Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012079834 Xt7.1-CABC6996.5 - 16 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABC6996.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAACAAAGTGACAGAGCTTTTAGCTCCCAGTACTAACAAGGCACTATCCGGATACATGCAGTCATGAACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAAAGGCTTGGCAAAACCTGGCACGTATTCCACCATTTTTATGAACGTATGGTTACCAGAGAGTTTTATCTGAATCCATGCATGAGATCTGATTTTAAAAAAATATATGGCAGTTTCTAAATATAAATAAAATGTAAA
                                                  Xt7.1-CHK-1008232272                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTGACAGAGCTTTTAGCTCCCAGTACTAACAAGGCACTATCCGGATACATGCAGTCATGAACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAAAGGCTTGGCAAAACCTGGCACGTATTCCACCATTTTTATGAACGTATGGTTACCAGAGAGTTTTATCTGAATCCATGCATGAGATCTGATTTTAAAAAAATATATGGCAGTTTCTAAATATAAATAAAATGTAAAGAGCAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     3     3     3     3     4     4     4     4     5     5     6     6     9     9     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     8     9     8     9     9    10     9    10     9    10     9     9    10    10     9     9     9     9     9     9     9     9     8     9     8     9     8     9     9    10     9    10     7     7     7     7     6     6     7     7     5     6     8     8     8     8     8     8     7     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3
                                               BLH ATG      64    1360                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      64     171                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      64     872                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      64       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      37       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      64      89                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Bf ---- 1e-011     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Br ---- 1e-019     AAQ96651.1 elastase I [Branchiostoma belcheri tsingtaunese] -----------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 2e-028     NP_501379.1 serine protease 22D (4I977) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Ci ---- 1e-037     CAD24308.1 putative coagulation serine protease [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 7e-039     XP_001202239.1 PREDICTED: similar to CG18735-PA, partial [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 1e-041     NP_649132.1 CG9372-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bb ---- 5e-045     BAC75888.1 mannose-binding lectin associated serine protease-1 [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 1e-119     NP_956650.1 hypothetical protein MGC63987 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 5e-124     NP_032960.2 protein C [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 5e-126     NP_000303.1 protein C (inactivator of coagulation factors Va and VIIIa) [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 2e-141     NP_989772.1 anticoagulant protein C precursor [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Xl ==== 0          AAH54968.1 Unknown (protein for MGC:64425) [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 0          NP_001080424.1 protein C [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 0          AAH89695.1 Unknown (protein for MGC:107972) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABC6996.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAG------------TAGATG---------------ATG---------ATG------------------------TAATAATGA---TAG---------ATG---------------------------------------------------TAA------------------------------------------ATG---------------------------TGA---------TGA---------------------ATG------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   1           AbdN FL                     IMAGE:7025619.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCAAACAAAGTGACAGAGCTTTTAGCTCCCAGTACTAACAAGGCACTATCCGGATACATGCAGTCATGAACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAAAGGCTTGGCAAAACCTGGCACGTATTCCACCATTTTTATGAACGTATGGTTACCAGAGAGTTTTATCTGAATCCATGCATGAGATCTGATTTTAAAAAAATATATGGCAGTTTCTAAATATAAATAAAATGTAAAGAGCAGCTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld AbdN FL                            IMAGE:7025619                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAACAAAGTGACAGAGCTTTTAGCTCCCAGTACTAACAAGGCACTATCCGGATACATGCAGTCATGAACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAANATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCCGGCTTGGTTGATATGAACATTCGCAAAGCTGGGAGGATACAGAGCAGCAGTTTGCTTGTGATCA
  5   1   2       bld Abd0 5g                            IMAGE:7018031                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAACAAAGTGACAGAGCTTTTAGCTCCCAGTACTAACAAGGCACTATCCGGATACATGCAGTCATGAACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGAT
  5   1   2       bld Abd0 5g                            IMAGE:7016438                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGCTTTTAGCTCCCAGTACTAACAAGGCACTATCCGGATACATGCAGTCATGAACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAGGACGCAAAGGGGATAGTCCTTGGCAAGGCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGG
  5   1   2       bld Abd0 5g                            IMAGE:7016368                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGCACTATCCGGATACATGCAGTCATGAACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTC
  5   1   2      seed Liv1      in                         CAAR4975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACTGTCTACCCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAA
  5   1   2       bld Fat1      in                         CABC6996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCTGCCGAATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGANAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATNCAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAA
  3  -1   2       bld Liv1      in                         CAAR1876.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAANATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATC
  5   1   2       bld Liv1      in                         CAAR4301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCAT
  5   1   2       bld Liv1      in                         CAAR4915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATATGGTGGCCTCTTATTTTTTACTTCATTCTGGTCATTTGGGAGTCTCCAAAAGCTAAAAGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGCAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACT
  5   1   2       bld Liv1      ?                          CAAR8169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGATTCAATTCGGCACGAGGTGGGAGTCTCCAAAAGCTAAACGCAGCCCAGTGTTCTCCAGCAGACAGGAGGCCAATCATGTGCTGAAAGTTCGGAAGCGTGCTTATAACTTTATGGAGGAGCTGAAGCCGGGCTCCCTGGAACGGGAGTGCATAGAAGAGAAGTGTGATTTCGAGGAGGCCTTTGAAATTTTTGAGACTCGGGAGGACACACTTAACTTTTGGGCAAAATATTTTGACGGGGATCAGTGTCAGTCCAATCCATGTGTCAATGCTGTGTGCAAGGATGGAATTGGAAGATTCGACTGCATCTGTAATGAGGGCTGGGAAGGTCGCCTGTGTAAAATTGAGGTTGAGTATTCCAACTGCTCATTGAATAATGGAGGATGTATGCACTTCTGCACTAATACAGAGAATAGCACAAGCCGTGTGTGTAGCTGTGCCCAAGGCTACCGGTTAAATGATGACTACAAGACGTGCCAACCAGCAGTGGAATTCCCCTGTGGGAAATTAAAAATTGTAGACTATGGATATTCCGCTCGTCTCACTGGAGCAAAGCAAGGACGCAAAGGGGATAGTCCTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCCATATGTCTGCC
  5   1   2       bld Liv1                                CAAR12876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGCAGGCCATGTTACGTTATGAGAAGAAGCTAAAATGTGGAGGGGTCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTTAAAAGAACATTAC
  3   1   2       bld Fat1      in                         CABC6996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTGATTCATCCTTTCTGGGTTCTGACTGCAGCTCACTGCGTTACACATGCTGGAAAGTACACTGTCCGGCTTGGTGAATATGACATTCGCAAGCTGGAGGATACAGAGCAGCAGTNTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCCTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAA
  3   1   2       bld Liv1      in                         CAAR4301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGAGCAGCAGTTTGCTGTGATCAAGATCATTCCCCATCCTGAGTATGAAAGTAACACAAACGACAATGATATCGCCNTACTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAAAGGCTTGGCAAAACCTGGCACGTATTCCACCATTTTTATGAACGTATGGTTACCAGAGAGTTTTATCTGAATCCATGCATGAGATCTGATTTTAAAAAAATATATGGCAGTTTCTAAATATAAATAAAATGTAAAGAGCAGCTTGC
  3   1   2       bld Liv1      in                         CAAR4975.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGACAATGATATCGCCCTATTGCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAAAGGCTTGGCAAAACCTGGCACGTATTCCACCATTTTTATGAACGTATGGTTACCAGAGAGTTTTATCTGAATCCATGCATGAGATCTGATTTTAAAAAAATATATGGCAGTTTCTAAATATAAATAAAATGTAAAGAGCAGCTTGC
  5  -1   2       bld Liv1      in                         CAAR1876.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCGCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAAAGGCTTGGCAAAACCTGGCACGTATTCCACCATTTTTATGAACGTATGGTTACCAGAGAGTTTTATCTGAATCCATGCATGAGATCTGATTTTAAAAAAATATATGGCAGTTTCTAAA
  3   1   2       bld Liv1      in                         CAAR4915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCTTGTACAGCCAGTTGTCTATAACAAGTATATCCTGCCCATATGTCTGCCCAGTGTAGATCTTGCTGAAAGTAACCTAACGATGGATGACACTGTAGTCGCGGTTACTGGTTGGGGGAGAGAAGATGAAACGGCCTTAAACTATTCCAGTGTGCTTAGCTACATACAGATCCCCATTGCCCCACGGAATCAGTGTGCTGAGACTCTGAAAGATGGAGTGTCTGACAATATGCTGTGTGCGGGACAGCTGGGACATATACAAGATGCCTGCTATGGTGATAGTGGTGGACCTATGGTCACTAAGTTTGGAGAAACCTGGTTTCTGGTGGGGCTGGTAAGCTGGGGGGAAGGCTGTGGGAGACTTAATAATTTTGGTGTTTATACCAAAGTCAGCCGTTATCTGGACTGGATTGCACAAAAGATGGTAGAGTATGAAGAAGCCCAACGCCTCTCTGCGGCATCCCAGACAGAAAAGCAAAATGTCAACAAATCCCGGAAAATCCGACCATAGCTTAGGGGAAACTAGATGGCTACCCAAGTTGAAATGTATTTTTTCATGCCCAGTAAAAGAACATTACAATGGTAATAATGAATCTAGAAAACAAAAATGCTTTTCTTATTGGGAAGAAAAATATCTCCATGTCTAAGTTTTGCTGTGCTTTAAATAAAAGGCTTGGCAAAACCTGGCACGTATTCCACCATTTTTATGAACGTATGGTTACCAGAGAGTTTTATCTGAATCCATGCATGAGATCTGATTTTAAAAAAATATATGGCAGTTTCTAAATATAAATAAAATGTAAAGAGCAGCTGCAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)