Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK10810.3                          17 END     5          71       29                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012082037 Xt7.1-CAAK12242.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAK12242.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCCTTCTGTGCGCGTCCCCGACACTGATGCTGCTGCTGGTGCTGCGGGCGGCGGGAGACGAGGGGGAACCGGAGAGAGAAAGGCCCCGGGCCGGACACACCCGGAGCGGAGACGCGGGTCGGATCACTTGGACCCTGTCGGCTATCCCGATGCCTATCTACCCTGTGTATTGCTTGTGTAGTGCAAGATGTGAATGACATCCTTTGAGGGCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTTGTAGTCATCACCCTGAATTATCGTGTGGGAGTTCTGGGTTTTCTAAGCACTGGAGATCAGGCAGCTAAGGGAAATTATGGGCTTCTAGACCAAATCCAGGCCCTACGATGGGTAAGCGAGAACGTGGCGTTCTTTGGAGGCGACCCTCACAGGATTACTGTATTCGGCTCTGGCATCGGAGCATCCTGCGTCAGCCTCCTCACTCTGTCTCACCAT
                                                  Xt7.1-CHK-1008239286                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTGTGCGCGTCCCCGACACTGATGCTGCTGCTGGTGCTGCGGGCGGCGGGAGACGAGGGGGAACCGGAGAGAGAAAGGCCCCGGGCCGGACACACCCGGAGCGGAGACGCGGGTCGGATCACTTGGACCCTGTCGGCTATCCCGATGCCTATCTACCCTGTGTATTGCTTGTGTAGTGCAAGATGTGAATGACATCCTTTGAGGGCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTTGTAGTCATCACCCTGAATTATCGTGTGGGAGTTCTGGGTTTTCTAAGCACTGGAGATCAGGCAGCTAAGGGAAATTATGGGCTTCTAGACCAAATCCAGGCCCTACGATGGGTAAGCGAGAACGTGGCGTTCTTTGGAGGCGACCCTCACAGGATTACTGTATTCGGCTCTGGCATCGGAGCATCCTGCGTCAGCCTCCTCACTCTGTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     4     4     4     4     4     4     4     4     4     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     276     292                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     270     105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     276    1120                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     276      51                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN -== Br ==== 4e-029     AAB18262.1 cholinesterase 1 [Branchiostoma lanceolatum] ===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Cs ---- 2e-035     CAD29868.1 TPA: actylcholinesterase [Ciona savignyi] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Bf ==== 3e-040     AAD05374.1 cholinesterase 2 [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 6e-042     NP_001033475.1 F07C4.12b [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xt ---- 1e-042     AAH82503.1 Unknown (protein for MGC:89138) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-046     XP_690455.1 PREDICTED: similar to carboxylesterase 2 isoform 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 8e-054     NP_001036685.1 CG34127-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 3e-064     XP_783479.2 PREDICTED: similar to neuroligin 2, partial [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---- 6e-102     XP_425576.2 PREDICTED: similar to neuroligin X isoform 2 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 1e-117     NP_766520.1 neuroligin 3 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 1e-118     NP_061850.2 neuroligin 3 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 4e-147     AAH79746.1 MGC84475 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 4e-147     NP_001087416.1 MGC84475 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAK12242.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAG------ATGTGAATG---------------------------------------------------TGA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  5   1   2   14  bld Brn3 5g3  out                        CAAK4651.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCCTCTCACCCTCAGCTCCCTCATCCTTCTGTGCGCGTCCCCGACACTGATGCTGCTGCTGGTGCTGCGGGCGGCGGGAGACGAGGGGGAACCGGAGAGAGAAAGGCCCCGGGCCGGACACACCCGGAGCGGAGACGCGGGTCGGATCACTTGGACCCTGTCGGCTATCCCGATGCCTATCTACCCTGTGTATTGCTTGTGTAGTGCAAGATGTGAATGACATCCTTTGAGGGCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGGACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTTGTAGT
  5   1   2   24  bld Brn3 5g   ?                          CAAK5469.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCCTTCTGTGCGCGTCCCCGACACTGATGCTGCTGCTGGTGCTGCGGGCGGCGGGAGACGAGGGGGAACCGGAGAGAGAAAGGCCCCGGGCCGGACACACCCGGAGCGGAGACGCGGGTCGGATCACTTGGACCCTGTCGGCTATCCCGATGCCTATCTACCCTGTGTATTGCTTGTGTAGTGCAAGATGTGAATGACATCCTTTGAGGGCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTAT
  5   1   2   14  bld Brn3 PIPE out                       CAAK10810.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGATGCTGCTGCTGGTGCTGCGGGCGGCGGGAGACGAGGGGGAACCGGAGAGAGAAAGGCCCCGGGCCGGACACACCCGGAGCGGAGACGCGGGTCGGATCACTTGGACCCTGTCGGCTATCCCGATGCCTATCTACCCTGTGTATTGCTTGTGTAGTGCAAGATGTGAATGACATCCTTTGAGGGCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTT
  5   1   2   14 seed Brn3 5g3  out                       CAAK12242.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGGCGGCGGGAGACGAGGGGGAACCGGAGAGAGAAAGGCCCCGGGCCGGACACACCCGGAGCGGAGACGCGGGTCGGATCACTTGGACCCTGTCGGCTATCCCGATGCCTATCTACCCTGTGTATTGCTTGTGTAGTGCAAGATGTGAATGACATCCTTTGAGGGCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTTGTAGTCATCACCCTGAATTATCGTGTGGGAGTTCTGGGTTTTCTAAGCACTGGAGATCAGGCAGCTAAGGGAAATTATGGGGCTCT
  5   1   2   24  bld Te3  5g                              CAAM7403.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCGGGTCGGATCACTTGGACCCTGTCGGCTATCCCGATGCCTATCTACCCTGTGTATTGCTTGTGTAGTGCAAGATGTGAATGACATCCTTTGAGGGCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTTGTAGTCATCACCCTGAATTATCGTGTGGGAGTTCTGGGTTTTCTAAGCACTGGAGATCAGGCAGCT
  5   1   2   14  bld Brn3 5g3  out                        CAAK1640.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCAAACCTGTATTCCTGTTGCTACCAGTGAAGTGTCCTTGATGCGAGAGCTATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTTGTAGTCATCACCCTGAATTATCGTGTGGGAGTTCTGGGTTTTCTAAGCACTGGAGATCAGGCAGCTAAGGGAAATTATGGGCTTCTAGACCAAATCCAGGCCCTACGATGGGTAAGCGAGAACGTGGCGTTCTTTGGAGGCGACCCTCACAGGATTACTGTATTCGGCTCTGGCATCGGAGCATCCTGCGTCAGCCTCCTCACTCTGTCTCACCATTTCTGAGGTCTGTT
  5   1   2   14  bld Brn3 5g3  out                       CAAK11694.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATACCACTTGGACCATGCATGGGGTTGGGCTGAAAGTGGCCCCCAGGAAGCTGAGTCTGGTCCTGTGGGTTCTGAGTGTCACCTCCCGTGTCCTGTCCTCTCATGCACAGGTGTATTCTCAGACCGTCAACACACACTACGGCAAACTGCGTGGCACACGTGTGCCCTTACCAAGCGAAATCCTGGGTCCTGTGGATCAGTACCTAGGAGTGCCCTATGCTGCACCACCTGTGGGAGAGAAACGTTTTCTCCCACCAGAACCACCACCCTCCTGGTCCGGAATAAGGAATGCCACCCATTTCTCTCCAGTGTGCCCTCAGAACATACAGAATGCAGTACCAGATATTATGATGCCTGTTTGGTTCACTTCAAACTTGGACACTGTGACAGGGTACTTGCAGGAACAGAGTGAGGATTGCCTGTATCTCAATATCTATGTGCCCACAGAGGATGATATCCGGGACACAGGAGCCAAGCCAGTCATGGTTTATATACATGGAGGATCATACATGGAGGGCAGCGGGAACATGATCGATGGCAGTGTGCTGGCCAGCTATGGGAATGTTGTAGTCATCACCCTGAATTATCGTGTGGGAGTTCTGGGTTTTCTAAGCACTGGAGATCAGGCAGCTAAGGGAAATTATGGGCTTCTAGACCAAATCCAGGCCCTACGATGGGTAAGCGAGAACGTGGCGTTCTTTGGAGGCGACCCTCACAGGATTACTGTATTCGGCTCTGGCATCGGAGCATCCTGCGTCAGCCTCCTCACTCTGTCTCACCATTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)