Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA041j23.5                          9 END     9          36      100                PREDICTED: similar to beta-4C-adrenergic receptor [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012079051 Xt7.1-CABD10642.3 - 25 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD10642.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAAACATCATCAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTTGGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCATGCCCTTTCCAAGGACCTCAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACAGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATATAAAAATATGCTCA
                                                  Xt7.1-CHK-1008229127                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCATCAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTTGGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCATGCCCTTTCCAAGGACCTCAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACAGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATATAAAAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11     9    10     9    10     8     9     4     7     6     7     6     7     8     9     9    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    11    11    11    10    11     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    13    10    14    10    14    10    14    10    14    14    14    13    15    13    15    13    15    13    15    13    15    13    15    12    14    13    15    12    12    11    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    11    12     9    10     9    10     9    10     9    10     9    10     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     6     8     6     8     6     8     6     8     3     6     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                       ...PROTEIN --- Dm ---- 7e-007     NP_524548.1 Dopamine receptor 2 CG18741-PB [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 5e-007     NP_508238.2 DOPamine receptor family member (dop-4) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN --- Br ---- 4e-009     CAA06536.1 dopamine D1/beta receptor [Branchiostoma lanceolatum] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                     PREDICTED - Sp ---- 8e-008     XP_001198071.1 PREDICTED: similar to dopamine D1B receptor [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN --- Bf ---- 4e-010     AAQ91625.1 dopamine D1/beta receptor [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                              PROTEIN --- Mm ---- 5e-015     NP_031445.1 adrenergic receptor, beta 1; beta 1-AR; cardiac beta adrenergic receptor [Musmusculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-016     NP_000675.1 beta-1-adrenergic receptor [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================
                                                                                                                                                                                                         PROTEIN --- Xl ---- 7e-020     CAA70415.1 beta-1 adrenergic receptor [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                         PROTEIN --- ?? ---- 7e-020     NP_001084152.1 beta-1 adrenergic receptor [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                          PREDICTED - Dr ---- 4e-022     XP_685300.1 PREDICTED: similar to Beta-1 adrenergic receptor (Beta-1 adrenoceptor) (Beta-1 adrenoreceptor) [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 7e-024     XP_428541.2 PREDICTED: similar to beta-4C-adrenergic receptor [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                     Xt7.1-CABD10642.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATAG------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG---------ATG------------------TGA---------------------TAG---------------------------TAA------ATG------------------------------------------------------------------------------TAA---------------------ATG---ATG---------TAA------------------------------------------------------TAA---------------------------------------------------------------TAA---------------------------TGATAA---TGA------------------------------------------------TGA---------------------TGA------------------------------------TAA------------ATG---------------------------------------TAG---------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TAA------------------------------TAA------TAA---------------------------------------------------------------------------TAA------------------------TAG------------------------------TAA---------------------TGA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------ATG---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Hrt1      in                         CAAQ1794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATTTTCACCCTGTGCTGGTTGCCCTTCTTCGTGGCAAACATCATCAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTTGGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCATGCCCTTTCCAAGGACCTCAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATG
  3   1   2       bld Hrt1      in                         CAAQ1794.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAAACATCATCAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTTGGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCATGCCCTTTCCAAGGACCTCAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGGCCTCTCGCCCTATAGGAG
  3   1   2       bld Ski1 5g3  out                       CABJ11877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAAACATCATCAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTTGGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCATGCCCTTTCCAAGGACCTCAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAG
  3   1   2       bld Lun1      out                       CABD14894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAACATCATCAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTTGGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCATGCCCTTTCCAAGGACCTCAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGATGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAAAAA
  3   1   2       bld TpA  5g3  out                   TTpA041j23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACATCATCAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTGNGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCACGCCCTTTCCAAGGACCTTAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTTTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAGATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAACGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  out                        XZT47361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAAGTGTTTTGCAGGTCCTTTATAGATGACAATGTGTTTCTCTTTTTGAACTGGTTGGGGTACATCAACTCAGGACTGAACCCTATCATTTACTGCAGGAGCCCTGATTTCAGGAGGGCATTCAGGAAGCTCCTGCGTTGTCCAAGGACTGTTGACCGCAAGTTGCACGCCCTTTCCAAGGACCTCAATAGGTACCCCTATACCTCTGGCACCCACTTGGACTGTGATGGGATCAAACAAGTACCTGATGGACAGGAACCAGGTAACGGCAGCCTGAGCAGTAGCAGTAGGTGCAGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGTGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAACGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAAC
  5   1   2       bld Tbd1      in                        CBXT11052.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAGCAGAACGGAGGAAACCAGCCTGAAAAATGGCAATGCCAACTCCAACCATAAACAGTGATAGGGTTCACTCTCCTCAGGAGCCCCTCTCCTCCATGGTGCACAGCAGCTGAACCAAGTAGTGGGTCAGTATTTGTTGTTGTTGTTGTTGTGTGTCCATGGAGTGACGGGACATAGTGTCTCTTGTGCACAACCTCAGCAGAACAGCCTAGGCTCTGAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAG
  3   1   2       bld Lun1      out                       CABD11933.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTGNCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCC
  5   1   2       bld Fat1      in                         CABC7850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATAACAGGAACAAATGAGTGCTGCTATGATATGTACAGTATTAATTTGACTTGCTGGGGGGCTCGCAGCCTAGTCCTGCTCCGGAGGAAGTAGCGGACAGTAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCC
  5   1   2       bld HdA       in                   THdA053i11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGAAATATTTATGCACTTATGCAGTCAACGTCGCCGAGACAGCCGTGCGTCAGGGAAAACTACTAGACAAATTCATGTTCAAATATTTTTATAACTTGTAAGCCGCCCAAAGAATATGTCCATGAATATTTTGTAAATACCTTGTGTTACCTATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCC
  5   1   2       bld Fat1      in                         CABC8399.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATTTATATGAATTGTATATACTAATTGCACATGACCACTAATGCCAAAGGGGGCTCTCGGCTACTGAGCAAGAAACAAGGAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTANGTGGCCAGACTTATCCAATCA
  3   1   2       bld Tbd1      in                        CBXT11052.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGGAAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAACCAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA003a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAAAAAAAAAAGAGTCTGGGTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCAATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTG
  5   1   2       bld Tbd1      in                        CBXT20810.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCTAAATCCGGAGGGCGCAGATAGATAACAAATGATAACTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGT
  3   1   2       bld Fat1      in                         CABC7850.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGGAGGGCGCAGATAGATAACAAATGATACTTCTGAACAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGCTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCC
  3   1   2       bld HdA       in                    THdA053i11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGGCGCGGATAGATAACAAATGATAACTTTGACCAGCTTTCCAGTTATTCTATATATCCTCCATTCCCTCTGGTTTTAAATGAATTTGTAAATGCAATTGCTGTTGAAAGTCTTTCCCTTACTGCACTGGTGGTTCTGACTCCTAAAACAATGTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTTTAAGGCATTCTGCAGTTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCAAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Tad5      in                         XZT66258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCAGAATGGGAAAAGAACAGAAAGAAACAGACATATACTGGTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCAATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATG
  3   1   2      seed Lun1      out                       CABD10642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTTTCAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACAGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATAGCCTCTCG
  3   1   2       bld Fat1 5g3  out                       CABC10736.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATAGCAATTGCATACACAGATGTCTTTAAAACCACTGGAAATGTGCAATAAATGTATATTAGAAAGTTGCCTAGAATTACAACTTCATTCATTAGGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACAGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATAT
  3   1   2       bld TpA  5g3  out                   TTpA058d01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCAAAAGATGTCTTTTTTGGGTTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCAATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAAGCAACCAGGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATATAAAAATATGCTCACCTGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                         CABC8399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTACTTCCCCTTTAAAATTAAATTTAATATTCTAAGGCATTCTGCAGTTTTTTTTTTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTCTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACAGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATAT
  3   1   2       bld HdA  5g3  out                   THdA012f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTATTTAGTCCTTTTAATATTATTCCAACATGTATGTGGTTGCTGGGGTCTCTGACCCTAAGTTACCAGCATTTTTTGGGACTGCCATTTATAAAAATGCTAAAAATCCACCCCTGACTGTCTGTTTATTTTCTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTTTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTTTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTTTAGTTGTGTTTGTACAATACAAATCATAATATTACCTTTAAATTTGATAAGTGAGTGTCACACTGCTTTTATTCATAATGTTTTTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTTTATTTTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTTTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACAGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATATAAAAATATGCTCACCTGAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TpA       in                    TTpA003a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATTTATAAAAATGCTAAAAATCCACCCCNTGACTGTCTGTTTATTTTTTTTTTTGGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACCAGTGTGTATAATATTTTTATACAGAATTAAACACCAGATATACAGATATATATTTATATAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT66258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCAGCGTCACTGACCTTAGCAGCCAGGTTGCATTTTTAAATCCCAGACTGGAAAGTGTTTGAATAGATTCTGTTTGTATTATGTTTCAAGAATGTATAAATAAAAATCCAGCTCTCCGCGTGATGCAGAACTACAATTCCCATGCCATGCCATTGGACATCAGAGCATTCTGGGAATTGTAGTTTTGCCCTAGGTGGCCAGACTTATCCAATCATTTGTGATTCTAGTTGTGTTTGTACAATACAAATCATAATATTACCTCTAAATCTGATAAGTGAGTGTCACACTGCTCTTATTCATAATGTTTCTGATGTTGGAATTACTGTTATTAGGGGTTACCATATATTCTATTCTTTCATAGGAATTTGTCAGTTTGGCTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTCTAATGTATATTAGTAAGCATACAGTATGTATATACAGTACTAATGTATGGCATTTATTATGGAAAGCAACAGTGTGTATAATATTTTTATACAGAATTAAACACAGATATACAGAATATATTTATATAAAAATATGCTCACCTGAAAAAAAAAAAAAAAGG
  3   1   2       bld Tbd1      in                        CBXT20810.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACTGTTTTTAGGGGTTACCATATTTTTTATTTTTTCATAGGAATTTGTCAGTTTGGGTGCGCAGGACATGTTTATTTTTGAGACAAATCAGTGTATATGAGCTGTACAATTTTAATGTATATTAGTAAGCATCCAGTATGTATATACAGTATTAATGTATGGCATTTATTATGGAAAGCAACAGGGTGTTTAATTTTTTTTTACAGAATTAAACCCAGATTTACAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)