Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT11320.5                            9 END     2          13       25                eomesodermin [Xenopus laevis]
     2   2.0    0Xt7.1-XZT3338.3                             6 END     2          13       33                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012083210 Xt7.1-TGas067m10.3 - 15 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas067m10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCTACCAGAACACTGATATCACTCAGTTGAAGATTGACCACAACCCATTTGCAAAAGGCTTCAGGGATAATTATGATTCCATGTACACAGCATCAGAAAGTGACAGATTAACGCCATCTCCTGCGGATTCTCCTAGATCTCACCAGATAGTCCCTGGGACCCGCTACAGTGTGCAGCCTTTCTTCCAGGACCAGTTTGTCAACAATCTGCCCCCTGCCAGATATTACAGTGGGGAGAGGACTGTCCCCCAAGCAAATGGTCTCCTGTCTCCACAGACCAACGACGAAGTGGCAAATGCTCCCCCTCAGCGGTGGTTTGTGACCCCAGTCCAACAAGCTGCTGCAAATAAACTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCTTCGCTTCCATGGCAGGCTGGGGAAGCAGAGGTTCTACATATCAGAGGAAAATGACAACAACTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTCCTATAAAGTGTGAAGACATTGGCAATGAGGACTATAAAGATGCCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAATGTGGTGCCTCTTGGGAAAT
                                                  Xt7.1-CHK-1008232547                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCAGAACACTGATATCACTCAGTTGAAGATTGACCACAACCCATTTGCAAAAGGCTTCAGGGATAATTATGATTCCATGTACACAGCATCAGAAAGTGACAGATTAACGCCATCTCCTGCGGATTCTCCTAGATCTCACCAGATAGTCCCTGGGACCCGCTACAGTGTGCAGCCTTTCTTCCAGGACCAGTTTGTCAACAATCTGCCCCCTGCCAGATATTACAGTGGGGAGAGGACTGTCCCCCAAGCAAATGGTCTCCTGTCTCCACAGACCAACGACGAAGTGGCAAATGCTCCCCCTCAGCGGTGGTTTGTGACCCCAGTCCAACAAGCTGCTGCAAATAAACTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCTTCGCTTCCATGGCAGGCTGGGGAAGCAGAGGTTCTACATATCAGAGGAAAATGACAACAACTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTCCTATAAAGTGTGAAGACATTGGCAATGAGGACTATAAAGATGCCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAATGTGGTGCCTCTTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     4     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     5     5     6     6     7     7     6     7     6     7     7     8     7     8     7     8     7     7     8     8     8     9     8     9     7     8     8     9     7     9     8     9     9     9     9     9     8     9     8     9     8     9     8     9     9     9     8     9     9     9     9     9     8     9     9     9     8     9     9     9     7     9     8     9     9     9     8     9     8     9     7     8     7     8     7     8     8     9     9     9     8     9     8     9     9     9     8     9     9     9     9     9     8     9     8     9     8     9     9     9     8     9     9     9     8     9     8     9     8     9     8     9     5     8     3     5
                                                                                                                                                                                                                          PROTEIN --- Bb ---- 4e-010     BAB63370.1 T-brain [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================
                                                                                                                                         PROTEIN --- Bf ---- 4e-010     AAG34893.2 T-box protein AmphiEomes/Tbr1/Tbx21 [Branchiostoma floridae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================
                                                                       ...PREDICTED - Sp ---- 8e-009     XP_791266.1 PREDICTED: similar to T-brain-1 protein (T-box brain protein 1) (TBR-1) (TES-56) [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                                                                                      PROTEIN --- Xt ---- 9e-059     AAI36087.1 Unknown (protein for MGC:122605) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 9e-099     NP_571754.3 eomesodermin homolog [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-105     NP_005433.2 eomesodermin; t box, brain, 2 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 2e-117     XP_426003.2 PREDICTED: similar to eomesodermin [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 4e-118     NP_034266.2 eomesodermin homolog [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 4e-158     AAI25987.1 LOC398065 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 4e-158     NP_001081810.1 eomesodermin [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas067m10.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------ATG---------------------------------------------------------------TGA------TAA------------------------------TAA---ATG---TAA---------TAATGA---------------TAA---------------------------------------TAAATG------------TAA---------------------------------------------------------------------------TAA---------TAA------------------------ATG---------TAA---------------------------------------------------TAG---TAG------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld Gas       in                   TGas072g21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGCAGGAGATCTCCTTCGGGAAACTCAAACTCACCAACAACAAAGGCGCAAATAACAACAGCACCCAGATGATAGTGCTGCAGTCTCTGCACAAGTACCAGCCTCGCCTGCACATAGTAGAAGTGAGTGAGGATGGAGTGGAGGATCTGAACGACTCTGCTAAGAGCCAGACTTTTACCTTTCCGGAGACGCAGTTCATCGCGGTGACAGCCTACCAGAACACTGATATCACTCAGTTGAAGATTGACCACAACCCATTTGCAAAAGGCTTCAGGGATAATTATGATTCATCTCACCAGATAGTCCCTGGGACCCGCTACAGTGTGCAGCCTTTCTTCCAGGACCAGTTTGTCAACAATCTGCCCCCTGCCAGATATTACAGTGGGGAGAGGACTGTCCCCCAAGCAAATGGTCTCCTGTCTCCACAGACCAACGACGAAGTGGCAAATGCTCCCCCTCAGCGGTGGTTTGTGACCCCAGTCCAACAAGCTGCTGCAAATAAACTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCT
  5   1   2       bld Tad5      out                         XZT3338.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATCGCGGTGACAGCCTACCAGAACACTGATATCACTCAGTTGAAGATTGACCACAACCCATTTGCAAAAGGCTTCAGGGATAATTATGATTCCATGTACACAGCATCAGAAAGTGACAGATTAACGCCATCTCCTGCGGATTCTCCTAGATCTCACCAGATAGTCCCTGGGACCCGCTACAGTGTGCAGCCTTTCTTCCAGGACCAGTTTGTCAACAATCTGCCCCCTGCCAGATATTACAGTGGGGAGAGGACTGTCCCCCAAGCAAATGGTCTCCTGTCTCCACAGACCAACGACGAAGTGGCAAATGCTCCCCCTCAGCGGTGGTTTGTGACCCCAGTCCAACAAGCTGCTGCAAATAAACTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCTTCGCTTCCATGGCAGGCTGGGGAAGCAGAGGTTCTACATATCAGAGGAAAATGACAACAACTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTCCTATAAAGTGTGAAGACATTGGCAATGAGGACTATA
  5   1   2       bld Tad5      out                         XZT3337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATCGCGGTGACAGCCTACCAGAACACTGATATCACTCAGTTGAAGATTGACCACAACCCATTTGCAAAAGGCTTCAGGGATAATTATGATTCCATGTACACAGCATCAGAAAGTGACAGATTAACGCCATCTCCTGCGGATTCTCCTAGATCTCACCAGATAGTCCCTGGGACCCGCTACAGTGTGCAGCCTTTCTTCCAGGACCAGTTTGTCAACAATCTGCCCCCTGCCAGATATTACAGTGGGGAGAGGACTGTCCCCCAAGCAAATGGTCTCCTGTCTCCACAGACCAACGACGAAGTGGCAAATGCTCCCCCTCAGCGGTGGTTTGTGACCCCAGTCCAACAAGCTGCTGCAAATAAACTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCTTCGCTTCCATGGCAGGCTGGGGAAGCAGAGGTTCTACATATCAGAGGAAAATGACAACAACTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTCCTATAAAGTGTGAAGACA
  5   1   2       bld Gas       ?                    TGas055n22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTACAGTGTGCAGCCTTTCTTCCAGGACCAGTTTGTCAACAATCTGCCCCCTCAGCGGTGGTTTGTGACCCCAGTCCAACAAGCTGCTGCAAATAAACTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCTTCGCTTCCATGGCAGGCTGGGGAAGCAGAGGTTCTACATATCAGAGGAAAATGACAACAACTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTCCTATAAAGTGTGAAGACATTGGCAATGAGGACTATAAAGATGCCACAAAGGGACTTGGGTATTACTCTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTTTAATATGACCTTATGGGATGGACCACT
  5   1   2       bld Gas       in                   TGas067m10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACGAAGTGGCAAATGCTCCCCCTCAGCGGTGGTTTGTGACCCCAGTCCAACAAGCTGCTGCAAATAAACTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCTTCGCTTCCATGGCAGGCTGGGGAAGCAGAGGTTCTACATATCAGAGGAAAATGACAACAACTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTCCTATAAAGTGTGAAGACATTGGCAATGAGGACTATAAAGATGCCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTC
  5   1   2      seed Gas7      in                         XZG50884.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGACATGGGGGCATATGAAACAGACTACTCCTCAGGTTCCCTCCTCACCTATGGCATTAAGTCTCTGCCCATCCAAACCTCCCACCCAATGGCCTACTACCCAGATGCAGCCTTCGCTTCCATGGCAGGCTGGGGAAGCAGAGGTTCTACATATCAGAGGAAAATGACAACAACTTTACCTTGGTCCTCAAGGTCAAGTCCTTCAGGTTTCTCAGAAGATCTCCTACCCAAGGACAAGGTCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTCCTATAAAGTGTGAAGACATTGGCAATGAGGACTATAAAGATGCCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACAT
  3   1   2       bld Gas       in                    TGas067m10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAAGGAAGAGATGAGCTCTTCGTGGGTAGAAACCCCTCCCCTTCCATTAAATCGCTAGACTCTAATGATTCTGGGGTATATACAGGTGCTTGCAAGAGAAGGAGGCTCTCCCCTAGCACCTCAAGCAATGAAAACTCTCCTTCCTATAAAGTGTGAAGACATTGGCAATGAGGACTATAAAGATGCCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAATGTGGTGCCTCTGGGAAATCCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn3 5g3  out                         CAAK626.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATAAAGTGTGAAGACATTGGCAATGAGGACTATAAAGATGCCACAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAATGTGGTGCCTCTTGGGAAATCC
  3   1   2       bld TpA       out                   TTpA055c01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCCCGGGGAAAGGGACTTGGGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAATGTGGTGCCTCTTGGGAAATCCAAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas       in                    TGas072g21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTATTACTCTTTCTACTCTAGTTCTTAAAGAAAGGTTCTTTTGCGGTATAAATATGCCCTTATGGGAGGGACCCCTGTATATGCCAAAAAGGGGGTTTCCCTTTCATTGGGGGTCCTCATTCACCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGCCATTAATGAGTAAACCAGGTTTTCTAAATATATATATAGGTATATAGTGGTTATTATATATATTTATAAAGGTATAAATATATATAATTATTATTATGTTTTATTTAGGGCACAAAATGCCAATGTACATTTTTTGTATATCCCCCTGCATATTGGGGGGTATAAGATTTTGTATAAATAGCGGCGTTTCTGTTGGGAAAGATGTCCCTGACATAAAATGCACGGGGGGGTTGTCCATTGTTTTCGGGGCACAAAGCTGTATATTTATAGAGTTGGGGGGCAATTTCAGAATGTATTTTCCACTTTTTCTGGGAAGATTTCTATTAAAATCTTGTCTTTTAGGGCAAATCATGTCCAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGGGGCTTTACCAAGCTTTCTCTTTCTTTGGTTTTGGTAAATATGGCGGCCATTTTTAAAAAAGGGGGTCCCTCTGGGGAATTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas                             TGas065f04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAAGAAAGGTTCTTTTGCTGTATAAATATGACCTTATGGGATGGACCACTGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTCCCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAAATGTGGTGCCTCTTGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 PIPE out                        XZG18065.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTATATGCCAAAAAGTGGGTTTGCCTTTCATTTGGCGTCCTCACTCAGCCATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTCTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCCGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCCGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAA
  3   1   2       bld Gas7      in                         XZG50884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAGGGGGGTTGCCTTTCATTTGGGGGCCCCCCTCCCCCCCGAAAGGGTTAAAGCCCCCGGATTTTTTTTATAATTTTTTTTTAAGGAAAGGAATAAGCTTGGCCCTAATGAGTAAAACAGGTTTTCTAAAAAAAAAAAAAGGGAAAAAGGGGGTTTTATATATATTTATAAAGGGATAAAAATAAATAATTTTTTTTTTGTTTTATTTTTGGCCCAAAATGCCCATGGCCCTTTTTTGTATATCCCCCCCCCTTTTGTGGGGTTTAAGATTTTGTTTAAAAAGCCGCGTCTCTTTTTGGAAAAATGTCCCCGCCCTAAAAAGCCCCGGGGGGGTGTCCCTTGTTTTCGGGGCCCAAAGCCGTATTTTTTTAGAGTTAGGGGGCAAAGTCCGAAAGTTTTTTCCCCTTTGTCTTGGAAGATTTTTATTTAAATCTTGTCTTTTTGGGCAAACCCTGTCCAAAAGTAAAGTCCCGTCCTGAATGTTCCGAAGGGGGGCCCCTTGGGGCTTTACCCAGCTTTTTCTTTCTTTTGTTTTTGGAAAAATTGCGGCCCTTTTTAAAAAAAGGGGGGCCCCTGGGGG
  5  -1   2       bld Gas                            TGas004l13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGAAAGTGTTAAAGCCTCAGTATTATTATTATAATTTTTTTTAAGGAATGGAATAAGCTTGGCACTAATGAGTAAAACAGGTTTTTTAAATATATATATATGTATATAGTTGTTATTATATATATTTATAAATGTATAAATATATATAATTATTATTATGTTTTATTTATGGCACAAAATGCCAATGTACATTTATTGTATATACACCTGCATATTGTGGAGTATAAGATATTGTATAAATAGCAGCGTCTCTGTTTGGAAAGATGTACCTGACATAAAATGCACTGGTGGGTTGTACATTGTATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAATGTGGTGCTCTTGGGAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Gas                            TGas037k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTCGTGGCACAAAGCTGTATATTTATAGAGTTAGGTGGCAATGTCAGAATGTATTTTCCACTTTGTCTTGGAAGATTTCTATTTAAATCTTGTCTTTTATGGCAAATCATGTACAAATGTAAAGTCCAGTACTGAATGTTCCGAAGTGGGACGCATTGTGGCTTTACCTAGCTTTCTCTTTCTTTCGTTTTTGTATATATTGCTGTCATTTTTAATAAATGTGGTGCCTCTTGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)