Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 77%

 1012079851 Xt7.1-CAAO9360.5.5 - 22 ESTs
                                                                       .-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAO9360.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACAGATGGTGGGACAAATGGTGGGTTCTAGATAAAGGAACCCTGTTTTATCCCCACAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTCGTTTATTACCAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008230063                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGTGGGACAAATGGTGGGTTCTAGATAAAGGAACCCTGTTTTATCCCCACAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTxxTTxxTTACCAAGAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2     3     2     3     2     3     2     3     2     3     3     3     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     8     9    10     9    10     9    10     9    10    10    10    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    13    14    13    14    14    15    14    15    15    16    17    18    17    18    17    18    15    16    15    16    15    16    15    16    15    17    15    17    15    17    14    17    10    17     9    16     8    16     9    16     9    16     8    16     9    16     8    15     8    15     8    15     8    15     8    15    10    16     7    16     7    16     7    16     6    15     6    15     6    15     6    15     6    15     6    15     6    15     6    15     6    13     6    13     5    13     5    12     5    12     4    10     3     9     3     9     2     6     3     4
  5   1   2                                         Xt7.1-TNeu124a09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAACGAGCAGAGAATGGCCTGCTCCAGCAGCCCCAGGTCCAGCCTGGCCATTTGGCTACCGAATTCCCCTGGATGAAAGAGAAGAAATCGGCAAAGAAGAGCAGCCAAGGGTCCCCCCAGGCCCTTATTCCCCCTCCTGAGTCTGCAGGGGGGTCTCCTGCAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGCCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCCATGTTAATAAATCTTACGTTTATACCAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAO9360.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGGACAAATGGTGGGTTCTAGATAAAGGAACCCTGTTTTATCCCCACAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACTTACGTTTATTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                               BLH MIN      37      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH OVR     250     146                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               ORF LNG     250       4                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 3e-020     NP_001021164.1 abnormal cell LINeage family member (lin-39) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================
                                                                       PROTEIN --- Sp ---- 2e-020     NP_999815.2 homeobox protein Splox [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 7e-023     CAJ82652.1 homeo box B3 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bf ---- 9e-028     CAA48180.1 Amphihox3 [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ci ==== 2e-030     BAE06499.1 transcription factor protein [Ciona intestinalis] ============================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Dm ---- 8e-032     NP_996161.1 CG31481-PD, isoform D [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ---- 5e-048     NP_001079219.1 transcription factor Hoxa2b [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Gg ---- 2e-049     NP_990481.1 Hoxa2 protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 4e-051     NP_002136.1 homeo box B2; homeo box 2H; homeobox protein Hox-B2; K8 home protein [Homosapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PROTEIN --- Mm ---- 4e-053     NP_598793.2 homeo box B2 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN --- Dr ---- 1e-053     NP_571191.1 homeo box B2a; homeobox gene B-2 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 1e-058     AAZ52558.1 transcription factor Hoxb2 [Xenopus laevis] ----==========================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAO9360.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG------------------TAA---TAG------TAA---------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TAAATG------TAATAA---------TAA---------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2                                         Xt7.1-TNeu124a09.3                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAACGAGCAGAGAATGGCCTGCTCCAGCAGCCCCAGGTCCAGCCTGGCCATTTGGCTACCGAATTCCCCTGGATGAAAGAGAAGAAATCGGCAAAGAAGAGCAGCCAAGGGTCCCCCCAGGCCCTTATTCCCCCTCCTGAGTCTGCAGGGGGGTCTCCTGCAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGCCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCCATGTTAATAAATCTTACGTTTATACCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008296120                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAGCAGAGAATGGCCTGCTCCAGCAGCCCCAGGTCCAGCCTGGCCATTTGGCTACCGAATTCCCCTGGATGAAAGAGAAGAAATCGGCAAAGAAGAGCAGCCAAGGGTCCCCCCAGGCCCTTATTCCCCCTCCTGAGTCTGCAGGGGGGTCTCCTGCAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGCCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCCATGTTAATAAATCTTACGTTTATACCAAAAAAAAAAAAAAAAAA
  5   1   4      seed Neu  5g3  in                   TNeu124a09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAACGAGCAGAGAATGGCCTGCTCCAGCAGCCCCAGGTCCAGCCTGGCCATTTGGCTACCGAATTCCCCTGGATGAAAGAGAAGAAATCGGCAAAGAAGAGCAGCCAAGGGTCCCCCCAGGCCCTTATTCCCCCTCCTGAGTCTGCAGGGGGGTCTCCTGCAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGCCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGAT
  3   1   4      seed Neu  5g3  in                    TNeu124a09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCCATGTTAATAAATCTTACGTTTATACCAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAO9360.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGGACAAATGGTGGGTTCTAGATAAAGGAACCCTGTTTTATCCCCACAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACTTACGTTTATTA
                                                  Xt7.1-CHK-1008296122                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATGGTGGGTTCTAGATAAAGGAACCCTGTTTTATCCCCACAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACxTxxxTTTATTACCAAGA
  5   1   1           TbA  FL                     TTbA055n09.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACCAAGAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext HeRe 5g3  in                      EC2CAA2BE03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAAGAAATCCACTGGCCACATGGCAGTAGTAGAGTTAACTCGGTGGGACAGATGGTGGGACAAATGGTGGGTTCTAGATAAAGGAACCCTGTTTTATCCCCACAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCGGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCCGTCCACTTC
  5   1   2       ext HeRe      in                     EC2CAA43BG08.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGGACAGATGGTGGGACAAATGGTGGGTTCTAGATAAAGGAACCCTGTTTTATCCCCACAGAACCCCCTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGAC
  5   1   2   32  ext Tad5 5g                              XZT38252.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGGCTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTAT
  5   1   3        nb TbA  FL   in                   TTbA055n09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCACGATGCCGGCGGCGGATCCAGAAGACTGCGCACCGCATACACCAACACCCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCANAGATCTGCAGAACTTAGATTTTTAACGAANATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACT
  5   1   2       ext Te5       in                         CAAO9360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAACTCCTGGAGCTGGAGAAAGAATTTCACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTTAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCANTTGTTATTTATTTAAGTCTCAGGAAT
  5   1   2       ext BrSp 5g3  in                    EC0CBA002AF01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGACTTTAATAAATACTTGTGCCGACCCAGGAGGGTGGAGATAGCGGCTCTGCTGGATCTGACTGAGAGACAGGTCAAGGTTTGGTTCCAGAACCGGAGGATGAAGCACAAGAGACAAACCCAGCACAAGGACTCGCAGGACGGGGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCCGTCCACTTCT
  5   1   2       ext Ski1      in                         CABJ3725.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGCCCGNGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACCAAGAAAAAA
  3   1   2       ext Ski1      in                         CABJ3725.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGCACAGTTACTCGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGCCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACCAAGAAAAAA
  3  -1   3        nb Lun1      in                         CABD3808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATT
  5  -1   3        nb Lun1      in                         CABD3808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAACCCCGAAGATGGCGAACCCCTGGACGATGGAGACGATAGTCCGGTCTATCACCAGGGATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTCTATTAGCGATTTGATAATTATT
  3   1   3        nb Brn4                                 CAAL9305.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGGATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTTAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACC
  3   1   3        nb TbA  FL   in                    TTbA055n09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATAGTAATGACTCTTTAAGGGAACAGGAGATCCGCAAAGATCCCAGCACAGCAATGCCTTCAAGCAAGGAGTTAACCCCCAGCAGCCCTTTATACCCAACGCCTACTACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTTTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTTTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTTTCCATAGTCCTGTCCACTTTTCAGAGGAAGATATTGACTTTTTTACCAGCACACTTTGTAGCAAAGATTTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATTTTAGATATACTAAAGCGGGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTTTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACCAAGAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext HeRe 5g3  in                      EC2CAA2BE03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACTGATTCCGAGGGCAGAATAGAGGTGGGTAGCATGGACAATGTACTCTCACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTCTCCTCGGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCCGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCTCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCGTAGTTGATATAA
  3   1   2       ext HeRe      in                     EC2CAA43BG08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAAACCCCCGACAATTCCTTATTGTCAGAGCTGACTTTATTTTCCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCCGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATT
  3   1   2       ext Te5       in                         CAAO9360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCAGACTCCTGCCTACACATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTTTCAGAGGAAGATATTGACTTTTTTACCAGCCCACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATTTTAGATATACTTAAGCGGGAAGGGGTCCTCTATATTTATTTTAAAATATCAGACCCACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGGGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAAGGTCTTTATAATAAAATGTATGTTAAGATTT
  5   1   2       ext Tad5                                 XZT36190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTCAGACGGTATCACAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTTAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACCAAANAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu       in                    TNeu079e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACCAAGCTTTCCAAGTTTTTAATTCGTTTTTAACTCTGAGTAGGTTCAGATAAACAAATAAAAATTTCAACTTTAGAATAAAGGAGGAATTTACAACTACCCATTAGTTAAGATTTATACAATATATAGGGAAACGTGTTGGCCTACAAATCGTTTAAAATGTATATCGAATTATTTGTTTTGAAACCTATGTAATATATATTTGCTTTAAAATAAAAATCCACCCACGGATTTATTATTTTATATATTTAAGTTAAATAACGGATTGTGAGATTTAGTTCTTTTAGACGGTTACTATTTTGGCATTTGTTTTTAAAAAAAAAAAAAAAAAA
  5   1   2       ext Neu       in                   TNeu079e12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGCCTGCACGGCTCTCTCCATAGTCCTGTCCACTTCTCAGAGGAAGATATTGACTTTCTTACCAGCACACTTTGTAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCGCTAGTCATATCAGTATTTATGTATCCTAACCGCTTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGCTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATG
  3   1   2       ext BrSp 5g3  in                    EC0CBA002AF01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGCAAAGATCTGCAGAACTTAGATTTTTAACGAAAATTAATGTTTTTTTTTTGCAAAGTCTAATCTTAGATATACTAAAGCGTGAAGGTGTCCTCTATATTTATTTTAAAATATCAGACACACGTCTCTAGTCATATCAGTATTTATGTATCCTAACCGCGTAAATTAGCTATTTTCATTTGCTTGCTAATTAGAAGGCATTTTTTTTTTTGGATTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTCTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTCCAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tad5                                 XZT14207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCATTTTTTTTTTGGTTAGACAAATGGATCAATTGTTATTTATTTAAGTCTCAGGAATTTCAAGGTACGTTTTCGATTTTGTTATACAGGATTCATTATGCAGATTTCGTTTTATGTTATTTATGTAAAGCCTTTATTAGCGATTTGATAATTATTTATTGTACGTTATTTTCCTAGTTTATATAAATGTCTTTATAATAAAATGTATGTTAAGATTTCGCCATGTTAATAAATCTTACGTTTATTACCAAGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)