATAACCATTAAAAAAAAGATCAGGAAGAAAACCTGATGATGTGTCTACCTTTGTGTCCTATATGTTAAAAAATAAAAAATAAATGAGCTGCAAATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Brn4      in                         CAAL8898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCGGTCGGATTCCGGGATATCGCAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATGAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn4      in                         CAAL8898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGTGAGTGTCTCTTGCAGGGCCGGGAAGTTGCATTGTTTCAGTTGTGGTGTCCTTAGAAGAAAATCACTTTTTTTGGAAAAGTTGTGGGAAATTACTGGAAAAGTCTAAGCATTATAGCTGGAGGCACTGTCGGGAAATAAAGGTGCTTACTTTGACCATACTACCAGTTGCAAAGGGATTATGGACCTCATGTTCCGTCAGCTTCATCTGTTGCGTGGATGCCCTGTGTCCCCTCATTTCCGACACAACTGCTGCTTCAGGGAAAGAGGCCGTCTGCACACTTCCATCTACTCTTTTATTTCTTTTGTCTTCATATTGAAGATGAAGTTGTATGGAAGAACGAACATTTTTTTTTCTTCTTCTTTTGCTTGCATTTTTTGGCAAAACAAGGAAAATATATG

In case of problems mail me! (