Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD7984.5                           18 END     2          18       11                (no blast hit)
     2   1.0    0Xt7.1-CAAN4636.3                           13 END     6          54       46                hypothetical protein LOC563356 [Danio rerio]
     3   2.0    0Xt7.1-CBWN3813.3                            5 END     1           9       20                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012081289 Xt7.1-CAAO8868.5 - 11 ESTs
                                                                       ..-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO8868.5                                                                                   GAAGCGCTGGTGGGTGGTTAACGGTTCGGCCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACTGTGCTTGTCGAGGCAGCTGCCCCCCCAGCTGCTGCTGGATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCAGGATGGAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCTGGCCTTTAATGCAGTAACTGGATTCAGCCTGTGGGGGGCAGTGTTGTCCATGGGATTGGTGTGCACGCTCTACACAACCCTGGGTGGCCTGAAGGCCGTTATCTGGACAGACGTCATACAGACCCTGGTGATGTTTGCAGGGCAGCTGGCAGTTATTATTGTTGGTACCATAAAGGTTGGGGGCTTCGACCAGGTGTGGAACATTGCTACAGAAAATAACAAGATTGCCGGTGTAAATTGGAACCCTGACCCTTTCGAACGTCATTCCTTCTGGTCTC
                                                  Xt7.1-CHK-1008235417                                                                                         CTGGTGGGTGGTTAACGGTTCGGCCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACTGTGCTTGTCGAGGCAGCTGCCCCCCCAGCTGCTGCTGGATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCAGGATGGAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCTGGCCTTTAATGCAGTAACTGGATTCAGCCTGTGGGGGGCAGTGTTGTCCATGGGATTGGTGTGCACGCTCTACACAACCCTGGGTGGCCTGAAGGCCGTTATCTGGACAGACGTCATACAGACCCTGGTGATGTTTGCAGGGCAGCTGGCAGTTATTATTGTTGGTACCATAAAGGTTGGGGGCTTCGACCAGGTGTGGAACATTGCTACAGAAAATAACAAGATTGCCGGTGTAAATTGGAACCCTGACCCTTTCGAACGTCATTCCTTCTGGTCTCTGGCGA
                                                      consensus depths                                                                                        2     2     4     4     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9     9     9     9     9     9     8     9     8     8     7     7     6     6     5     5     5     5     5     5     4     4     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                               ----C-------
                                                                   SNP                                                                                                                                                                                                                                                           -------G----
                                                                   SNP                                                                                                                                                                                                                                                                       ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                       -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                               ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                               -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -------T----
                                               BLH ATG     392      25                                                                                   
                                               BLH MIN     179      87                                                                                   
                                               BLH OVR     392     849                                                                                   
                                               EST CLI       4       7                                                                                   
                                               ORF LNG     392      46                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 2e-038     NP_001041067.1 ZK822.5a [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ==== 6e-065     NP_611465.2 CG10444-PA [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 2e-069     XP_416173.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xl ---- 7e-071     AAP82285.1 sodium solute transporter Vito-a [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- ?? ---- 7e-071     NP_001084454.1 electrogenic sodium monocarboxylate cotransporter [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 2e-077     XP_787078.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 2e-097     NP_808538.1 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 3e-099     NP_066918.1 solute carrier family 5 (sodium-dependent vitamin transporter), member 6 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Dr ==== 2e-108     NP_001020700.1 hypothetical protein LOC563356 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 8e-133     AAH75109.1 Solute carrier family 5 (sodium-dependent vitamin transporter), member 6 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO8868.5                                                                                                                                     TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------TAA------------------------------------------TGA------------------------------------TAG------TAA------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2       bld Te4       out                       CAAN10895.5p                                        CTTGTGGAGAGGCTTCGCCGTGCCAGTGGTTAGTCAGTACCTGGAAGCGCTGGTGGGTGGTTAACGGTTCGGCCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACTGTGCTTGTCGAGGCAGCTGCCCCCCCAGCTGCTGCTGGATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCAGGATGGAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTA
  5   1   2       bld Te5       out                        CAAO8868.5p                                                                                   GAAGCGCTGGTGGGTGGTTAACGGTTCGGTCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACCGTGCTTGTCGAGGCGGCTGCCCCCCTAGCTGCTGCTGTATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCTGGATGGAGGCAGCAATGCTGGAGTGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACAAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACTGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCAATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACTGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCTGGCCTTTAATGCAGTAACTGGATTCAGCCT
  5   1   2   14  bld Te4  5g3  out                        CAAN4636.5p ......................................................................................CGCTGGTGGGTGGTTAACGGTTCGGTCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACCGTGCTTGTCGAGGCGGCTGCCCCCCTAGCTGCTGCTGTATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCTGGATGGAGGCAGCAATGCTGGAGTGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACAAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACTGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCAATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACTGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGA
  5   1   2   14  bld Brn2 5g3  out                       CAAJ20007.5p ............................................................................................TGGGTGGTTAACGGTTCGGCCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACTGTGCTTGTCGAGGCAGCTGCCCCCCCAGCTGCTGCTGGATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCAGGATGGAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGT
  5   1   2   14 seed Te5  5g3  out                       CAAO11520.5p ..................................................................................................GTTAACGGTTCGGCCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACTGTGCTTGTCGAGGCAGCTGCCCCCCCAGCTGCTGCTGGATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCAGGATGGAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ13209.5p ...................................................................................................TTAACGGTTCGGCCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACTGTGCTTGTCGAGGCAGCTGCCCCCCCAGCTGCTGCTGGATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCAGGATGGAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTTCATCTTCCAG
  5   1   2   20  bld Te1  5g                             CBWN15324.b1 .........................................................................................................GTTCGGCCAGTACCGTATGCGACTGCCTAGTCACTGTGTGAAGAGGTGAAGCCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACTGTGCTTGTCGAGGCAGCTGCCCCCCCAGCTGCTGCTGGATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCAGGATGGAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGC
  5   1   2   14  bld Te4  5g3  out                        CAAN6177.5p ..............................................................................................................................ACTGCCTAGTCACTGTGTGAAGAGGTGAAACCGGGACAGGCCAGCTGGGAGCGGTATTGGGCCACTTGCAGATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACCGTGCTTGTCGAGGCGGCTGCCCCCCTAGCTGCTGCTGTATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCTGGATGGAGGCAGCAATGCTGGAGTGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACAAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACTGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCAATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACTGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCTGGCCTTTAATGCAGTAACTGGATTCAGCCTGTGGGGGGCAGTGTTGTCCATGGGATTGGTGTGCACGCTCTACACAACCCT
  5   1   2       bld Tbd0 FLq                           IMAGE:6980848                                                                                                                                                                                                 TCATTATACATTTACCCGGGGAGCAGCGACCTTCCTGCGCCAGAATACACCGTGCTTGTCGAGGCGGCTGCCCCCCTAGCTGCTGCTGTATCTCAGAGAGGGACTGAGGAGAAGCCGGGGTGCTGGATGGAGGCAGCAATGCTGGAGTGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACAAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACTGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCAATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACTGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCTGGCNCTTTATGCAGTAACTGGATTCAGCCTGTGNGGGGG
  5   1   2       bld Te5       out                        CAAO2634.5p                                                                                                                                                                                                                                                                                                                                  GAGGCAGCAATGCTGGAATGTTAAGCAGAGCGGAAGAACGAATGCTGTGAAGGGGACAGAAATGGCTGAGTGGGACCCCTAGCCGCTTATTTGCAGCCCCCCCTATAGAGACACTAAGCAGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACGGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCGATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACCGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCTGGCCTTTAATGCAGTAACTGGATTCAGCCTGTGGGGGGCAGTGTTGTCCATGGGATTGGTGTGCACGCTCTACACAACCCTGGGTGGCCTGAAGGCCGTTATCTGGACAGACGTCATACAGACCCTGGTGATGTTTGCAGGGCAGCTGGCAGTTATTATTGTTGGTACCATAAAGGTTGGGGGCTTCGACCAGGTGTGGGACATTGCTACAGAAAATAAACAAGATGCCGGTGTAAAATGGAACCCTGACCCTTTCGAACGTCATTCCTTCTGGTCTCTGGCGA
  5   1   2   14  bld Te5  5g3  out                        CAAO6837.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTTTGTTCCTCAGCTGCACGGCACAAAGCAACAATGAGGTTCACCACTGTGGACTACATTATCTTCGTCCTCCTCCTGGTCCTTTCCTCCGCAATAGGGCTGTACTATGCCTTGAGCGGGGGCAAGCAGCGCACCATGCAGGAGTTCCTGCTGGCCAATCGTAGCATGAGTTTCCTGCCCATCTCTCTTTCCCTCCTGGCCACCTTTCAGTCAGCGGTAGCCATCCTGGGGGTCCCCTCGGAGATCTACCGATTTGGCACTGAGTATTGGTTCCTGGGCTGCTCCTACATTATCGGACTGCTCATTCCAGCCCACATCTTCATTCCAGTCTTTTACCGGTTACGGCTCACAAGTACCTATGAGTACCTGGAGCTGCGGTTCAGTAAAGCTGTGCGAATCTGTGGGACAGTAACCTTCATCTTCCAGATGGTGATCTACATGGGAGTGGTCCTTTATGCTCCAGCTCTGGCCTTTAATGCAGTAACTGGATTCAGCCTGTGGGGGGCAGTGTTGTCCATGGGATTGGTGTGCACGCTCTACACAACCCTGGGTGGCCTGAAGGCCGTTATCTGGACAGACGTCATACAGACCCTGGTGATGTTTGCAGGGCAGCTGGCAGTTATTATTGTTGGTACCATAAAGGTTGGGGGCTTCGACCAGGTGTGGAACATTGCTACAGAAAATAACAAGATTGCCGGTGTAAATTGGAACCCTGACCCTTTCGAACGTCATTCCTTCTGGTCTCTGGCGATTGGTGGGATTTTCATGATGCTGTCCTTGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)