Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 84%

 1012082986 Xt7.1-CABJ3691.3 - 18 ESTs
                                                                       ........0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ3691.3         GTGGATATTGCGCTGCTGTTTGCCAGACATATGAAAACAAATGAAAGATACTGACTCCGGAACCTACTTTAGTGACTGAGCCAGATTTCTACTTGTTTTAGGGACCACATCACATGAGCGTTTAAATCCAGAGGAGTTGCTTATGAGTCAAGAGAAAATGCAGTCAGCCATAGCCATCCTCAAGCAAGCATCTGGAAATAAGGAAAAGGCTTGTCGAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCAGAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAAGGGCAATATGATTGGGAGAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAAAGTGAAAAAGAAAACCAGTGCCAAGATGTAGCCGCAGAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCAGAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACAAAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTGTGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAACAACCGGAAGAAGAGATAAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCTAGTTGTTGCAAAATACTTTTTTTGTAATTCTAAATAGTAAAACACTGCGGTTTTATAGATATATGTATATAAATGATACTAAGTTAATGAAAATGGCTAATATTTAGAAGTTTGCAACAGATTTTGACAAGATTCAGAGCAATATTCAGAAATGCACTAAAATGTTAGTCCATGTGTGCAGGCCACTTTGCTTTAGCACTCAGCATCATACCTTGGGGCTTTTTAAAGGGGACCATACACTGGATAATACTCTTCAGTATCCTACCAATCAGCCCTCTGGCTGAATTGGCGGCTACCATATGAGTGGCCATTTACATGTATGGCTGCCATACTAGTGTTCCATTTGTTTAATTAAACAATTGAAATAGCAGGAAGTGAAGAGGAGCTACAAATTTTCTTTACTCCTTCATCTATTGATGCATATTGCATCAGCAGATGAACAGATCAATATGTCAGAATAATATATCTGGGCATGTAAAGCCAGCTTAACTGTGCTAACACTGATATCTTTAAAATACTACCACCTGGAGGGTGGGTGGACATCATTTTCACGTCCAGTTGTTAAATGTTTTTCTTGCACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATTGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAATGCTTGTAAATCGCATTTTTCAGAAAAGGGTGGAGCTGTTTTTCACCTAAAAAAGAACCATGTCATGTAGACTTTAGTAATCAAAATAGGTAATATAATAGTGCCTGTTTGTAAGCAGCAGACCAATAAATACTTCCTGTTG
                                                  Xt7.1-CHK-1008231064               ATTGCGCTGCTGTTTGCCAGACATATGAAAACAAATGAAAGATACTGACTCCGGAACCTACTTTAGTGACTGAGCCAGATTTCTACTTGTTTTAGGGACCACATCACATGAGCGTTTAAATCCAGAGGAGTTGCTTATGAGTCAAGAGAAAATGCAGTCAGCCATAGCCATCCTCAAGCAAGCATCTGGAAATAAGGAAAAGGCTTGTCGAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCAGAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAAGGGCAATATGATTGGGAGAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAAAGTGAAAAAGAAAACCAGTGCCAAGATGTAGCCGCAGAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCAGAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACAAAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTGTGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAACAACCGGAAGAAGAGATAAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCTAGTTGTTGCAAAATACTTTTTTTGTAATTCTAAATAGTAAAACACTGCGGTTTTATAGATATATGTATATAAATGATACTAAGTTAATGAAAATGGCTAATATTTAGAAGTTTGCAACAGATTTTGACAAGATTCAGAGCAATATTCAGAAATGCACTAAAATGTTAGTCCATGTGTGCAGGCCACTTTGCTTTAGCACTCAGCATCATACCTTGGGGCTTTTTAAAGGGGACCATACACTGGATAATACTCTTCAGTATCCTACCAATCAGCCCTCTGGCTGAATTGGCGGCTACCATATGAGTGGCCATTTACATGTATGGCTGCCATACTAGTGTTCCATTTGTTTAATTAAACAATTGAAATAGCAGGAAGTGAAGAGGAGCTACAAATTTTCTTTACTCCTTCATCTATTGATGCATATTGCATCAGCAGATGAACAGATCAATATGTCAGAATAATATATCTGGGCATGTAAAGCCAGCTTAACTGTGCTAACACTGATATCTTTAAAATACTACCACCTGGAGGGTGGGTGGACATCATTTTCACGTCCAGTTGTTAAATGTTTTTCTTGCACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATTGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAATGCTTGTAAATCGCATTTTTCAGAAAAGGGTGGAGCTGTTTTTCACCTAAAAAAGAACCATGTCATGTAGACTTTAGTAATCAAAATAGGTAATATAATAGTGCCTGTTTGTAAGCAGCAGACCAATAAATACTTCCTGTTGCTTGGT
                                                      consensus depths              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     6     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     8     9     8    10     9    10     9    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     9    10     9    10     9    10     9    10     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4
                                               BLH ATG     157     158         
                                               BLH MIN     157      20         
                                               BLH MPR     130      20         
                                               BLH OVR     142     119         
                                               CDS MIN     142      20         
                                               ORF LNG     142       3         
                                                                                                                                                                                                                 PROTEIN --- Dr ---- 3e-010     NP_001002040.1 cyclin-dependent kinase inhibitor 1C (p57, Kip2) [Danio rerio] ============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 2e-011     NP_000380.1 cyclin-dependent kinase inhibitor 1A [Homo sapiens] =================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 1e-012     NP_031695.1 cyclin-dependent kinase inhibitor 1A (P21) [Mus musculus] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                             PROTEIN --- Gg ==== 2e-014     NP_989727.1 cdk inhibitor CIP1 (p21) [Gallus gallus] ==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 3e-059     AAT88078.1 cyclin dependent kinase inhibitor p16Xic2 [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === ?? ==== 3e-059     NP_001087933.1 cyclin dependent kinase inhibitor p16Xic2 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ3691.3                                        TGA------ATG---------------------------------TGA---------------------------------------------------------------ATG------------ATG---------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TGA---------------TGA------------------------------------------------------------------ATG------------------------ATG---------TAG------------------------------------------------TAATAA------------------------------------------------------------TAG------------------------------------------------------------ATG---------------------ATG---ATG---------TAG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TGA---------------ATG------------------------------TAG------------------------------TAG------------------------------------------------ATG------------------------------ATG------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------TAA------------------------------------------------------------------------------------------------------------------------------ATG---------------------TAG------------TAA------------TGA------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------TAG------------------TAA---TGA---------------------------ATG---TAA------------TAA------------------------TAA---------------------TAG------------------ATG------------------------------------------TAA---------------------TAA---------------------------------------------------------TAA---------------TAA------------ATG---------------------------------------------TAA---------ATG------------TAGTAA------TAG------TAATAG
                                                                   ORF                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  0   1   1           Liv1 FL                          CAAR1078.FL-MGC                                                                                                    CTTGTTTTAGGGACCACATCACATGAGCGTTTAAATCCAGAGGAGTTGCTTATGAGTCAAGAGAAAATGCAGTCAGCCATAGCCATCCTCAAGCAAGCATCTGGAAATAAGGAAAAGGCTTGTCGAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCAGAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAAGGGCAATATGATTGGGAGAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAAAGTGAAAAAGAAAACCAGTGCCAAGATGTAGCCGCAGAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCAGAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACAAAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTGTGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAACAACCGGAAGAAGAGATAAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCTAGTTGTTGCAAAATACTTTTTTTGTAATTCTAAATAGTAAAACACTGCGGTTTTATAGATATATGTATATAAATGATACTAAGTTAATGAAAATGGCTAATATTTAGAAGTTTGCAACAGATTTTGACAAGATTCAGAGCAATATTCAGTAATGCACTAAAATGTTAGTCCATGTGTGCAGGCCACTTTGCTTTAGCACTCAGCATCATACCTTGGGGCTTTTTAAAGGGGACCATACACTGGATAATACTCTTCAGTATCCTACCAATCAGCCCTCTGGCTGAATTGGCGGCTACCATATGAGTGGCCATTTACATGTATGGCTGCCATACTAGTGTTCCATTTGTTTAATTAAACAATTGAAATAGCAGGAAGTGAAGAGGAGCTACAAATTTTCTTTACTCCTTCATCTATTGATGCATATTGCATCAGCAGATGAACAGATCAATATGTCAGAATAATATATCTGGGCATGTAAAGCCAGCTTAACTGTGCTAACACTGATATCTTTAAAATACTACCACCTGGAGGGTGGGTGGACATCATTTTCACGTCCAGTTGTTAAATGTTTTTCTTGCACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATTGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Ski1 PIPE in                         CABJ3691.5p CCATCCCCGTGGATATTGCGCTGCTGTTTGCCAGACATATGAAAACAAATGAAAGATACTGACTCCGGAACCTACTTTAGTGACTGAGCCAGATTTCTACTTGTTTTAGGGACCACATCACATGAGCGTTTAAATCCAGAGGAGTTGCTTATGAGTCAAGAGAAAATGCAGTCAGCCATAGCCATCCTCAAGCAAGCATCTGGAAATAAGGAAAAGGCTTGTCGAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCAGAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAAGGGCAATATGATTGGGAGAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAAAGTGAAAAAGAAAACCAGTGCCAAGATGTAGCCGCAGAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCAGAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACAAAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTGTGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAACAACCGGAAGAAGAGATAAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCTAGTTGTTGCAAAATACTTTTTTTGTAATTCTAAATAGTAAAACACTGCGGTTTTATAGATATATGTATATAAATGATACTA
  5   1   2   12  bld Tad5 5g3  in                         XZT38301.5p ........GTGGATATTGCGCTGCTGTTTGCCAGACATATGAAAACAAATGAAAGATACTGACTCCGGAACCTACTTTAGTGACTGAGCCAGATTTCTACTTGTTTTAGGGACCACATCACATGAGCGTTTAAATCCAGAGGAGTTGCTTATGAGTCAAGAGAAAATGCAGTCAGCCATAGCCATCCTCAAGCAAGCATCTGGAAATAAGGAAAAGGCTTGTCGAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCAGAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAAGGGCAATATGATTGGGAGAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAAAGTGAAAAAGAAAACCAGTGCCAAGATGTAGCCGCAGAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCAGAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACAAAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTGTGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAACAACCGGAAGAAGAGATNAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCNNTAGTGTGCAAAATAC
  5   1   2       bld Neu  FL                        TNeu012k07.p1kSP6                                                                                    TTCGCTCGGGTTGTTTGTTGCGCCATTCCCGTGGATATTGCGCTGCTGTTTGCCAGACATATGAAAACAAATGAAAGAGAAAATGCAGTCAGCCATAGCCATCCTCAAGCAAGCATCTGGAAATAAGGAAAAGGCTTGTCGAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCAGAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAAGGGCAATATGATTGGGAGAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAAAGTGAAAAAGAAAACCAGTGCCAAGATGTAGCCGCAGAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCAGAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACAAAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTATGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAAC
  5   1   2       bld TbA  5g3  in                   TTbA041p22.p1kSP6                                                                                              TTCTACTTTGTTTTAGGGACCACATCACATGAGCGTTTAAATCCAGAGGAGTTGCTTATGAATCAATACAAAATGCAGTCTTCCATAGCCATCCTCTAGCAAGCATCTGGAAATAAAGAAAAGGCTTGTCTAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCACAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAATGGCAATATGATTGGTACAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAGAGTGAAAAAGAACACCAATGCCAAGATGTATCCGCATAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCACAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACACAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTGTGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACAT
  5   1   2   10  bld Liv1 FL   in                         CAAR1078.5p ...................................................................................................CTTGTTTTAGGGACCACATCACATGAGCGTTTAAATCCAGAGGAGTTGCTTATGAGTCAAGAGAAAATGCAGTCAGCCATAGCCATCCTCAAGCAAGCATCTGGAAATAAGGAAAAGGCTTGTCGAATGCTTTTTGAAGCTGTGGACCATGAACAGCTAAAAACTGAATTTCATGAACTTATGCAGAGATCCAACGAGGAAGCAAAAGCTAAATGGAACTTTGACTTTGTCACTGAAACTCCTCTTGAAGGGCAATATGATTGGGAGAAGGTAGAAGACAAAACCTTGAATTGCAATTCGCAGGAAAGTGAAAAAGAAAACCAGTGCCAAGATGTAGCCGCAGAGATGTGTAACATTAACCAATCCCATAAAGCTTCCCAGAATTGTGAAAGCAGCGATTCAGGCAAAAGGAAACAAAAGCTGATCACAGATTTTTATCCTGTCAAGCGGAGATGTTCACCTAAACCCAGCCCCCGCGATTGATCACTATGCTGTTTGTGAGGTCCTTTCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAACAACCGGAAGAAGAGATAAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCTAGTTGTTGCAAAATACTTTTTTTGTAATTCTAAATAGTAAAACACTGCGGTTTTATAGATATATGTATATAAATGATACTAAGTTAATGAAATGGCT
  5   1   2       bld Te1       in                        CBWN14095.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTATGCTGTTTATGAGGTCCTTCCTTTGGACCTGAACAAATTTTCATTTCTCAGTTTAAGGTGTCAGAACGCTGGATTTTTCATGCTCTTATACAAAACCTGGACTTTAATGGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAACAACCGGAAGAAGAGATAAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCTAGTTGTTGCAAAATACTTTTTTTGTAATTCTAAATAGTAAAACACTGCGGTTTTATAGATATATGTATATAAATGATACTAAGTTAATGAAAATGGCTAATATTTAGAAGTTTGCAACAGATTTTGACAAGATTCAGAGCAATATTCAGAAATGCACTAAAATGTTAGTCCATGTGTGCAGGCCACTTTGCTTTAGCACTCAGCATCATACCTTGGGGCTTTTTAAAGGGGACCATACACTGGATAATACTCTTCAGTATCCTACCAATCAGCCCTCTGGCTGAATTGGCGGCTACCATATGAGTGGCCATTTACATGTATGGCTGCCATACTAGTGTTCCATTTGTTTAATTAAACAATTGAAATAGCAGGAAGTGAAGAGGAGCTACAAATTTTCTTTACTCCTTCATCTATTGATGCATATTGCATTAGCAGATGAACAGATCAATATGTCAGA
  5   1   2       bld Tbd1      in                        CBXT10668.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGACATTACATAGACTCCAGAGAACTTCAAAATCCTCACAGATTGTACCTCACTATTACTTTAATAATTTAAACAACCGGAAGAAGAGATAAGCATTAGCTTTAGTGGTGTATGTTTGCTGAGTTTCTAGTTGTTGCAAAATACTTTTTTTGTAATTCTAAATAGTAAAACACTGCGGTTTTATAGATATATGTATATAAATGATACTAAGTTAATGAAAATGGCTAATATTTAGAAGTTTGCAACAGATTTTGACAAGATTCAGAGCAATATTCAGTAATGCACTAAAATGTTAGTCCATGTGTGCAGGCCACTTTGCTTTAGCACTCAGCATCATACCTTGGGGCTTTTTAAAGGGGACCATACACTGGATAATACTCTTCAGTATCCTACCAATCAGCCCCCTGGCTGAATTGGCGGCTACCATATGAGTGGCCATTTACATGTATGGCTGCCATACTAGTGTTCCATTTGTTTAATTAAACAATTGAAATAGCAGGAAGTGAAGAGGAGCTACAAATTTTCTTTACTCCTTCATCTATTGATGCATATTGCATCAGCAGATGAACAGATCAATATGTCAGAATAATATATCTGGGCATGTAAAGCCAGCTTAACTGTGCTAACACTGATATCTTTAAAATACTACCACCTGGAGGGTGGGTGGACATCATTTTCACGTCCAGTTGTTAAATGTTTTTCTTGGACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATTGGG
  5   1   2       bld Tad5      in                           XZT178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGCACTAAAATGTTAGTCCATGTGTGCAGGCCACTTTGCTTTAGCACTCAGCATCATACCTTGGGGCTTTTTAAAGGGGACCATACACTGGATAATACTCTTCAGTATCCTACCAATCAGCCCTCTGGCTGAATTGGCGGCTACCATATGAGTGGCCATTTACATGTATGGCTGCCATACTAGTGTTCCATTTGTTTAATTAAACAATTGAAATAGCAGGAAGTGAAGAGGAGCTACAAATTTTCTTTACTCCTTCATCTATTGATGCATATTGCATCAGCAGATGAACAGATCAATATGTCAGAATAATATATCTGGGCATGTAAAGCCAGCTTAACTGTGCTAACACTGATATCTTTAAAATACTACCACCTGGAGGGTGGGTGGACATCATTTTCACGTCCAGTTGTTAAATGTTTTTCTTGCACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATTGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGA
  3   1   2      seed Liv1 FL   in                         CAAR1078.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGTGGGTGGACATCATTTTCACGTCCAGTTGTTAAATGTTTTTCTTGCACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATTGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCC
  3   1   2       bld TbA  5g3  in                    TTbA041p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCATTTTCACGTCCAGTTGTTAAATGTTTTTCTTGCACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATGGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTGGGAATAATGGCTGAGTTAATGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGTTAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTATTACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTTTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATAATAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCTTAACCCCTGCACAATTAAGGTTTCCACCAATACATCCTTTATTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAAGGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATCTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTCCGTGTATGTGTTAAATTTGTGGAATCGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATAT
  3   1   2       bld Tbd1      in                        CBXT10668.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTCCAGTTGTTAAATGTTTTTCTTGGACTTACAGAGTTATTGTTTATTATAGCTATAAACAAACACAGAATAGGTTCTAAACACCTTAAGATATCCTAGATTGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAAAAAAAAAAAAA
  3   1   2       bld Ski1 PIPE in                         CABJ3691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATAGCTATAAACAAACACAGATAGGTTTCTAAACACCTTAAGATATCCTAGATTGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAATGCTTGTAAATCGCATTTTTCAGAAAAGGGTGGAGCTGTTTTTCACCTAAAAAAGAACCATGTCATGTAGACTTTAGTAATCAAAATAGGTAATATAATAGTGCCTGTTTGTAAGCAGCAGACCAATAAATACTTCCTGTTGCTGGTTAAAAAAA
  3   1   2       bld Te1       in                        CBWN14095.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATCCTAGATTGGGGCTGCTAAGATACTGATCCTGTGCCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                           XZT178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGATTGGGCTGCTAAGATACTGATCCTGTGGCATACCAACAAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGACCATATATTGAACTTCAAAAGGCAACTTGAACTTAATACCTATGAAAACCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTACAGAGTAAGGACAGATTTTTTTGGACACCCCCTAGTATACTAGTGTTATTTATTACACCTTTAACACTGAACATTTTTAGAAGGAAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCC
  3   1   2       bld Tad5 5g3  in                         XZT38301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAAGGCATCCAAGTATAATGCTCTAGAACAGCAGTTCCCACACTATAGGGCTGTCCCTCATAGGGGGGCTGGAGCAATGGAGCCATTAACGGAAAGATTTTAGATATTCTTGGAATAATGGCTGAGTTACTGAAAGCAAGGGTATTTCCTAATCTCTGTAACCTTGGTTTGGGATAAGGGGATCCCAGCCCATATATTGAACTTCAAAAGGCAACTTGAACTTAATCCCTATGAAACCCAATAGAAAGAAATCATTGTGGAAAATTCTAAATATGTCTCCAGAGTAAGGCCAGATTTTTTTGGCCCCCCCCTAGTATACTAGTGTTATTTATTCCCCCTTTACCCCTGACCATTTTTAGAAGGAAATGTAACAATCATGTCATAACCCCTGCCCAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGACCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTAGGGGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCC
  5   1   2       bld TpA       in                   TTpA017c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAATGCTTGTAAATCGCATTTTTCAGAAAAGGGTGGAGCTGTTTTTCACCTAAAAAAGAACCATGTCATGTAGACTTTAGTAATCAAAATAGGTAATATAATAGTGCCTGTTTGTAAGCAGCAGACCAATAAATACTTCCTGTTGCTTGGTT
  3   1   2       bld TpA       in                    TTpA017c07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATGTAACAATCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTTTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAATGCTTGTAAATCGCATTTTTCAGAAAAGGGGGGAGCTGTTTTTCCCCTAAAAAAGAACCATGTCATGTAGACTTTAGTAATCAAAATAGGTAATATAATAGTGCCTGTTTGTAAGCAGCAGACCAATAAATACTTCCTGTTGCTTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg                            TEgg133a12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCATGTCATAAACCCTGCACAATTAAGGTTTCCAGCAATACATCCTCTACTAATCAGACTGGGATAATTGGCAATAGCGTCGAGCTCAGTGTAGAATGGAGCAATATCTGTTTAAGTTTTGTTTGGGGCATGTGCTAATATAAGGGAAAGGGATATTTTTATTTTAAAATATTTTAATTTATCTATGTGTATGTGTTAAATTTGTTGAATTGTTCTTATTTTATTAATATATAAAGTTCCCTTAAAATATTGCCAAAATGCTTGTAAATCGCATTTTTCAGAAAAGGGTGGAGCTGTTTTTCACCTAAAAAAGAACCATGTCATGTAGACTTTAGTAATCAAAATAGGTAATATAATAGTGCCTGTTTGTAAGCAGCAGACCAATAAATACTTCCTGTTGCTTGGTTATTATGGTTTATTAGACTTGGAACAATTTTGCACTTGTCACTCCTTCATCTGCTAAAGGGTTTTAGTTAACACTTTAAAGGGGACATATTGTGTGAGAAACAATATTGTGCGCATGAATTGTACTCACCTAATTATATAAGGAATGTGCTTTAAAAAGTAGTGTTTCGGGATGGTTTATTTGACATTTCTCCAAAACCCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)