Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012082248 Xt7.1-CAAL22404.5 - 16 ESTs
                                                                       .....-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAL22404.5                                                                            GAAACAGCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACAACTGCAGTGAATTCACAACCCCAGATGGGGATTTTTATGATGTGATAGAGCTGCCATATGAAGGAGAGGAGCTCAGCATGCTTATTGCTGCTCCTTATGAAAAGAATGTTCCCTTATCCGCCATCACAAACATCCTGACACCTGAGCTCATTGCCCAGTGGAAAGCCCAAATGAAGAAAGTAACACGTCTTTTAGTCCTACCCAAGTTCTCTCTGCTCAGCGAAGTTGATCTGAAGAAGCCACTGGAACGTCTCGGAATTACGGACATGTTCACTCAAGAGACTGCAGACTTCAGCCGCTTGTCTTCTGAAAAACCACTGTATGTATCTGAAGCTTTTCAAAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGCTGCAATCCTGCTAGCTCGAATGGCTCCTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACACTGCTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCCTGACCCCCCCTATACCTGTGAGATAGATGGCGTCAACAAGACTCACCTGAACCCTAAAGTCTGCCTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCGCCAAGGAGTATGAGTGTTTGAGCATTAATGAGTATGGAGTACGACTGTCGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAGAATGCATTGTAATTGAGCTTTTTTTATATTTATTAAATATATTT
                                                  Xt7.1-CHK-1008232150                                                                                  GCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACAACTGCAGTGAATTCACAACCCCAGATGGGGATTTTTATGATGTGATAGAGCTGCCATATGAAGGAGAGGAGCTCAGCATGCTTATTGCTGCTCCTTATGAAAAGAATGTTCCCTTATCCGCCATCACAAACATCCTGACACCTGAGCTCATTGCCCAGTGGAAAGCCCAAATGAAGAAAGTAACACGTCTTTTAGTCCTACCCAAGTTCTCTCTGCTCAGCGAAGTTGATCTGAAGAAGCCACTGGAACGTCTCGGAATTACGGACATGTTCACTCAAGAGACTGCAGACTTCAGCCGCTTGTCTTCTGAAAAACCACTGTATGTATCTGAAGCTTTTCAAAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGCTGCAATCCTGCTAGCTCGAATGGCTCCTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACACTGCTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCCTGACCCCCCCTATACCTGTGAGATAGATGGCGTCAACAAGACTCACCTGAACCCTAAAGTCTGCCTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCGCCAAGGAGTATGAGTGTTTGAGCATTAATGAGTATGGAGTACGACTGTCGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAGAATGCATTGTAATTGAGCTTTTTTTATATTTATTAAATATATTTATTTAT
                                                      consensus depths                                                                                 7     8     7     8     7     8     7     8     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     7     9     7     9     7     9     7     9     7     9     8    10     8    10     8    10     8    10     8    10     8    10     7    10     7    10     7    10     7    10     8    11     7    10     5     8     3     6     3     6     3     6     3     6     2     5     3     8     3     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     7     4     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5
                                               BLH ATG      64     470                                                                            
                                               BLH MIN      13     133                                                                            
                                               BLH MPR      13     133                                                                            
                                               BLH OVR      64     103                                                                            
                                               EST CLI     -12      47                                                                            
                                               ORF LNG      64       9                                                                            
                                                                                                                                                                                                         PROTEIN --- Ci ---- 8e-028     BAB00620.1 Not2 [Ciona intestinalis] ----------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                               PROTEIN === Ce ==== 3e-032     NP_504890.1 serpin (srp-6) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 9e-042     NP_524953.1 Serine protease inhibitor 6 CG10913-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 3e-050     XP_787959.1 PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 1 [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                  PROTEIN --- Br ---= 2e-056     CAI64376.1 serpin 1 precursor [Branchiostoma lanceolatum] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                    PROTEIN --- Gg ==== 1e-062     NP_001004411.1 neuroserpin [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PROTEIN === Xt ==== 5e-073     CAJ81471.1 serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                       PREDICTED - Dr ---- 1e-084     XP_694226.1 PREDICTED: similar to plasminogen activator inhibitor-1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                            PROTEIN === Mm ==== 3e-108     NP_032897.1 serine (or cysteine) proteinase inhibitor, clade E, member 1 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                            PROTEIN === Hs ==== 8e-113     NP_000593.1 plasminogen activator inhibitor-1 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                  PROTEIN === Xl ==== 0          AAI23189.1 Serpine1 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === ?? ==== 0          AAI41763.1 LOC100049768 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAL22404.5                                                                                                                                            ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------ATG---------------------------------------------ATG------TGA------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------TGA------ATG---ATG------------------------------------TAG---------------------------------TAA---------------------TAA
                                                                   ORF                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       bld AbdN 5x                            IMAGE:7022737 TTTTTTTNNNGGGCCCCCACGCCATTAGGTGAGCTATANAACAATTTTCTNTAAGTAAAGCCCGGGATTTGCANGGAAACAGCTGCACANAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAAAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAATCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCCGGAGCAAATTTCTGGACAGCAAATATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAACGGGACCTGTCGCTGAACCCAAGCTTTCTCCCAAAATTTCAAACAACTTTTCCCCGACACCTCAGCCAGGTCAATTTTACTGATGTGGGCCATACCAAGGACATCAATAAAATCAATGGGTAAAAGAACAAACACAAAATGGAAATGATTCAAAGATTTTATTTGGGGCAACCAACAAAAATTACCCCCCAACTGAACCCCACCCTTTTTGTCGTAATTAAAATGGCCTGTTACCACCTTTCCATGTGTGGCAAAAAAGGAAACCGGTTTTTCCCATCTTCCCCTAAAGAGAAAAAGGGGAAACTTTTAATCCTGAGCGCCCCCCCCCTTTTTTTAACCAAAATACTCGGGAATGGGGCGGTTTCCCCCAAAATGTTGTTCCACAATGTTCTCTCCAAAAACTGAAAAAGTGGCTCACACACAAACTTTGGTGTGAAAAAATAAACTACAACTCTTCTCCGGTTGTGATATATTTTTTTACAAATCACACCCCCACAAAAATGAGGGTGGTGGAATAATCTTTTTTTATTGGATAAAGTTAGGGAAAATTAATAAAAACATCTCCCCCCTCTTTTTTTTTATTAGTCGAAAGAAAAAAAAGAAAATCTTCACACCCATTGGCAATTTAATTTTCTGCTCTGCCCCTCCCCATTTTTTTGTAGATAAAAAAAAATGTTATTCTCCCCTTTTTTTCAGCCCCCCCCCTTTCTACCAAAAACAATAATCTTTATTATAACCCACTTAAGGGACCTCTCTATATTTGCTCCACACGTGATGATAAAAGCCACCTCCTATCTTCTAAATTAAAAAATTTTACCACCCGCTGCCCTTCTTATTGTTTCCC
  5   1   2   10  bld Thy1 5g3  in                        CBST1051.fwd ...............................................................GAAGCTTGCAGGGAAACAGCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGNGAAATACAACTG
  5   1   2   20  bld Thy1 5g                             CBST6366.fwd ................................................................AAGCTTGCAGGGAAACAGCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTNCAATGATGGCCAACACT
  5   1   2   14 seed Brn4 5g3  in                        CAAL22404.5p .................................................................AGCTTGCAGGGAAACAGCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACAACTGCAGTGAATT
  5   1   2   10  bld Thy1 5g3  in                       CBST10177.fwd ..................................................................GCTTGCAGGGAAACAGCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACAACTGCAGTGAA
  5   1   2       bld AbdN 5x                            IMAGE:7023524                                                                      GATTGCAGGGAAAAGCTGCCAGAAATAATAGCCTTGCTGTCATCTACAGAAACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAAGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCCAAACCAATGGGGAAAAAAACTTGGGCCTTCCCCCCCCTTATGGGGGTACCTTCCGCCCTGGAGTGGCCCCTTAAGTCCGGTGGCAACTTGGGAACCAACCCGGGATTCAAAATTTCCCAAAAGCCCTCAAATTTTATGGCCACAAAAAAAAAAGGGGGCCAAGGGGCCCCTTGGCCACCAAAAAAAAAAATTTTCGGGAAAGCAAAAATTTTTTGTGGGAACACCCAAAAAAAATTTTTCGTTAGAAAAAACCCCCCAAACCCCGGGGTGCAACACATTTTGTGGCAAAAAGGGGGGCCCTCCCTTTTTTATAAAAAAACGGGGGGAAACCATTTTTCTCTCTCATAAAAACACCCCCCACGGATGTTTTTTTTCTCCCCCCAAAAAGATTTTTTTTAGGGAGAAAATTTTTTTTTCTCCCCCCCCGCAAACACCCCCCCTTCTTCCCCGCCCCGCGGGGGAAAAAATTTTTTTTTTTCTCCACCGAGGAGGAGAGGGGCCGCCGCCAAAAAATCTAGAAAAAGAAGAAGGGCACCTCCTACCCCCACTATATAATAATATATACCTCCGGGTGAGGAGGGGTAAGAATAAAAACAAACAATATACCTCACCGCCAGAGGCGGCTGGGTGAGATACCACATTTCTTCCCCCCNAN
  5   1   2       bld In62 5g                         IMAGE:8955400.5p                                                                          GGGAAACAGCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCACACTGGGAAATACACTGCAGTGAATTCACAACCCAGATGGGATTTTTATGATGTGATAGAGCTGCCATATGAAGGAAGGAGCTCAGCATGCTATGCTGCTCCTTATGAAAGATGTTCCTTATCCGCATCCAACATCCTGAACCTGACTCATTGCCATGGAGCCAATGAGAAGTACCGTCTTTAGTCCTACCAGTCTCTCTGCTCACGATGATTGAAAGCATGACGCTCGAATCGAATTCACAGAATCGCAACTCACGTGTCCGGAACCTGTGTTTGACTCAATCAGGGATGGAAAGACAAATTCGACAGT
  5   1   2   10  bld Tail 5g3  in                         CBSW8313.b1 .........................................................................GGGAAACAGCTGCACAGAAATAATAGCCTTGCTGTCATCTACAGAACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTGCTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAACGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGCAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCATCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCGTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACAA
  5   1   2   10  bld Hrt1 5g3  in                        CAAQ12808.5p ......................................................................................................................ACACCAGGAGCAACAGACAAAATGTCACGCAACTTAAGGTGCATGATAGTCGTCTTACTTTCCCTGGCATCAGTCACGTCTGCCCAAAACAGAGTGTCTCGTGTGGCTCAGAAAGGCACAAGTTTTGGGTTACGCTTGTTCCAAGAGGTTCTTGCAGACCAATGGGGAAAGAACCTGGGCTTCTCGCCTTATGGGGTAACTTCTGCCTTGAGTGTCCTTCAGTCGGGTGCAGCTGGGACGACACTGGATCAGATTCGCAAAGCTCTAAATTATGGACATAAAGAATGGGCAGTGGCCTTGGCACTAAATAAACTTCGGGAGCAGATTTCTGGACAGCAAAAATCTGCTGAAGACCCCAAGCCGGTACACATTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCGCTGACCCCAGGCTTTCTCCAAAGATTTCAAGCAACTTTCCACCGACACCTCAGCCAGGTCAATTTTACTGATGTGGCCCAAGCCAAGGACATCATAAATCAATGGGTAGAGAACAAGACAGATGGAATGATCAAAGATTTAGTGGGCAGCAACAACATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACAACTGCAGTGAATTCACAACCCCAGATGGGGATTTTTATGATGTGATAGAGCTGCCATATGAA
  5   1   2       bld Bone      in                        CBTC1345.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATACCCCCACTGACCCGCCTTGTGCTATTAAGTGCTGTACACTTCAGTGGCAAATGGACTGTTCCATTCCTAGAGAAGGCAACTCACCAGCGCCCCTTCTACAGATCTGATGGGTCTCATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACACC
  3   1   2       bld Hrt1 5g3  in                        CAAQ12808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATGTGCAAGTTCAAATGATGGCCAACACTGGGAAATACAACTGCAGTGAATTCACAACCCCAGATGGGGATTTTTATGATGTGATAGAGCTGCCATATGAAGGAGAGGAGCTCAGCATGCTTATTGCTGCTCCTTATGAAAAGAATGTTCCCTTATCCGCCATCACAAACATCCTGACACCTGAGCTCATTGCCCAGTGGAAAGCCCAAATGAAGAAAGTAACACGTCTTTTAGTCCTACCCAAGTTCTCTCTGCTCAGCGAAGTTGATCTGAAGAAGCCACTGGAACGTCTCGGAATTACGGACATGTTCACTCAAGAGACTGCAGACTTCAGCCGCTTGTCTTCTGAAAAACCACTGTATGTATCTGAAGCTTTTCAAAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGCTGCAATCCTGCTAGCTCGAATGGCTCCTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACACTGCTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCCTGACCCCCCCTATACCTGTGAGATAGATGGCGTCAACAAGACTCACCTGAACCCTAAAGTCTGCCTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCGCCAAGGAGTATGAGTGTTTGAGCATTAATGAGTATGGAGTACGACTGTCGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAGAATGCATTGTAATTGAGCTTTTTTTATATTTATTAAATATATTTATTTAC
  3   1   2       bld Brn4 5g3  in                        CAAL22404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGGAAATACAACTGCAGTGAATTCACAACCCCAGATGGGGATTTTTATGATGTGATAGAGCTGCCATATGAAGGAGAGGAGCTCAGCATGCTTATTGCTGCTCCTTATGAAAAGAATGTTCCCTTATCCGCCATCACAAACATCCTGACACCTGAGCTCATTGCCCAGTGGAAAGCCCAAATGAAGAAAGTAACACGTCTTTTAGTCCTACCCAAGTTCTCTCTGCTCAGCGAAGTTGATCTGAAGAAGCCACTGGAACGTCTCGGAATTACGGACATGTTCACTCAAGAGACTGCAGACTTCAGCCGCTTGTCTTCTGAAAAACCACTGTATGTATCTGAAGCTTTTCAAAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGCTGCAATCCTGCTAGCTCGAATGGCTCCTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACACTGCTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCCTGACCCCCCCTATACCTGTGAGATAGATGGCGTCAACAAGACTCACCTGAACCCTAAAGTCTGCCTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCGCCAAGGAGTATGAGTGTTTGAGCATTAATGAGTATGGAGTACGACTGTCGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAGAATGCATTGTAATTGAGCTTTTTTTATATTTATTAAATATATTTATTTAT
  3   1   2       bld Thy1 5g3  in                       CBST10177.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCCACTCTTTGTCTATTTTCCATCCCACTTACTTTGACGCAACTTAATCCATGGCTGGAGTAAAACTGATGTCCTTCTGGGTAGATACATAGCCCAATGAGGCCTAGGCCCAGCAGGAAGTCTTCTGTTTTCTTTGAGCACCATTCTTACCCCAGTTACAATGTTCGTTAAACACAGGAAGCTGCATTTTCCGGCTCAAACCGCACTACGCTGACACTTTTTGTTTGTTTTTCTTTTTTCTTTAGCTGAAAAACCACTGTATGTATCTGAAGCTTTTCAAAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGCTGCAATCCTGCTAGCTCGAATGGCTCCTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACACTGCTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCCTGACCCCCCCTATACCTGTGAGATAGATGGCGTCAACAAGACTCACCTGAACCCTAAAGTCTGCCTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCGCCAAGGAGTATGAGTGTTTGAGCATTAATGAGTATGGAGTACGACTGTCGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAGAATGCATTGTAATTGAGCTTTTTTTATATTTATTAAATATATTTATTTAT
  3   1   2       bld Thy1 5g3  in                        CBST1051.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGAGAGGAGCTCAGCATGCTTATTGCTGCTCCTTATGAAAAGAATGTTCCCTTATCCGCCATCACAAACATCCTGACACCTGAGCTCATTGCCCAGTGGAAAGCCCAAATGAAGAAAGTAACACGTCTTTTAGTCCTACCCAAGTTCTCTCTGCTCAGCGAAGTTGATCTGAAGAAGCCACTGGAACGTCTCGGAATTACGGACATGTTCACTCAAGAGACTGCAGACTTCAGCCGCTTGTCTTCTGAAAAACCACTGTATGTATCTGAAGCTTTTCAAAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGCTGCAATCCTGCTAGCTCGAATGGCTCCTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACACTGCTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCCTGACCCCCCCTATACCTGTGAGATAGATGGCGTCAACAAGACTCACCTGAACCCTAAAGTCTGCCTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCGCCAAGGAGTATGAGTGTTTGAGCATTAATGAGTATGGAGTACGACTGTCGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAGAATGCATTGTAATTGAGCTTTTTTTATATTTATTAAATATATTTATTTAT
  3   1   2       bld Bone      in                        CBTC1345.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGTTGTCTATTTTCCATCCCACTTACTTTGACGCAACTTAATCCATGGCTGGAGTAAAACTGATGTCTTTCTGGGTAGATACATAGCCCAATGAGGCTTAGGCCCAGCAGGAAGTCTTCTGTTTTCTTTGAGCACCATTCTTACCCCAGTTACAATGTTCGTTAAACACAGGAAGCTGCATTTTCCGGCTCAAACCGCATTACGCTGACACTATTTGTTTGTTTTTCTTTTTTCTTTAGCTGAAAAACCACTGTATGTATATGAAGCTTTTCACAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGATGCAATCCTGCTAGCTGGAATGGCTCTTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACAATGTTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCCTGACCCCCCCTATACCTCTGAGATAGATGGCGTCAACAAGACTCTCCTGAACCCTAAAGTTTGCTTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCTCCAAGGAGTATGAGTGTTTGAGCATTAATGAGTATGGAGTACGACTGTTGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAA
  3   1   2       bld Tail 5g3  in                         CBSW8313.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTCCTTATGAAAAGAATGTTCCCTTATCCGCCATCACAAACATCCTGACACCGGAGCTCATTGCCCAGTGGAAAGCCCAAATGAAGAAAGTAACACGTCTTTTAGTCCTACCCAAGTTCTCTCTGCTTAGCGAAGTTGATCTGAAGAAGCCACTGGAACGTCTCGGAATCACGGACATGTTCACTCAAGAGACTGCAGACTTCAGCCGCTTGTCTTCTGAAAAACCACTGTATGTATCTGAAGCTTTTCAAAAAATCAAGGTGGAAGTGACGGAAAAAGGCACAAGAGCATCTGCAGCAACAGCTGCAATCCTGCTAGCTCGAATGGCTCCTCTGGAGGTTATCATGGACCATCCTTTCTTGTTTATGGTCAGACACAACCCAACAGGCACACTGCTATTTGTGGGACAAGTCATGGAGCCCTGAGGGGAATGTTCTGTGCGTCTTGACCCCCCCTGTACCTGTGAGATAGATGGCGTCAACAAGACTCACCTGAACCCTAAAGTCTGCCTGTTGGGGGGGTGGGCAAGGAACTGGGCCAATAGGGGAAAGGGGAGAATAACGGGTAGTATGAGAGCGCCAAGGAGTATGAGTGTTTGAGCAGTAATGAGTATGGAGTACGACTGTCGTTGCCTTATAAGTAAGATTTTATAGAGTACTGATACTACTGAACTTGAGAATGCATTGTAATTGAGCTTTTTTTATATTTATTAAATATATTTATTTATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)