Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK8696.3                           33 END     1          14        3                PREDICTED: similar to Rap guanine nucleotide exchange factor (GEF) 3 [Gallus gallus]

 This cluster: approximate FL confidence score = 85%

 1012083539 Xt7.1-IMAGE:7022325.5 - 7 ESTs
                                                                       .-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-IMAGE:7022325.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTCACCATAATGCTGCGTCTTCTTGCGATTTTTGCCACACTCTGCGCTGTTGCAAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAACTAAATGAAATAAAGTGTATAATATAAAGATAAA
                                                  Xt7.1-CHK-1008239991                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATAATGCTGCGTCTTCTTGCGATTTTTGCCACACTCTGCGCTGTTGCAAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAACTAAATGAAATAAAGTGTATAATATAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     3     3     3     3     3     4     5     4     5     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     5     6     5     6     3     4
                                               BLH ATG      10     330                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                              PROTEIN --- Gg ---- 9e-032     NP_001038151.1 peptidoglycan recognition protein L [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 6e-034     XP_001200942.1 PREDICTED: similar to peptidoglycan recognition protein SC2 [Strongylocentrotus purpuratus] =============================================================================================================================================================================================
                                                                       PREDICTED - Dr ---- 4e-040     NP_001038687.1 hypothetical protein LOC571817 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 1e-043     NP_033428.1 peptidoglycan recognition protein; tumor necrosis factor super family 3-like[Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 1e-044     NP_005082.1 peptidoglycan recognition protein; TNF superfamily, member 3 (LTB)-like(peptidoglycan recognition protein) [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ==== 7e-053     NP_610410.1 CG14745-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 5e-098     AAH87429.1 LOC496035 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 5e-098     NP_001088771.1 hypothetical protein LOC496035 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 2e-107     NP_001015775.1 MGC108330 protein [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:7022325.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------TAA---------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   1           AbdN FL                     IMAGE:7022325.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCTCACCATAATGCTGCGTCTTCTTGCGATTTTTGCCACACTCTGCGCTGTTGCAAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAACTAAATGAAATAAAGTGTATAATATAAAGATAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   32  bld Tad5 5g                              XZT27735.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGAAAAGGTGCCTCACCATAATGCTGCGTCTTCTTGCGATTTTTGCCACACTCTGCGCTGTTGCAAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGCATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACAGTAACTAAATGAAATAAAGTGTATAATATAAAGATAAACATTGAAAAAAAAAAAAAAGG
  3  -1   2      seed Panc 5g   out                       CBTA3177.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAAAAAGGTGCCTCACCATAATGCTGCGTCTTCTTGCGATTTTTGCCACACTCTGCGCTGTTGCAAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAAC
  5   1   2       bld AbdN FL                            IMAGE:7022325                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCTCACCATAATGCTGCGTCTTCTTGCGATTTTTGCCACACTCTGCGCTGTTGCAAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTTCATGCAGACNATACACAGTAACTAAATGAAATAAAGTGTATAATATAAAGATTN
  5  -1   2       bld Ski1      in                         CABJ6383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGCCACACTCTGCGCTGTTGCAAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAACTAAATGAAATAAAGTGTATAATATAAAG
  3  -1   2       bld Ski1      in                         CABJ6383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTGCCACACTCTGCGCTGTTGCAACAGCTGCCCTACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAACTAAATGAAATAAAGTGTATAATATAAAGAAAAAAAAAAAAAA
  5   1   2       bld Panc      in                        CBTA1952.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTCTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAACTAAATGAAATAAAGTGTATAATATAAAGATAAACATTG
  3   1   2       bld Panc      in                        CBTA1952.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAATCCTAACAAAGGCTCAATGGGGAGGTCGTGCTGCCACCTGCAGGACTGCAATGACCACACCTGTCCCTTATGTGATCATCCATCACACTGCTGGGGCACACTGCAGTAGCCAGACTTCATGTATAAGTCAGGCCAAAAGCATTCAGAACTATCACATGAATTCAAATGCCTGGTGTGACGTTGGATACAGCTTCCTGGTAGGTGAGGATGGAAATGTATATGAGGGACGTGGATGGAATTCTGTTGGGGCCCATGCTCCTAATTACAACTCAAACTCAATTGGAATCAGTGTCATGGGAACATACACTAACATTAACCCCAATACTGCAGCTCAGAATGCAGTTAAAAACCTCATCAGTTGTGGAGTGACAAAAGGATACATTAAGTCGACTTACATTTTGAAAGGACATCGTAACGTGGGATCAACTGAATGCCCTGGGAACACATTTTACAACACCGTAAAAACTTGGCCCCGCTTCCAAGCTTGAGATGTATCTTCTTGCCCAAGCAACTAATGTCTGAAGTTTTTAATCGGCTTTCCAACAAAAATATGTTTAAGAAAGGAAACCAGACAGATCACACAATACTCCAGAATATATTTTCAGTATCATACCTTTCCATGCAGACAATACACAGTAACTAAATGAAATAAAGTGTATAATATAAAGATAAACATTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)