Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-XZT57213.5                            9 END     1           5       11                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012084216 Xt7.1-CABJ11886.3 - 18 ESTs
                                                                       .-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABJ11886.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAACAAGGCCACAAGCATCACCTCACCTACCATGTCAAAGCAGATTTTCCCTTGGATGAAAGAATCCCGACAGAACACGAAGCAGCAGAAAGCGGGCAGTTCGAGTTCAGGTGAGAGTTGTGCTGGAGACAAAAGCCCCCCGGGGCAATCCTCTTCCAAGAGGGCCCGCACTGCTTACACAAGCGCTCAGCTGGTAGAACTGGAAAAAGAGTTCCACTTTAACAGATACCTGTGCAGACCCAGGAGGGTGGAGATGGCCAATCTGCTCAACCTCACCGAGAGGCAAATTAAGATCTGGTTTCAGAACAGGCGAATGAAATACAAAAAGGATCAAAAAGGGAAATCCATGATGACCTCTTCAGGAGGGCAGTCACCATGTAGGAGCCCAGTGCCGACTCCATCTGTTGGAGGTTACCTAAACTCTATGCATTCTTTGGTAAACAGTGTCCCCTATGAGCCTCAGTCTCCCCCAGCCTTTAACAAACACCACCCTAGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCCCCGTTTATGTAGGGGGGAACTATGTGGAGACCATGACTAATTCTGGACCATCCATGTTTGGTTTGTCTCATCTCTCTCATTCCTCATCGAACATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTCTATTTTACTTTCCAGTAACCCCCTTTATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAGAATCAACAAAACTATCGAACTGTTTACATCTTATTTATCCCATCCTTCATATTTATAAACAATATATACCCTTGCTATTCAGGTCAGGCTCTGGGCCTTCAGTTAATGGCACAGGCAGTGCTTTTGAAAAAAAATTCTCATTAAAGATGCAATAAAATCTGAGAGAATATTAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008231229                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGGCCACAAGCATCACCTCACCTACCATGTCAAAGCAGATTTTCCCTTGGATGAAAGAATCCCGACAGAACACGAAGCAGCAGAAAGCGGGCAGTTCGAGTTCAGGTGAGAGTTGTGCTGGAGACAAAAGCCCCCCGGGGCAATCCTCTTCCAAGAGGGCCCGCACTGCTTACACAAGCGCTCAGCTGGTAGAACTGGAAAAAGAGTTCCACTTTAACAGATACCTGTGCAGACCCAGGAGGGTGGAGATGGCCAATCTGCTCAACCTCACCGAGAGGCAAATTAAGATCTGGTTTCAGAACAGGCGAATGAAATACAAAAAGGATCAAAAAGGGAAATCCATGATGACCTCTTCAGGAGGGCAGTCACCATGTAGGAGCCCAGTGCCGACTCCATCTGTTGGAGGTTACCTAAACTCTATGCATTCTTTGGTAAACAGTGTCCCCTATGAGCCTCAGTCTCCCCCAGCCTTTAACAAACACCACCCTAGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCCCCGTTTATGTAGGGGGGAACTATGTGGAGACCATGACTAATTCTGGACCATCCATGTTTGGTTTGTCTCATCTCTCTCATTCCTCATCGAACATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTCTATTTTACTTTCCAGTAACCCCCTTTATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAGAATCAACAAAACTATCGAACTGTTTACATCTTATTTATCCCATCCTTCATATTTATAAACAATATATACCCTTGCTATTCAGGTCAGGCTCTGGGCCTTCAGTTAATGGCACAGGCAGTGCTTTTGAAAAAAAATTCTCATTAAAGATGCAATAAAATCTGAGAGAATATTAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2     4     2     4     2     4     3     4     5     6     4     5     3     5     3     5     3     5     4     5     4     5     5     5     4     5     4     5     4     5     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     6     6     5     6     5     6     5     6     5     6     5     6     7     8     8     9     8     9     8     9     8     9     8     9     8     9     7     7     7     7     7     7     7     7     7     8     7     8     5     8     6     8     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     6     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 7e-021     NP_498695.1 male ABnormal MAB-5, abnormal cell LINeage LIN-21, Homeobox C member, requiredfor cell differentiation (22.4 kD) (mab-5) [Caenorhabditis elegans] ------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sp ---- 2e-023     NP_999815.2 homeobox protein Splox [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 3e-025     NP_476669.3 CG31481-PA, isoform A [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 2e-033     CAB40561.1 homeoprotein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 4e-047     CAA48180.1 Amphihox3 [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 3e-103     CAJ82652.1 homeo box B3 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dr ---- 2e-110     NP_571192.2 homeo box B3a [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ---- 9e-125     NP_034582.1 homeobox A3 protein [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 8e-126     NP_705895.1 homeobox A3 protein isoform a [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Gg ---- 2e-145     NP_989879.1 homeodomain protein HOXD-3 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Xl ---- 2e-169     AAH41731.1 Similar to homeo box A3 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- ?? ---- 2e-169     NP_001080293.1 homeo box A3 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABJ11886.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATGATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------TAATGA------------------------------------------------------TAA------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAA---------------------------------TAA---------TAA------TAA------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   1       add In62 PIPE                       IMAGE:8952652.5p                                                                                                                                                                                                                                                                                             CAAGTAATAAAAAAGATTACATCAAATTCGAATTCGTCCCCTGCTCCCATCCTGGGGTCGTGTTGTGCCTGGTGCTTGGAGGTGATAGCGCAGGAGAAGTGCTGGTTTAGCCACAGCACAGTGCCCAGGAATTAGTTGGAGAGCAAGCCAGATTTGTTGGTTCTGGAGCCCAACTGGGGTGTAGTGTGTTGTGTTCCGCGTCAGTCGTCAGAAACTAAGGTCTGACCAGCGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCTCTGCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCATCTCTGCTGGAAACTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGCAGCGCAGTGCCCCATCACAAAGCCAATGACATCAACGAAAGTTGTATGAGAACCATTAACAGTCAATCAAACCAAGCCCCGGTCATTCCCGAGCAGCAGCCCACACCGCAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGTCACAAGCATCACCTCACCTACCATGTCAAGCAGATTTTCCCTTGGATGAAAGAATCCTGACGACACTAAGCAATCAGAAAGCGGGCAGTTCGAAGTTCAGTGAGAGTTGTTGCTCGAAACAAAGCCCCCTCGGGCCATCCTCCTCCAAGAAGGGCCCGCCACTGCTTTACACAATCGACTCTAACCTGGTT
  5   1   0       add TbA       in                   TTbA062a12.p1kSP6                                                                                                                                                                                                                                                                                                                                        CTCCCATCCTGGGGTCGTGTTGTGCCTGGTGCTTGGAGGTGATAGCGCAGGAGAAGTGCTGGTTTAGCCACAGCACAGTGCCCAGGAATTAGTTGGAGAGCAAGCCAGATTTGTTGGTTCTGGAGCCCAACTGGGGTGTAGTGTGTTGTGTTCCGCGTCAGTCGTCAGAAACTAAGGTCTGACCAGCGAGGCCATTGGAGGAGGAACGCCACGTGACAGAGGGGTGCCAATGTTATTCTTTACGGGTGTCAAGACCCTGTCAGTTTGTGAAATAAATATTGGGAAACAACGAAATGCAAAAAGCGACCTACTACGACAGCTCTGCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCATCTCTGCTGGAAACTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGCAGCGCAGTGCCCCATCACAAGGCCAATGACATCAACGAAAGTTGTATGAGAACCATTAACAGTCAATCAAACCAAGCCCCGGTCATTCCCGAGCAGCAGCCCACACCGCAAGGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAAGCATCACCTCACCTACCATGGTCAAAGCAGATTTTTCCCCTTGGGATGAANNAGAATCCCGACAGAACACGAAGC
  5   1   0       chi Tad5 FL   out                        XZT30935.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            NCTGGATTATTACACCCCCCTAATTTCCCTCTTGCTGTTATATCATATTTATTGGAGAAGACAATTAGACTGGTCGCTTCCCCGAAGATATTCCGTGCCAGGTGACTGTGGGGTGCCAATGTTATTCTGTAAGGGTGGGGACACCCTCCGAGTCGGTGACAGCTGTTTTTGGGGATCCCGGAGATGCAGAAAGCATCCTACTATGACAACCCCACTCTGTTCGGAGGTTACCCCTACCAGGCAGGGAGTCTGGGCTATGAAGGCCCCCAGCAGTCCTTCCCCACTTCTTCCCATATGGACAATGAATTCCAGCGCTCCTCCTGCTCCCTGCAGTCTCTGGGGCACAGCGGCCCTCTGGTCAAAGCTAAGAACCTAAATGGGAGCTGTATGCGCCCCAACCTGTCCTCTGAGCAGTCCCAGCCCCTGTCTCCAACGGCCAACCCCAGTAGCAACACCAACAGCAGCAGCTCCCAGGCTTCCCTCAGCAAGCCCTCTCCAGCCAAAAGCCAGGCCAGCGGCAGCCCAGCCAGCAAGCAGATCTTCCCTTGGATGAAAGAGTCCAGACAGAACTCCAAACAGAAATCCAGCCCCCCCGCCCCAGCGGCAGAAAGCTGCGGCGGTGACAGGAGCCCCCCGGGTTCGTCTGCGTCCAAGAGAGCGCGTACGGCCTACACCAGCGCCCAACTGGTCGAACTGGAGAAGGAGTTTCACTTCAACCGCTACCTGTGCCGGCCCCGCCGGGTGGAAATGGCCAATCTGCTCAACCTGAGCGAGAGGCAAATCAAGATCTGGTTCCAGAACCGGAGGATGAAGTATAAGAAAGATCAAAAGGTAAAGGCATGT
  5   1   2       bld In54                            IMAGE:8944095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTGTTAAAATGAAAGGAACCTAAAAAAAAATTCGTCCCGATCTATGGTGGATATCCCTACCAAGGAGCAAATGGTTTCACTTATAATGCAAGTCAGCAGCAATATCCTCCTTCCTCATCTCTGCTGGAAACTGAATATCATCGACCTGCCTGCTCCCTGCAGTCACCTGGCAGCGCAGTGCCCCATCACAAGGCCAATGACATCAACGAAAGTTGTATGAGAACCATTAACAGTCAATCAAACCAAGCCCCGGTCATTCCCGAGCAGCAGCCCACACCGCAAGGGCCGCCACCCTCTGTGTCCCCACCACAAACCACCAGCAATGCAGCCACAGCCTCCTCCAACAAGGCCACAAGCATCACCTCACCTACCATGTCAAAGCAGATTTTCCCTTGGATGAAAGAATCCCGACAGAACACGAAGCAGCAGAAAGCGGGCAGTTCGAGTTCAGGTGAGAGTTGTGCTGGAGACAAAAGCCCCCCGGGGCAATCCTCTTCCAAGAGGGCCCGCACTGCTTACACAAGCGCTCAGCTGGTAGAACTGGAAAAAGAGTTCCACTTTAACAGATACCTGTGCAGACCCAGGAGGGTGGAGATGGCCAATCTGCTCAACCTCACCGAGAGGCAAATTAAGATCTGGTTTCAGAACAGGCGAATGAAATACAAAAAGGATCAAAAAGGGAAATCCATGATGACCTCTTCAGGAGGGCAGTCACCATGTAGAGCCCAGTGCCGACTCCATCTGTTGGAGGTTACCTAAACTCTATGCATTCTTGGGTAAACAGTGTCCCCTATGAGCCTCAGTCTCCCCAGCCTTTAACAACACCACCCTAGCGCGTATGGCATGCTGCACCTACCAAGTCCCCCACAACAGCTTCCTTCCACACAAAAAGAGATATACAGGCGGGAACTT
  5   1   0       add HdA                            THdA045b24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTATGGTGGATATCCCTACCACGGAGCATATGGTTTCACTTATAATGCTAGTCAGCAGCAATATCCTCCTTCCTCATCTCTGCTGGAGACTGAATGTCATCTACCTGCCTGCTCCCTGCAGTCACCT
  5   1   0       add HdA                            THdA022l17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGTCCTCATCTCTGCTGCAAACTGACTATCATCGACCTGCCTGCTCCCTGCAGACACCTGACACCTCACTGCCCCTGCACAAGGCCCATGTCATCAACGAAAGTTGTGTTACAGCCATTTCCGGTCAATCTACCCAAGCCCCGGTCAATCCCGAGCATCTGCCCACACCGCAAGGGCCACCACCCTCTGTGTCCC
  5   1   2       bld In66                            IMAGE:8965826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTTTTTTAACTAATTTATAAATTTATAAATTCGTCCGAGTAATTAGTAATCAATGTAATTATGTAGATCATCTGCAGGAGAGTATTAATGTAAAATGCTTGCCAAGGGACCAACAAATGCTGTTTAGTACCAAAGTCAGGTTCTGAGCAGGAAGCTCCTGGTAATGTTTTCGAATAATTTTAAAGGTTTGTGATCTTTAATATTTTGTATGGTTTCTGCAGGTGAGAGTTGTGCTGGAGACAAAAGCCCCCCGGGGCAATCCTCTTCCAAGAGGGCCCGCACTGCTTACACAAGCGCTCAGCTGGTAGAACTGGAAAAAGAGTTCCACTTTAACAGATACCTGTGCAGACCCAGGAGGGTGGAGATGGCCAATCTGCTCAACCTCACCGAGAGGCAAATTAAGATCTGGTTTCAGAACAGGCGAATGAAATACAAAAAGGATCAAAAAGGGAAATCCATGATGACCTCTTCAGGAGGGCAGTCACCATGTAGGAGCCCAGTGCCGACTCCATCTGTTGGAGGTTACCTAAACTCTATGCATTCTTTGGTAAACAGTGTCCCCTATGAGCCTCAGTCTCCCCCAGCCTTTAACAAACACCACCCTAGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCTCTCGTTTATGTAGGGGAACTATGGTGGAGACCATGACTAATCTGGACCATCCATGTTTGATTGTCTCATCTCTCTCATCTCATCGAACATGACTACAGTGGAATCGAACCATGAACAGTGTCACACCATGACCCTGGTGACTCTCTCACCTTAAATAACCACGACTTTAATTCTGTGCTTCAACCCCA
  5   1   2       bld Ski1      in                         CABJ1747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNCACAGCCTCCTCCAACAAGGCCACAAGCATCACCTCACCTACCATGTCAAAGCAGATTTTCCCTTGGATGAAAGAATCCCGACAGAACACGAAGCAGCAGAAAGCGGGCAGTTCGAGTTCAGGTGAGAGTTGTGCTGGAGACAAAAGCCCCCCGGGGCAATCCTCTTCCAAGAGGGCCCGCACTGCTTACACAAGCGCTCAGCTGGTAGAACTGGAAAAAGAGTTCCACTTTAACAGATACCTGTGCAGACCCAGGAGGGTGGAGATGGCCAATCTGCTCAACCTCACCGAGAGGCAAATTAAGATCTGGTTTCAGAACAGGCGAATGAAATACAAAAAGGATCAAAAAGGGAAATCCATGATGACCTCTTCAGGAGGGCAGTCACCATGTAGGAGCCCAGTGCCGACTCCATCTGTTGGAGGTTACCTAAACTCTATGCATTCTTTGGTAAACAGTGTCCCCTATGAGCCTCAGTCTCCCCCAGCCTTTAACAAACACCACCCTAGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCCCCGTTTATGTAGGGGGGAACTATGTGGAGACCATGACTAATTCTGGACCATCCATGTTTGGTTTGTCTCATCTCTCTCATTCCTCATCGAACATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCA
  5   1   2       bld Ski1      in                        CABJ11886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTCCCTTGGATGAAAGAATCCCGACAGAACACGAAGCAGCAGAAAGCGGGCAGTTCGAGTTCAGGTGAGAGTTGTGCTGGAGACAAAAGCCCCCCGGGGCAATCCTCTTCCAAGAGGGCCCGCACTGCTTACACAAGCGCTCAGCTGGTAGAACTGGAAAAAGAGTTCCACTTTAACAGATACCTGTGCAGACCCAGGAGGGTGGAGATGGCCAATCTGCTCAACCTCACCGAGAGGCAAATTAAGATCTGGTTTCAGAACAGGCGAATGAAATACAAAAAGGATCAAAAAGGGAAATCCATGATGACCTCTTCAGGAGGGCAGTCACCATGTAGGAGCCCAGTGCCGACTCCATCTGTTGGAGGTTACCTAAACTCTATGCATTCTTTGGTAAACAGTGTCCCCTATGAGCCTCAGTCTCCCCCAGCCTTTAACAAACACCACCCTAGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCCCCGTTTATGTAGGGGGGAACTATGTGGAGACCATGACTAATTCTGGACCATCCATGTTTGGTTTGTCTCATCTCTCTCATTCCTCATCGAACATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCCAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTCCTACNNTATTCTATTTTACTTT
  5   1   2       bld Gas1                               IMAGE:6990888                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGATCCAAGCGCTCAGCTGGTAGAACTGGAAAAAGAGTTCCACTTTAACAGATACCTGTGCAGACCCAGGAGGGTGGAGATGGCCAATCTGCTCAACCTCACCGAGAGGCAAATTAAGATCTGGTTTCAGAACAGGCGAATGAAATACAAAAAGGATCAAAAAGGGAAATCCATGATGACCTCTTCAGGAGGGCAGTCACCATGTAGGAGCCCAGTGCCGACTCCATCTGTTGGAGGTTACCTAAACTCTATGCATTCTTTGGTAAACAGTGTCCCCTATGAGCCTCAGTCTCCCCCAGCCTTTAACAAACACCACCCTAGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCCCCGTTTATGTAGGGGGGAACTATGTGGAGACCATGACTAATTCTGGACCATCCATGTTTGGTTTGTCTCATCTCTCTCATTCCTCATCGAACATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAAGACAATATTCCCCTTTTTTCCCTACTATTTCTATTTTACTTTCCAGTAC
  3   1   2      seed Ski1      in                        CABJ11886.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTAGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCCCCGTTTATGTAGGGGGGAACTATGTGGAGACCATGACTAATTCTGGACCATCCATGTTTGGTTTGTCTCATCTCTCTCATTCCTCATCGAACATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTCTATTTTACTTTCCAGTAACCCCCTTTATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAGAATCAACAAAACTATC
  3   1   2       bld Ski1      in                         CABJ1747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGCGTATGGCGTGCCTGCACCCTACCCAAGCCCCCACAACAGCTGCCCTCCCCACCAAAAGAGATACAGCGGGACTGCTGCGGTCACCCCTGAATATGAGCCACATCCTCTCCAACAAAGCAGCGGAGCTTATGGGAATCCGCATGTACAGGGAAGCCCCGTTTATGTAGGGGGGAACTATGTGGAGACCATGACTAATTCTGGACCATCCATGTTTGGTTTGTCTCATCTCTCTCATTCCTCATCGAACATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTCTATTTTACTTTCCAGTAACCCCCTTTATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGG
  3   1   2       bld Gas6      in                         ANBT3238.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTCTATTTTACTTTCCAGTAACCCCCTTTATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGG
  5   1   2       bld Gas6      in                         ANBT3238.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGGACTACAGTGGAGCCGGACCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTCTATTTTACTTTCCAGTAACCCCCTTTATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA062a12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCATGAACAGTGGTCACCACCATGGACCCTGTGACTCTCACCCTACATACACGGACTTATCTGCTCACCACAATCCTCAGGGAAGAATTCAGGAAGCCCCCAAATTAACACATTTGTAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTCTATTTTACTTTCCAGTAACCCCCTTTATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTTTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAGAATCAACAAAACTATCGAACTGTTTACATCTTATTTATCCCATCCTTCATATTTATAAACAATATATACCCTTGCTATTCAGGTCAGGCTCTGGGCCTTCAGTTAATGGCACAGGCAGTGCTTTTGAAAAAAAATTCTCATTAAAGATGCAATAAAATGTGAGAGAATTTAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TbA                             TTbA058i05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAATGATCGTGGAGACAAATATTCCCCTTTTTTCCTACTTATTTNTATTTTACTTTCCNAGTAACCCCCTTTAATTTTATATTCAAGATTTTGCGTGAGTGTGTGTGCCAGTAATATTCAGTGCAAGAAATACTGGCTCTTTCAGATATAACATTGTGGCCCTTAGGAACCCGATTTGGAACAAGTCTTTGTATTTTATTCGTCTCTTTTATCAAACAGGGTATAGCAACAATTTTTATATGGGGAACAAATTCTTCTTACATGTGAATTTGTTTGCACATTTTCTTAACCCACAGGGAACCCATTTAAATTATTATTGCACTTCTATTCAATTGCTAGCCAAATATTAAAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAGAATCAACAAAACTATCGAACTGTTTACATCTTATTTATCCCATCCTTCATATTTATAAACAATATATACCCTTGCTATTCAGGTCAGGCTCTGGGCCTTCAGTTAATGGCACAGGCAGTGCTTTTGAAAAAAAATTCTCATTAAAGATGCAATAAAATCTGAGAGAATATTAAAAAAAAAAAAAAAAAGC
  3   1   2       bld BrSp      in                      EC2BBA6CG03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCTATTCAATTGCTAGCCAAATATTAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAGAATCAACAAAACTATCGAACTGTTTACATCTTATTTATCCCATCCTTCATATTTATAAACAATATATACCCTTGCTATTCAGGTCAGGCTCTGGGCCTTCGG
  5   1   2       bld BrSp      in                      EC2BBA6CG03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTATTCAATTGCTAGCCAAATATTAAAAAAACGCTTGAACAGGGACATCCCGATCCATAATTATACGTGTAAATCATTTAATGTGTGTATTCTGCTGCATATACTCCGGTTAATTTATTATATTTTCATGGAAAAAAAAGAATCAACAAAACTATCGAACTGTTTACATCTTATTTATCCCATCCTTCATATTTATAAACAATATATACCCTTGCTATTCAGGTCAGGCTCTGGGCCTTCGGTTAATGGCACAGGCAGTGCTTTTGAAAAAAAATTCTCATTAAAGATGCAATAAAATCTGAGAGAATATTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)