Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG3666.5                             6 END     3          27       60                vg1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012080808 Xt7.1-TEgg016d06.3 - 11 ESTs
                                                                       ..-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg016d06.3                                                                         TCCTTCCTAAACCAATCAAAGTGAATAATTACTGATAAACTGATAACAAGGATGTGGCTTAAATGTGGGCAATGGTTCTGTTTGCTACAGATCCACATTCCGTCATGGAGTTCATGGCCTGTTAGAAAAATATCACTGTGCTACAGGCAATTTCTAATTTAATTTTATAACTCTCTCTTATAGATTGTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATTCACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCTGAATAAATCATATTTGGATTTG
                                                  Xt7.1-CHK-1008235114                                                                               CTAAACCAATCAAAGTGAATAATTACTGATAAACTGATAACAAGGATGTGGCTTAAATGTGGGCAATGGTTCTGTTTGCTACAGATCCACATTCCGTCATGGAGTTCATGGCCTGTTAGAAAAATATCACTGTGCTACAGGCAATTTCTAATTTAATTTTATAACTCTCTCTTATAGATTGTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATTCACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCTGAATAAATCATATTTGGATTTGGTTAAA
                                                      consensus depths                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    11    10    11    11    11    11    11    11    11    11    11    10    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     6     5     6     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                                    Xt7.1-TEgg016d06.3                                                                                                         TGATAA---------------------TAAATG------ATG------------------------------ATG------ATG------TAG------------------------------------------TAA------------------------TAA---------------------------------TAA------------------------------------------TGA---------------------------TAA---------TGA------------------------------TAATGATGATGATAA---------------------------TAA---------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------TAA---------------TGA------ATG---------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------ATG---------------------------------------------------TAG------------------------------TGA------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                              ]
  3  -1   2       bld Ova1      in                         CABE6474.3p TTGAGTCTGCCTCTGTATTTCTGTTAATGTGTGCTACATTTGTGTGCTTGGTATTCATATAGGAGTATTTATTCCTTCCTAAACCAATCAAAGTGAATAATTACTGATAAACTGATAACAAGGATGTGGCTTAAATGTGGGCAATGGTTCTGTTTGCTACAGATCCACATTCCGTCATGGAGTTCATGGCCTGTTAGAAAAATATCACTGTGCTACAAGCAATTTCTAATTTAATTTTATAACTCTCTCTTATAGATTGTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATTCACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGNGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCCTATGCCTAATGCTTTACCAT
  5   1   2       bld Gas       in                   TGas113d01.p1kSP6                                                             GGGAGTATTTATTCCTTCCTAAACCAATCAAAGTGAATAATTACTGATAAACTGATAACAAGGATGTGGCTTAAATGTGGGCAATGGTTCTGTTTGCTACAGATCCACATTCCGTCATGGAGTTCATGGCCTGTTAGAAAAATATCACTGTGCTACAGGCAATTTCTAATTTAATTTTATAACTCTCTCTTATAGATTGTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATTCACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTG
  5  -1   2       bld Ova1      in                         CABE6474.5p                                                                                                                                                                         ATTCCGTCATGGAGTTCATGGCCTGTTAGAAAAATATCACTGTGCTACAAGCAATTTCTAATTTAATTTTATAACTCTCTCTANTAGATGNTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATTCACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCTTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTG
  5   1   2       bld Egg       in                   TEgg016d06.p1kSP6                                                                                                                                                                                              CCTGTTAGAAAAATATCACTGTGCTACAGGCAATTTCTAATTTAATTTTATAACTCTCTCTTATAGATTGTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATACACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGC
  3   1   2      seed Egg       in                    TEgg016d06.q1kT7                                                                                                                                                                                              CCTGTTAGAAAAATATCACTGTGCTACAGGCAATTTCTAATTTAATTTTATAACTCTCTCTTATAGATTGTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATACACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCTGAATAAATCATATTTGGATTT
  3   1   2       bld Egg                             TEgg016d01.q1kT7                                                                                                                                                                                                   TAGAAAAATATCACTGTGCTACAGGCAATTTCTAATGTAATTTTATAACTCTCTCTTATAGATTGTCATTCTTAATGTATTCACACTTCTGCATTATCCACTAATTCTTAATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATACACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACGCAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCTGAATAAATCATATTTGGATTTGGTAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas113d01.q1kT7                                                                                                                                                                                                                                                                                                                 ATTAAGTGCTAATAAGGGGGTGGGGCATCATATTGATTTGCCTTGAACGTTAGCAGCTAAGGAGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATTCACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCTGAATAAATCATATTGGATTTGGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 PIPE out                         XZG3666.3p                                                                                                                                                                                                                                                                                                                                                                               AGCATATATCCTAAAATCCACTTTGAACAAATGATGTATTTTTCACTATATTGTATTAATGATGATGATAATGTAATGTGGTGATTGCTCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATACACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCTGAATAAATCATATTTG
  5   1   2       bld Egg                            TEgg117o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGTTTCACTAAAATGGGGTAGGGTACTGGCACTATTCACTGCAAAGAGGTATACTCCTCATAAATGGATAAAATTGTCCTTATGAATTTAGCTTCTCAGGCAGGTTGGGACCTAACAGGACATTTGCACTGGTGAAATGTTGGTTACACTGTGCTTCACACACAAACATAGGGAACACAAATACCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCACTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTG
  3   1   2       bld Egg  FL   ?                     TEgg005k01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGTTGGTTACACTGTGCTTCACACACAACCATAGGGAACGCAAATCCCCTCTAATTCCAGTTTTGGCAAAGAAATAATATGTCCCAAACATTATTCATCCTATAATGGGGAGTCCCAGCACTATGGACATCGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTATGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGGTTTCCCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATGGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCCGAATAAATCATATTTGGATTTGGTTAAAAAACCCCCCCTTTTTGGAAAAAAAAAAAA
  3   1   2       bld Gas7      out                        XZG52137.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGACATAGGGAGCACAAATGCCCTCTAATTCCAGTTTTTGCAATGAAATAATATGTCCCAAACATTATTCATCCTATACTGGGGAGTCCCAGCGCTATGGACATTGATGCTGCTGGCATACAAGTGGTATTTAAACACATTTGTTTTTAAAAATATGTATTTTAAACACTCCAATGTTTTTACACTGCCTGTCCGGCATTTGTCTGCAGAGAGGCAACTTAACTTATGCCTATTGCTTATCATTACCTATTGCTTATTGCTTTACCATAGAAGAGTTTCCTATAAAGGAAAGAAGTGGGTAAAATATAACTTGCCTTGGAAACATACAACCATACAAAACCCCTAAACTAACAGTAATGAACATAGTAGTATGTGTGCTATAGTTGGAGAGCCACAGGTTTGGCTACCAGGGTCTGTCTGTCTTTAGATATTTGTCAATTGTATACAGGATATTTCCTGAATTGTAAACTTATTGGTTTTAAATTCTGAATAAGTCATATTTGGATTTGGTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)