Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBSW12213.3                          16 END     1          10        6                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 290.0    0Xt7.1-TGas121l10.3                        113 PI      85        481      756                LOC394692 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012084814 Xt7.1-CBSW12213.5 - 10 ESTs
                                                                       ......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CBSW12213.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGCAGTCAGTTCACTGTGTTGGCAGTCTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGA
                                                  Xt7.1-CHK-1008235919                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCAGTTCACTGTGTTGGCAGTCTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     2     3     4     5     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     6     6     5     5     5     5     5     5     5     5     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     4     5     4     5     4     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3
                                               BLH MIN      23     105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI       0       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bb ---- 5e-015     AAF03901.1 bicoid type transcription factor Pitx [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Cs ---- 3e-016     BAA25399.1 CsNKX [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ce ==== 1e-032     NP_509648.1 msh homeodomain protein, Variable ABnormal morphology VAB-15 (25.2 kD) (vab-15)[Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 2e-036     CAB42631.1 msxb homeoprotein [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 5e-036     NP_477324.1 Drop CG1897-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sp ---- 2e-042     NP_999778.1 homeodomain protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bf ---- 3e-054     CAA10201.1 Msx protein [Branchiostoma floridae] --------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 3e-065     NP_571351.2 muscle segment homeobox D [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 3e-101     NP_002440.2 msh homeo box homolog 2 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 4e-103     NP_038629.2 homeo box, msh-like 2 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 1e-109     NP_989890.1 homeobox-containing Hox-8 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 9e-139     CAA41573.1 homeobox containing peptide Hhox7.1' [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 1e-163     AAH64202.1 LOC394987 protein [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CBSW12213.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TGA------TGA---------------------------------------------------------------ATG---ATG------------------------------------------------------------------TAA------------------------------------------------------------TAG---------------------------------------------------------------------TAG------------------------ATG---------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Gas  FL                     TGas001o13.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGATGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld HeRe      in                     EC2CAA33DA01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCTTTGCTGGAAGTGAATAGACTGAGCAGTCAGTTCACTGTGTTGGCAGTCTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGAAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCT
  5   1   2       bld Tail      out                       CBSW12213.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGCAGTCAGTTCACTGTGTTGGCAGTCTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTGCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATATTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTAT
  5   1   2       bld Gas  FL                        TGas001o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTC
  5   1   2       bld Gas0      in                         dad37f03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGTGCAGCTACTACTGTAGCCGGTCTATAGTCATTCCAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTGCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTA
  5   1   2       bld Gas1      ?                      NISC_mq09g02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCC
  5   1   2      seed Gas7      in                         XZG47255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGTAGGATGACAT
  3   1   2       bld Gas7      in                         XZG47255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGTAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGATGTAAAAAAAAAAAAAAAGG
  3   1   2       bld HeRe      in                     EC2CAA33DA01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATATTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGATTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACT
  3   1   2       bld Gas0      in                         dad37f03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGAGGCAGAAATAGAAAAGTTGAAATGGCAGGGAAGGCCCATATTACCTCCAGGCTTTAGGAACTCTTTCCCCATCAAATCACGTATCAGGGGTGCATGGTTGTATGGATCATCTTATCAGTTTACAGACCAAGTCTTTCCAATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGTCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGTATGTAAAAAAA
  5   1   2       bld Gas                            TGas023i15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGATGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)