Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAO5076.5                            5 END     1           3       20                LOC443677 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012081758 Xt7.1-CABK11070.3.5 - 26 ESTs
                                                                       ......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABK11070.3.5                                                                                                                     AAAATCAAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTCACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCAAAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGTAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228949                                                                                                                           AAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTCACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCAAAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGAxxxxxxGxxxxxTAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAAxTxxAxTxxxAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                          2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     7     6     7     6     7     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     8     9     8     9     8     9     9     9     9     9     8     8     8     8     8     8     7     8     7     8     7     8     8     9     7     9     8     9     8     8     8     8     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     5     7     6     7     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     2     3     3     5     3     5     3     5     3     5     3     5     3     5     4     6     4     6     4     6     5     7     4     7     4     7     4     6     5     8     5     9     5    10     5    10     6    11     6    11     6    11     6    10     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     6    11     6    11     6    10     6    10     6    10     6    11     6    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12    12    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     7    11     2     3     2     3
  5   1   2  SIG                                     Xt7.1-CAAO12696.3                                                                                                                  CAGAAAATCAAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTCACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAACCAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCCGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAAATTCAGAGTATTTATTTTATATTTGATATTAGTTTTACATTGCTCAAAGTGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCCTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACGGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTTTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTT
  5   1   2  SIG                                     Xt7.1-CABK11070.3                                                                                                                                                                                                                                                                                                                                                                                                     TAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCCCACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCAAAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTGCTCGTAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTATTATCATGCAGTGCGTGCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------G----T
                                                   Xt7.1-CABK11070.3.5                                                                                                                                                      ATG------------------------ATG------------------------------TAA---------------------------------------------------------------TAG---------ATG---------------TAA---------------------------------------------------------ATG------------------------------TGA------------------------TGATGA------------------------------------ATG------------------------TAA---------------------------TAA---------------TAA------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------ATG---------------TAA------------------------------------------------------------------------------------TGA------------TAA---------------------------------------------------ATG------------------------------------------------------------------------ATG---------TAG---------------------------------------ATG------------------------------------ATG---------------------------------------------TGATGA---------TGA---TAA---------------------ATG---------------------------TGA---------TGA------------ATG------TAG------------------------TAA------------ATG------------------------TAA------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------ATG------------------------TAA---------------------------TAG---------------------TAG---TGA------------TAA---------------------------------------ATG------------------------ATG---------------------------TAA---------------TAG---------------------TAG---------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------TAG---------TAAATG------------------------------------------TAA------------------------------------------------TGA---------------------------------------------------------ATG------------------------------------------------------------------------------------TGA------------TAA
  5   1   2  SIG                                     Xt7.1-CAAO12696.3                                                                                                                  CAGAAAATCAAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTCACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAACCAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCCGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAAATTCAGAGTATTTATTTTATATTTGATATTAGTTTTACATTGCTCAAAGTGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCCTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACGGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTTTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTT
                                                  Xt7.1-CHK-1008294946                                                                                                                        ATCAAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTCACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAACCAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCCGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAAATTCAGAGTATTTATTTTATATTTGATATTAGTTTTACATTGCTCAAAGTGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCCTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACGGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTTTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGA
  5  -1   2       ext Brn2                                CAAJ19903.5p CTCATCTACTGTTTTGCACTTTCTAATCATATTCCATATGTGAGCAACATTTAAGCCACCCTAGGCNCAAGCCTTGTGGGCTTCGCTTCAAATACTGCCTGGATATAGTCACCCAGAAAATCAAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTCACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAA
  5   1   2       ext TpA       in                   TTpA072k16.p1kSP6                                                                                                                  CAGAAAATCAAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTCACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACgatacaaaaagtcagagtgaggaccccatcattaagccaatgctgtccttgatccaacagaaaaaacaagagtgcccaatcgacatatggccgatttttggccagatatctgtcaggtaggcctgAAAGAGGGCCTCATACATGGGCAA
  5   1   4      seed Te5       in                        CAAO12696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACgatacaaaaagtcagagtgaggaccccatcattaagccaatgctgtccttgatccaacagaaaaaacaagagtgcccaatcgacatatggccgatttttggccagatatctgtcaggtaggcctgaaagagggcctcatacatgggcaaataagcTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAACCAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCCGTTTGGTCAGGACCATGGATTCgccaaatcttgctgaaaaaggatgaatcccaaactgaatcctggattcgatgcatccctaGTTTGAAGGA
  5   1   2       ext Brn2      in                        CAAJ17967.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAGGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAACCAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCCGTTTGGTCAGGACCATGGATTCgccaaatcttgctgaaaaaggatgaatcccaaactgaatcctggattcgatgcatccctaGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAAATTCAGAGTATTTATTTTATATTTGATATTAGTTTTACATTGCTCAAAGTGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCCTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTG
  5   1   2       ext HdA       out                  THdA050m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCAGCAGAAACTTTCGACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCCGTTTGGTCAGGACCATGGATTCACCAaatcttgctgaaaaaggatgaatcccaaactgaatcctggattcgatgcatccctaGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCATCCATTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAAATTCAGAGTATTTATTTTATATTTGATATTAGTTTTACATTGCTCAAAGTGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCCTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACACGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTA
  3   1   4      seed Te5       in                        CAAO12696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTAGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTT
  3   1   2       ext Brn2      in                        CAAJ17967.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCACCCATATCCTACGGTAAATACAAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACGGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTTTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTT
  3   1   3        nb Te3  FL   out                         CAAM478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTT
  3   1   2       ext TpA       in                   TTpA072k16.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTTGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAACAGATGTACTTATTTTTACAGTATTTTAGCTTCAGATAAAGAGTACTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTTTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTCATTCATTAAATGGATATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTTTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACGGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTTTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CABK11070.3                                                                                                                                                                                                                                                                                                                                                                                                     TAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCCCACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCAAAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTGCTCGTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008294944                                                                                                                                                                                                                                                                                                                                                                                                           CCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCCCACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCAAAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Eye       in                         CCAX8818.b1                                                                                             AAAATCAAGCTATATGTGCACACACATGTTTACATGATAGATAAGGTGTGTAACATTGATATGGGCATTTCTTACATTCCAAATGTACCATTTTAAAGCACACACCACAAGACAGCACTTCTTGCTCATCCAGTACTTTATTACATTGTTGCTTGTGTTCTGCATTTCATAGCATGATGTGATGTCACTTTGCGGTTGACACAAGGAATATACTAATGGTGTAGCTTATTCTGTGCACAGAACATTCCTTTGCTGCTTATTTGCTTTATAAATATGTGTGGGAGCTGCCTTAAATCTAAACTCCATTGAAAACAACAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCATGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCAGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTTTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCG
  5   1   4      seed TbA       in                   TTbA071d24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                         CTGCCTTAGATCTAAACTCCATTGAAAACAATAGACAAACAACATTGGTTGATGACTAGGCATTAGTCATATATATTATCCATTAGTAGCCCTGATACATATATATAAATATATAGCCTAAATAGAGGTAAAGAGGTATGTTTTACATTAAAGGGCAATTGTTCAGTAAAAGTTCAACTGCTCCGTTGTGTGTCTGCTAGGGGCTATACTAAACATATTTTCCTTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCCCACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCCATATGCCCACCTTGGAGCCAAACgatacaaaaagtcagagtgaggaccccgtcattaagccgatgctgtccttgatccaacagaaaaaacgagagtgcccaatcgacatatggccgatttttggccagatatctgtcaggtaggcctgaaagagggcctcatacatgggcaaataagcTACCAAATGAGTCTGAGGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAGATACCAGACAAATCCTAATTTGCACATGCAAATTACGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGAT
  5   1   3        nb Eye       in                         CCAX5082.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATATTTTCATTTATCTACTTAAGTTTGTGCCCATGTCATATGTTCTTACTTATGAGTCTCACTTTTGCATCACATGCTAAAAAAAAACATGGGAATACGGGTGCAAGGCCACACTTAATGTGGCCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTG
  5   1   2       ext Lun1      in                        CABD14252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAATTCGGCACGAGGCATACACGGCATAACCCGCTCAGTTTGCCATCTCGCAAACAAGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACgatacaaaaagtcagagtgaggaccccatcattaagccaatgctgtccttgatccaacagaaaaaacaagagtgcccaatcgacatatggccgatttttggccagatatctgtcaggtaggcctgaaagagggcctcatacatgggcaaataagcTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCgccaaatcttgctgaaaaaggatgaatcccaaactgaatcctggattcgatgcatccctaGTTTGAAGGGACCCAAATCGCAGCTTAAATCTGCCTGCATATG
  5   1   3        nb Eye                                  CCAX3249.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAAATCTTTCCCCCAATATGCCCACCTTGGAGCCAAACGATACAAAAAGTCAGAGTGAGGACCCCATCATTAAGCCAATGCTGTCCTTGATCCAACAGAAAAAACAAGAGTGCCCAATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCGCCAAATCTTGCTGAAAAAGGATGAATCCCAAACTGAATCCTGGATTCGATGCATCCCTAGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTT
  5   1   3        nb Spl1      in                        CABK11070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCGATTCggaaaaacaagagtgcccaatcgacatatggccgatttttggccagatatctgtcaggtaggcctgaaagagggcctcatacatgggcaaataagcTACCAAATGAGTCTGAAGTAGGGATGCAACAAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCgccaaatcttgctgaaaaaggatgaatcccaaactgaatcctggattcgatgcatccctaGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCANAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGNGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGNA
  5   1   3        nb Eye                                  CCAX7609.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCGACATATGGCCGATTTTTGGCCAGATATCTGTCAGGTAGGCCTGAAGAGGGCCTCATACATGGGCAAATAAGCTACCAAATGAGTCTGAAGTAGGGATGCAACAATTCACTATTTTGGGATTCGGCCGAATCATGATTCAGGTCAAAATACCAAACAAATCCCTAATTTGCACATGCAAAATTA
  5   1   2       ext Hrt1      in                         CAAQ4795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTCAGGTCAAATACCAAACAAATCCTAATTTGCACATGCAAATTAAGTTAGAGAAGGCGAAAAACTTTCTACTTCTGTGTTTGTGATGAAAAGTCACATGATTTTAAGAATTCAGTTTGGTCAGGACCATGGATTCgccaaatcttgctgaaaaaggatgaatcccaaactgaatcctggattcgatgcatccctaGTTTGAAGGACCCAAATCGGCAGCTTAAATCTGCCTGCATATGAGCCACCTTTACACTGTAGGCCCTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCAAAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCACCCATCATGCAACATGACGGCTCCCACCCATAT
  5   1   2       ext Ova1      in                         CABE6269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTAACAGCTGTAGTTCCCAGTTAGAACTGCTGCAATAGACTCATTGGAGTGGATTTTTATATGTAGTTTGTGTCTGTGTTTCACTGTGGTGCCAGAGTTCAGTGTAACCAGCCTGTGCCTTTTTGTATGTTCCCCATTTTGTAGCAGCTGTTTGGGCTGCCTATTGCAGTTAAGTGCTAATTGGTGGCTCTGATGAAGCACAGCATCAGCTTTTTTAAACCTGCATCCTTTTAAAATTACATACAAGCCATGGGCACACGTTTTTATTATCTTTCAGTATTTATTTTTATTTGATATTAGTTTTACATTGCTCAAAGGGTTGCCAGTCCTAGTGCATGGTCTTCCTTGGAAGAGTCTCTTGGGGCCAAGTGAGGCTTCACAGTCTACGGAGATACTGTAATACAACGCTGCACCAAAGGCATTTATTGCACCCTGTAAATCCATTGTAAGCTCCAGGTTTTATTTTGTGGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATACAGATGTACTTATTTCTACAGTATTT
  3   1   3        nb Spl1      in                        CABK11070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAGGGAAGTTATACTCTATACATTCATCTGTAAGGGCATAGCTTACTATATGCTTGGACATTCTATCTCCTGCACATTCGCTNTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGT
  3   1   2       ext Ova1      in                         CABE6269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTGCACATTCGCTTTTCTATGTGTGCCATATTGCATTCTCTGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGT
  3   1   2       ext Hrt1      in                         CAAQ4795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTATCAACCATTCATGCAACATGACGGCTCCCACCCATATCCTACTGTAAATACAAAAAAAAGGATNTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGT
  3   1   4      seed TbA       in                    TTbA071d24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAATACAAAAAAAAGGATTTTCTGTGCAATAGGTTATATCTTCATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTTTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTTTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTTTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb Eye       in                         CCAX5082.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTCCCTACTTAGAACTGACATAATGAAATTTAAACATGTAGGTTAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGTA
  3   1   3        nb Tad0                             NISC_no04h06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGTTTCATATCCAAAAAATACATATATAATGTGTAGCTGCAGAGGAGTCACTGTAATGCATGTCTTGCAATTTACAATACATTTTTAATGTTTAAAGCTGCAGTAGTGTGCCCTGTCATTCCCTAGTTAGTTAGTCATTTTACCTTTGCAGTTTGTTTTTAATTACAGATGTACTTATTTCTACAGTATTTTAGCTTCAGATAAAGAGTTCTTTAAATGACTATTATACACTGATATTCAGGTGGGTTTTACTTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTGCTCGTAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext Lun1      in                        CABD14252.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAATGACTATTATACACTGATATTCAGTGGGTTTTACTTTAAAGACGTACCATGTGTCTCTAGTGGTACATTGCACTCGGATAGACACTGTATTTATTAGTTAATTCATTAAATGGACATAATTCTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTT
  3   1   2       ext Eye       in                         CCAX8818.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTAAATGGACATAATTCTTTTATTACCGAACAGAATGGGCAGCTACAGACTAATTGCAATTATTATTCAATGTACAATCCATAGGAAAAGTCTGCAGCTTGTGACAGTTTTGCACATGTAACTATAGGAACCACTGGGTATGTATTGTTATTTGTATTATCATGCAGTGCGTGCAGGATTCTCATAGGGCTAGAGAACCGCACAGCACATGCATCCCTGCAACACTGTTAATCACATTGCCAATAAAGTGAGAATTTTACTCGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)