Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBSW4777.5                            2 END     2          18      100                TEK tyrosine kinase, endothelial precursor [Homo sapiens]
     2   2.0    0Xt7.1-CABE1423.5                            2 END     2          18      100                angiopoietin receptor Xtie-2 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 185.0    0Xt7.1-CABK4101.5                            2 PI      85        435      606                (no blast hit)
     4 174.0    0Xt7.1-CABA8132.5                            2 PI      85        435      598                (no blast hit)
     5 181.0    0Xt7.1-CABA6124.5                            2 PI      84        430      606                (no blast hit)
     6 179.0    0Xt7.1-CABK7686.3                            2 PI      84        435      606                (no blast hit)
     7 177.0    0Xt7.1-CABA5286.5                            2 PI      84        435      606                hypothetical protein MGC75895 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012081517 Xt7.1-CABD8035.3 - 11 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD8035.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGACTTCCTGTTCGATGGATGGCGATTGAGTCTTTGAACTACAGTGTCTATACATCAAACAGTGATGTATGGTCTTTTGGAGTATTATTGTGGGAAATTGTAAGCCTGGGTGGAACACCATATTGTGGGCTGACATGTGCAGAACTTTATGAAAAGCTTCCACAAGGATACAGACTTGAGAAGCCTCTGAACTGTGATGATGAAGTGTATGACCTCATGCGGCAGTGCTGGCGTGAGAAGCCATATGAAAGACCATCATTTGCCAAAATTGTGGTGTCCCTTAACCGAATGCTGGAAGAAAGAAAGACTTATGTCAACACAACACTATATGAAAAGTTCACCTACGCTGGCATTGACTGTTCTGCTGAGGAGGCTGCATAGGTTTAATACAGCATATTCATAATCTGTCAGTCCATATCGTTGACTCGGAATGTTAAAGAGATACTGACACCAGAAATGAAACCTTTTTTACATCTGTCATAACACTGTTTTTGCATGCTATTCATAACTTTGCCTTAAAAGTGTTTGCCTGATGCTTTTACATTACCTGATTCCTCAGGTTCCTCTATGAGGGGCTGCTATATTTGTGCAGCAGTAATCCGTTATTGTAACCCGTTACATGACCTATAGGTAACTTTTAATGCACATTAATATTTTGAAGAGTATTTTTTTAGTGTCAGTATCACTTTAAAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTGTAA
                                                  Xt7.1-CHK-1008235326                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTGTTCGATGGATGGCGATTGAGTCTTTGAACTACAGTGTCTATACATCAAACAGTGATGTATGGTCTTTTGGAGTATTATTGTGGGAAATTGTAAGCCTGGGTGGAACACCATATTGTGGGCTGACATGTGCAGAACTTTATGAAAAGCTTCCACAAGGATACAGACTTGAGAAGCCTCTGAACTGTGATGATGAAGTGTATGACCTCATGCGGCAGTGCTGGCGTGAGAAGCCATATGAAAGACCATCATTTGCCAAAATTGTGGTGTCCCTTAACCGAATGCTGGAAGAAAGAAAGACTTATGTCAACACAACACTATATGAAAAGTTCACCTACGCTGGCATTGACTGTTCTGCTGAGGAGGCTGCATAGGTTTAATACAGCATATTCATAATCTGTCAGTCCATATCGTTGACTCGGAATGTTAAAGAGATACTGACACCAGAAATGAAACCTTTTTTACATCTGTCATAACACTGTTTTTGCATGCTATTCATAACTTTGCCTTAAAAGTGTTTGCCTGATGCTTTTACATTACCTGATTCCTCAGGTTCCTCTATGAGGGGCTGCTATATTTGTGCAGCAGTAATCCGTTATTGTAACCCGTTACATGACCTATAGGTAACTTTTAATGCACATTAATATTTTGAAGAGTATTTTTTTAGTGTCAGTATCACTTTAAAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTGTAAAATAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     5     5     5     6     5     6     5     6     5     6     6     7     6     7     6     7     7     8     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7    10     7    10     7    10     7    10     7    10     7    10     7     9     7     9     7     9     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     6     8     6     8     6     8     5     7     4     5
                                                                       ...PROTEIN --- Bf ---- 7e-018     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 3e-022     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                       PROTEIN --- Ci ---- 9e-025     CAD58833.1 fibroblast growth factor receptor [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bb ---- 4e-029     BAA84727.1 FGFR [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 9e-029     NP_651349.1 CG10244-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-029     NP_001024723.1 EGg Laying defective family member (egl-15) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 3e-042     XP_001189273.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 3e-059     NP_035717.1 tyrosine kinase receptor 1 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-065     NP_571536.1 endothelium-specific receptor tyrosine kinase 2 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-069     NP_038718.2 endothelial-specific receptor tyrosine kinase [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-070     NP_000450.2 TEK tyrosine kinase, endothelial precursor [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-070     XP_424944.2 PREDICTED: similar to receptor tyrosine kinase [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 5e-071     AAK72490.1 angiopoietin receptor Xtie-2 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD8035.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAG---TAA---------------------------------------------------------------------ATG---------------------TAA------------ATG------------------TAA------------------------------------------------ATG---------------------------------------------------------TAG------------------TAA---------------------------------------------------------------------------------------------------------ATGTAA---------------------TAA------------------------------------------------------TAA---------------------------------------------------------------------------------------------TAA------------------------TAG---------------------------------------------------ATG---------------------------------TAA---------TGA---------------------------------------------------TAA---TGA---ATG------------TGA---------------------------------------TAA---------TGA------ATG------------TAA------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Lun1      in                         CABD8035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCGATTCGAGCTGCTACACTTTGCTGCAGATGTGGCCCGAGGTATGGACTACCTGAGCCAAAAGCAGTTTATTCATAGGGATTTAGCAGCAAGAAACATTTTAGTTGGTGAAAACTATGTTGCAAAAATTGCAGATTTTGGTTTATCCAGAGGACAAGAAGTTTATGTAAAGAAAACTATGGGAAGACTTCCTGTTCGATGGATGGCGATTGAGTCTTTGAACTACAGTGTCTATACATCAAACAGTGATGTATGGTCTTTTGGAGTATTATTGTGGGAAATTGTAAGCCTGGGTGGAACACCATATTGTGGGCTGACATGTGCAGAACTTTATGAAAAGCTTCCACAAGGATACAGACTTGAGAAGCCTCTGAACTGTGATGATGAAGTGTATGACCTCATGCGGCAGTGCTGGCGTGAGAAGCCATATGAAAGACCATCATTTGCCAAAATTGTGGTGTCCCTTAACCGAATGCTGGAAGAAAGAAAGACTTATGTCAACACAACACTATATGAAAAGTTCACCTACGCTGGCATTGACTGTTCTGCTGAGGAGGCTGCATAGGTTTAATACAGCATATTCATAATCTGTCAGTCCATATCGTTGACTCGGAATGttaaagagatactgacaccagaaatgaaaccttttttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataggtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcact
  5   1   2       bld TpA       in                   TTpA067h19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGACTTCCTGTTCGATGGATGGCAATTGAGTCTTTGAACTACAGTGTCTATACATCAAACAGTGATGTATGGTCTTTTGGAGTATTATTGTGGGAAATTGTAAGCCTGGGTGGAACACCATATTGTGGGCTGACATGTGCAGAACTTTATGAAAAGCTTCCACAAGGATACAGACTTGAGAAGCCTCTGAACTGTGATGATGAAGTGTATGACCTCATGCGGCAGTGCTGGCGTGAGAAGCCATATGAAAGACCATCATTTGCCAAAATTGTGGTGTCCCTTAACCGAATGCTGGAAGAAAGAAAGACTTATGTCAACACAACACTATATGAAAAGTTCACCTACGCTGGCATTGACTGTTCTGCTGAGGAGGCTGCATAGGTTTAATACAGCATATTCATAATCTGTCAGTCCATATCGTTGACTCGGAATGttaaagagatactgacaccagaaatgaaaccttttttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataagtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcactttaaAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTTACAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATA
  5   1   2       bld Sto1      in                        CABG12080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGTTCACCTACGCTGGCATTGACTGTTCTGCTGAGGAGGCTGCATAGGTTTAATACAGCATATTCATAATCTGTCAGTCCATATCGTTGACTCGGAATGttaaagagatactgacaccagaaatgaaaccttttttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataggtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcactttaaAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTTGAGGGAAGTAAAGTATATTCCTGGC
  3   1   2       bld Fat1      out                        CABC4859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGAGGAGGCTGCATAGGTTTAATACAGCATATTCATAATCTGTCAGTCCATATCGTGNACTCGGAATGttaaagagatactgacaccagaaatgaaaccttttttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataggtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcactttaaAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGNGGGCTCATGAAGGGTCATGAAGAAAAACAATAA
  3   1   2      seed Lun1      in                         CABD8035.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGCATAGGTTTAATACAGCATATTCATAATCTGTCAGTCCATATCGTTGACTCGGAATGttaaagagatactgacaccagaaatgaaaccttttttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataggtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcactttaaAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTTGTAAAATAAAA
  3   1   2       bld TpA                             TTpA044i23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCATATTCATAATCTGTCAGTCCATATCGTTGACTCGGAATGttaaagagatactgacaccagaaatgaaaccttttttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataggtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcactttaaAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTGTAANTTAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      out                        CABE1423.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                gagatactgacaccagaaatgaaaccttttttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataggtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcactttaaAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTTGTAAAAT
  3   1   2       bld Sto1      in                        CABG12080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ttacatctgtcataacactgtttttgcatgctattcataactttgccttaaaagtgtttgcctgatgcttttacattacctgattcctcaggttcctctatgaggggctgctatatttgtgcagcagtaatccgttattgtaacccgttacatgacctataggtaacttttaatgcacattaatattttgaagagtatttttttagtgtcagtatcactttaaAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTTG
  3   1   2       bld Spl2 5g3  out                       CBSS2762.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACTGTTTTTGCATGCTATTCATAACTTTGCCTTAAAAGTGTTTGCCTGATGCTTTTACATTACCTGATTCCTCAGGTTCCTCTATGAGGGGCTGCTATATTTGTGCAGCAGTAATCCGTTATTGTAACCCGTTACATGACCTATAAGTAACTTTTAATGCACATTAATATTTTGAAGAGTATTTTTTTAGTGTCAGTATCACTTTAAAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGNGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTTGT
  3   1   2       bld Tail PIPE out                        CBSW4777.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGTTTGCCTGATGCTTTTACATTACCTGATTCCTCAGGTTCCTCTATGAGGGGCTGCTATATTTGTGCAGCAGTAATCCGTTATTGTAACCCGTTACATGACCTATAGGTAACTTTTAATGCACATTAATATTTTGAAGAGTATTTTTTTAGTGTCAGTATCACTTTAAAGTCTATTTGTGTACAGACAATATGTAGGATACTTTTAAAAAAATTAGCATATATTTTTATCACTATGTAAATATATTTTTTTTTTTATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAAATAAAATAAAGTACTTGTAAAATAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                   TTpA067h19.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTGTAAGCTGACATACATTTGGAAGGTTACAAGCAAAACTTTTTTATAGATAAAAACCTATAATACTGCATTATACATAAACAAAGTTTATTGATAAACGTTGAAGGGTGTGCTTATATTTTTGAAAAATGGTGTGCGTGTAAATTCTCCATTTAACTAATTCTGCAAAAACAACATATTGGTTTAGCATTTTTTTTTACCTTTTTGTGTTTTTTTTATCTTTTTTGCTGTTGCTGAAATGAGCTGTGTACAACAGAGAAGAAAATATATTTATTAAAACAGCTACTGACTAAAAGCACAGCAGCAGTGCAGTGAAATCGTCTTCACTTTTTCTCTGTTGTAACAATGATGTATGAGCTTTCTCTTTTGAAGGAAAGTAAAGTATATTCCTGGCTTTAAGCATGTTGTTTAAAGGGGCTCATGAAGGGTCATGAAGAAAAACAATTAATAAATAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)