Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012081741 Xt7.1-CAAO6280.3.5 - 15 ESTs
                                                                       ......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAO6280.3.5       AATAGCTGTCCGGCAGGAGTGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCTGTGGACTCTGGCAAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTCATTATTTAGTGGGCCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCT
                                                  Xt7.1-CHK-1008232727             TGTCCGGCAGGAGTGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTxCTxAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCTGTGGACTCTGGCAAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTCATTATTTAGTGGGCCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCTATACCA
                                                      consensus depths            2     2     2     2     2     2     2     3     3     4     3     4     3     4     3     5     3     5     3     5     3     6     3     6     3     6     3     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     8     9    10    10    10    10    11    11    11    11    11    12    11    12    12    12    12    12    11    12    11    12    10    12     9    11    10    11    11    12    11    13     9    12     8    12    10    12    10    12     9    11     8    10     8     9     8     9     8     9     7     8     7     8     7     8     4     6     4     5     3     4     3     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
  5   1   2  SIG                                      Xt7.1-CAAO6280.3      GAATAGCTGTCCGGCAGGAGTGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGAGTCTCACTTGAGAAGAATGGAGAGTATGCTGTTGTCTCCGATATGGAATGTCACTAACATGCAGTGTATTTCTTGAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCTGTGGACTCTGGCAAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTCATTATTTAGTGGGCCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCTATACCACCTCAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CABI12923.3                                                                                           CTGTCCGGCAGGAGAGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATGGGGGGGGGGGTAACAAAACAACTCCTAAGTGATCAGGTGTTAA
                                                                   VAR                                                                                                                               AGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAG
                                                                   VAR                                                                                                                                                                                           TACACAGCTTACACTGACAGGTGACTGAAAGGATAAGAGTCTCACTTGAGAAGAATGGAGAGTATGCTGTTGTCTCCGATATGG
                                                                   VAR                                                                                                                                                                                                                                                                                           ATGCAGTGTATT
                                               BLH ATG     321     328       
                                               BLH MPR      -6      47       
                                               BLH OVR     321     443       
                                               ORF LNG     321      42       
                                                                       PROTEIN -== Xt ==== 8e-007     AAI18853.1 Unknown (protein for IMAGE:7671329) [Xenopus tropicalis] ==========================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Dr ---- 8e-032     XP_690972.1 PREDICTED: similar to zinc finger protein 6 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 2e-066     XP_420253.2 PREDICTED: similar to Zinc finger protein 711 (Zinc finger protein 6) [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Mm ==== 1e-074     XP_903194.1 PREDICTED: hypothetical protein LOC245595 isoform 3 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 4e-075     NP_068838.3 zinc finger protein 6 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 7e-106     AAI10743.1 Unknown (protein for IMAGE:7394393) [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAO6280.3.5                                                                                                                                                                            TAG------------------------------------------------------ATG---------TGA------------------------------------TGA------------------------------TGA------------ATG---------------------------------------------------------ATG---ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAA---------------------------TAA------------TAA------TGA------TAG---------------------ATG------TAG------------TAG---------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF      ... open reading frame                                                                                                                                          ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2  SIG                                      Xt7.1-CAAO6280.3      GAATAGCTGTCCGGCAGGAGTGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGAGTCTCACTTGAGAAGAATGGAGAGTATGCTGTTGTCTCCGATATGGAATGTCACTAACATGCAGTGTATTTCTTGAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCTGTGGACTCTGGCAAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTCATTATTTAGTGGGCCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCTATACCACCTCAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008297500            CTGTCCGGCAGGAGTGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGAGTCTCACTTGAGAAGAATGGAGAGTATGCTGTTGTCTCCGATATGGAATGTCACTAACATGCAGTGTATTTCTTGAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCTGTGGACTCTGGCAAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTCATTATTTAGTGGGCCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCTATACCACCTCAAAAAAA
  0   1   1           Gas  FLq                    TGas137d04.FL-Sanger                                                                                                            ACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCTGTGGACTCTGGCAAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTCATTATTTAGTGGGCCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCTATACCACCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Te5       in                         CAAO6280.5p      GAATAGCTGTCCGGCAGGAGTGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATGCAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGAGTCTCACTTGAGAAGAATGGAGAGTATGCTGTTGTCTCCGATATGGAATGTTACTAACATGCAGTGTATTTCTTGAAGGCTTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATG
  5   1   2       ext Gas7      in                         XZG60668.5p       AATAGCTGTCCGGCAGGAGAGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGAGTCTCACTTGAGAAGAATGGAGAGTATGCTGTTGTCTCCGATATGGAATGTCACTAACATGCAGTGTATTTCTTGAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCCACTATTCAGCCCCAGGTTCATCTGTTACTATAAAGACCTGAGATGATGGAAATAAAAAA
  5   1   2       add In60 5g                         IMAGE:8947289.5p                                         TTTTTTTTATTCACCTGATCTCCTTCATATTCGAATTCGTCCCGGAATAGCTGTCCGGCAGGAGAGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTGTGATGCAGATGCTGTTATCCAAGCACCCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAGATGATGAAATAAAAATAACCTTCTGAGATTATCTATGATATCATGTAGTACGGGACGCAGCTATTAGAACATCCATGTAATGGTGCAAGTCTATCATTCCTGAACAACACTCCTTAGAGAT
  5   1   3   10   nb Eye  5g3  in                         CCAX2503.b1 ............................................CGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGAGTCTCACTTGAGAAGAATGGAGAGTATGCTGTTGTCTCCGATATGGAATGTCACTAACATGCAGTGTATTTCTTGAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAAT
  5   1   0       chi Gas  FLq                       TGas137d04.p1kSP6                                                                                                                                                                                                                                                                                                                                             CGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTA
  3   1   2       ext Te5       in                         CAAO6280.3p                                                                                                                                                                                                                                                                                                                                                              TAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTAGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTT
  3   1   2       ext Gas7      in                         XZG60668.3p                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTCATATTGATGGAGCCCATATTGTTGTTTCTGTTCCGGAAGCTGTTTTAGTTTGGGATGTTTTCCCGGATGATGCCTTTCCCCTGGACCCCGTTCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCCCAGAGGCCGATGTTGTAACTGAAAGTGTCTTCGTTCCGGAAGCGGTGCTGGAAACTGATGTTCCCATCGACCAGGCTTTGGATGCCAGTCCCCATGTGTGGGATTCAGCCATAATACCAGAAACGGTTGCAGTTCCTGACCAAGTTTTGGTGGCTGCCCTAGTGCCAGACAGAGATGCCCAGCTGGACCATGTATTTCAGGACTCTATCCATGGATCCCACTCCCCCCCAATGTTTTCCCAGGAGGTTTTTGTACCCAGTTGTGATCCAGATGTTTTTATCCAAGCCCCCATTTTTCAAGCCCCGGGTTCTTTTGTTACTATAAAGAC
  5   1   4      seed Gas7      in                         XZG48647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCtgtggactctggcaaatgccagaggggctgctgtaagatgccatagacagtcattatttagtgggcCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGNGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACANATAAAACCTATACCACCTCAAAAAAAAAAAAAAAGG
  3   1   4      seed Gas7      in                         XZG48647.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCtgtggactctggcaaatgccagaggggctgctgtaagatgccatagacagtcattatttagtgggcCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTCTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCTATACCACCTCAAAAAAAAAAAAAAAAGG
  3   1   3        nb Eye  5g3  in                         CCAX2503.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATCATATTTCCATAGACAAAACAACTCCTAAGTTATCAGGTTTTAAAATGACTGACGTAGGTAGCTTTCAGTAGGCTTGCTAGAAATGCAGTGGTAGCTATGCCTGGCCTAGAATTTAGTGCTGTGGACTCTGGCAAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTCATTATTTAGTGGGCCTCTGTATAATTGAAATGCCAGCGCCTGTTTGAAACCCCAGTCCAGACCTGGCGGTAGCCCACCTGCAGCATTAGGGTTAGAGGCAATAGATCTTTACTTAATGTGCAAACTGGTATTACCACTACAATTTAGCATATGGTTTGGTTTTAATCTGCATCTGCATGACTGTACTGTAAATAGCCTTACAAATGTCTTTGTGAATGCCCCACTCACTGGGAGAGTTTTATGAGCAGTGCTTAGTGGTTATTATTTTTCCCATTATTCTAACAGCTTAACACAAATAAAACCTATACCCCCTC
  5   1   2  SIG                                     Xt7.1-CABI12923.3                                                                                           CTGTCCGGCAGGAGAGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATGGGGGGGGGGGTAACAAAACAACTCCTAAGTGATCAGGTGTTAA
                                                  Xt7.1-CHK-1008297498                                                                                                 GGCAGGAGAGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATGGGGGGGGGGGTAACAAAACAACTCCTAAGTGATCAGGTGTTAAAATGAC
  5   1   2       ext Gas7 PIPE in                         XZG39375.5p                                                                                           CTGTCCGGCAGGAGAGTACGAGCCAAACGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAG
  5   1   4      seed Ovi1      in                        CABI12923.5p                                                                                                                    CGCGGTAACGGAGCTGCGGGACTTTTAAACATCGATCCGGCACCGGGGGATGTGCTAAGGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGA
  3   1   4      seed Ovi1      in                        CABI12923.3p                                                                                                                                                              ACCGGGGGATGTGCTAAGAAATCCGAACTGTCCCGGGAAAAGCGGGGCTGCCGGGCGGTGGATCTGTCAACATGGCTGGTGATTGACCTTCCTTAGCCTATACAAGGATACACAGCTTACACTGACAGGTGACTGAAAGGATAAGGATTTTCGAATGATTGGTGTTAATTATGGATCCTGGTGGTGGTGGCCTAGGCCTGCATGTCGAAGAAACAAAAATACCCCATGCCATGATCATGCAGGACTTTGTGACTGGGATGGCTGGCACTGCTCATATTGATGGAGACCATATTGTTGTGTCTGTTCCTGAAGCTGTCTTAGTCTCGGATGTTATCACAGATGATGACATTACACTGGAACACGATCTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCACAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCACCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTCGTGGCTGACCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTCTATCCATGGATCCCACTCACCCACAATGGTTTCCCAGGAGGTTCTTGTAGCCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCACTATTCAAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTCAAAAAA
  3   1   2       ext Gas7 PIPE in                         XZG39375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTGATGGAGACCATATTGTTGTGTTTGTTCCTGAAGCTGTTTTAGTTTCGGATGTTTTCCCAGATGATGCCATTCCCCTGGAACCCGATTTGTCCAATGAAGTTGTCCAAGGTCCTGATATCATCCCAGAGGCCGATGTTGTAACTGAAAGTGTCATCGTTCCTGAAGCGGTGCTGGAAACTGATGTTGCCATCGAGCAGGCTTTGGATGACAGTCCCCATGTGTTGGAATCAGACATAATAACAGAAACGGTTGCAGTTCCTGAGCAAGTGTTTGTGGCTGCCCTAGTGACAGACAGAGATGGCCAGCTGGAGCATGTAGTTCAGGACTTTTTCCATGGATCCCCCTCCCCCCCAATGGTTTCCCAGGAGGTTTTTGTACCCAGTTGTGATGCAGATGCTTTTTTCCAAGCCCCCCCTTTTCAAGCCCCAGGTTCTTTTGTTTCTATAAAGACTGAAGGTGGTGAAATAAAAAATCCCTTTGGGGGTTTTTTAATGATTTCATGTAAGTTAAGGGGGCGGCAGCTAATTAAAGAACCCTTCATTTTTTTAAAAAAAAAAAAAAGG
  5   1   2       ext Gas                            TGas104f14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGTTGTGATGCAGATGCTGTTATCCAAGCACCCGCTATGGGAGAGCCCCAGGTTCATCTGTTACTATAAAGACTGAAGATGATGAAATAAAAAATACCTCTGAGGATTATCTAATGATATCATGTAAGTTAAGGGGACGGCAGCTAATTAAAGAACCATTCATTTTTTATTTTTGTGTGCGAGTGTCTTAATGGGGGGGGGGGTAACAAAACAACTCCTAAGTGATCAGGTGTTAAAATGACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)