Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA050i16.3                         20 END     11         57       55                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012084824 Xt7.1-TNeu120n12.3 - 19 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu120n12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTCAGGGAGGCTGAATACATAAGAACTGAGTATGTGATCACCTGGGAATCCCAAAACTCTCTATAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAATAGAGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCTGGCCCTAAACAGAAAAAAATGGAAGCGGAAAAAGACAGCAGTGAAGAAGAGCACTCTGAAGCCATATTTCAATGAATCCTTTACTTTTGATGTGTCACTGGAACAAATGAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTGGGAAAGAACGAGCAGATTGGAAAATTATTTTTGGGGTGCCGAGCCTCAGGAAACGCTTTGCGCCATTGGTCCGACATGCTGGCTCATCCCCGACGACCCATTGCGCAATGGCACAAGCTCCAGGAGGCAGACGAGGTGGACAAAGTTCTTGAGCTCAAAAGGAACCTAAAACCATCTCTTCTCAGAAGTTTACCCTAATAAATGCATGTTCTGAGGCATCTCCATCGTACATTGCTGGATGGTTACTATAGAGACTGCGTATGTCTAGGATTGATTGCAGCAAAGCTGGATAATATATGGAGTTTGCTTTATTGGGAGATTCCATCACAGAGATCTTCTCTACCTCCCAGGGACCGTTATGGTACGATCAATGGCCAAGGGGCCAGATAATTGAATTTGGACTGATTTGGCCAGACACAAAGGTGGCCATTTTGTGCAAAGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGACTGGGGGGTGCAGGGCCCACCGGGGCTTCTGCCTCAGGGGCCCCTGCACCCCTCAATGACCCTGCTGCCTTCACAACCCCCCCGCCATGCAGAGGCCCCCAACACCCTCCGTCCCCCTCCCTCAAGCACTTCTAAGAGAAACTTATCTGCAGCGCGTTGGGGGAGGGAGACGGCAGATCATGGGAGTGCCCTGGAGGGAATCAGATCTGGGCGGTCCAGTCCGAAGCTGGAACTGCCCCCTCCTCACTGGCGGGGTTGGGGCAGGCCCAATGTCTGTAGACCAGGGGGTGAGGGGTTAAAGTCACTAGAGGAAAGGGTTAAGCCTCCCATCTGCCAGTGACCCATTACAGGAGCAATTTGATGTCCTGAACCTGCCTGGAACCTGGATAAACCTGCAAGTCCCTACGGATATTTGGCCGGCCTTCTCACCACTAATAATGG
                                                  Xt7.1-CHK-1008230696                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGGCTGAATACATAAGAACTGAGTATGTGATCACCTGGGAATCCCAAAACTCTCTATAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAATAGAGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCTGGCCCTAAACAGAAAAAAATGGAAGCGGAAAAAGACAGCAGTGAAGAAGAGCACTCTGAAGCCATATTTCAATGAATCCTTTACTTTTGATGTGTCACTGGAACAAATGAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTGGGAAAGAACGAGCAGATTGGAAAATTATTTTTGGGGTGCCGAGCCTCAGGAAACGCTTTGCGCCATTGGTCCGACATGCTGGCTCATCCCCGACGACCCATTGCGCAATGGCACAAGCTCCAGGAGGCAGACGAGGTGGACAAAGTTCTTGAGCTCAAAAGGAACCTAAAACCATCTCTTCTCAGAAGTTTACCCTAATAAATGCATGTTCTGAGGCATCTCCATCGTACATTGCTGGATGGTTACTATAGAGACTGCGTATGTCTAGGATTGATTGCAGCAAAGCTGGATAATATATGGAGTTTGCTTTATTGGGAGATTCCATCACAGAGATCTTCTCTACCTCCCAGGGACCGTTATGGTACGATCAATGGCCAAGGGGCCAGATAATTGAATTTGGACTGATTTGGCCAGACACAAAGGTGGCCATTTTGTGCAAAGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGACTGGGGGGTGCAGGGCCCACCGGGGCTTCTGCCTCAGGGGCCCCTGCACCCCTCAATGACCCTGCTGCCTTCACAACCCCCCCGCCATGCAGAGGCCCCCAACACCCTCCGTCCCCCTCCCTCAAGCACTTCTAAGAGAAACTTATCTGCAGCGCGTTGGGGGAGGGAGACGGCAGATCATGGGAGTGCCCTGGAGGGAATCAGATCTGGGCGGTCCAGTCCGAAGCTGGAACTGCCCCCTCCTCACTGGCGGGGTTGGGGCAGGCCCAATGTCTGTAGACCAGGGGGTGAGGGGTTAAAGTCACTAGAGGAAAGGGTTAAGCCTCCCATCTGCCAGTGACCCATTACAGGAGCAATTTGATGTCCTGAACCTGCCTGGAACCTGGATAAACCTGCAAGTCCCTACGGATATTTGGCCGGCCTTCTCACCACTAATAATGGGTCCCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     4     3     5     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8    10     7    10     7     9     5     9     6     9     6     9     5     8     5     8     4     6     4     6     4     6     4     6     3     6     4     7     4     7     4     7     4     7     4     7     4     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     4     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     6     7     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     136     505                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      79     159                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     136     998                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -21       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     136      93                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 4e-007     FAA00229.1 TPA: zinc finger protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sc ---- 9e-009     NP_014729.1 Hypothetical ORF; has similarity to YNL087w; Yor086cp [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Br ---- 3e-016     AAM92833.1 protein kinase C [Branchiostoma lanceolatum] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 2e-063     XP_797480.2 PREDICTED: similar to synaptotagmin I, partial [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 2e-093     NP_523460.2 CG3139-PA, isoform A [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ce ---- 1e-093     NP_001022129.1 F31E8.2a [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 3e-110     NP_033333.2 synaptotagmin 2 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 3e-110     NP_796376.2 synaptotagmin II; synaptotagmin 2 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 1e-131     XP_698786.1 PREDICTED: similar to MGC86555 protein [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 1e-133     AAI35171.1 Unknown (protein for MGC:121141) [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ---- 2e-137     XP_421028.1 PREDICTED: similar to synaptotagmin 1 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAH80438.1 MGC86555 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          NP_001087607.1 MGC86555 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu120n12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAG------------------TGA------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------TAATAAATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TGA---------------------------------------------------------------------------TAA---------------TAG---TGA---------------------------------------------------TAA------------------------------------ATG------TAG------------TAGTAA---------------------------TAG---------------------------------------------TAG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Tad5 CHI                          XZT8662.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGGAGTGTTCAGGTGTCAGGGAGGCTGAATACATAAGAACTGAGTATGTGATCACCTGGGAATCCCAAAACTCTCTATAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAATAGAGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGGTACACTAGGCTGTGTGTACAGCTACATAAATGTAACCTGGAGATCATGAATAGTAGATTAGTAATGATCGGCTTCCATACAGAGTCAGACTGGGGTGCCAAGAGCTCACCAGAAGACCTTAGACCACAAATCCACCATCCAAAATGTTTTTGCTCCTCTCCTCACTCACCTTCTTCTTAAAAAAATAATTTAACTGTGTTTTGCTTTAAAAAAACAACTGATAATTACTCATTTTGACTCTGCAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCTGGCCCTAAACAGAAAAAAATGGAAGCGGAAAAAGACAGCAGTGAAAAAGAGCACTCTGAAGCCATATTTCAATGAATCCTTTACTTTTGATGTGTCACTGGAACAAATGAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTGGGAAAGAACGAGCAGATTGGAAAATTATTTTTGGGGTGCCGAGCCTCAGGAAACGCTTTGCGCCATTGGTCCGACATGCTGGCTCATCCCCGACGACCCATTGCGCAATGGCACAAGCTCCAGGAGGCAGACGAGGTGGACAAAGTTCTTGAGCTCAAAAGGAACCTAAAACCATCTCTTCTCAGAAGTTTACCCTAATAAATGCATGTTCTGAGGCATCTCCATCGTACATTGCTGGATGGTTACTATAGAGACTGCGTATGTCTAGGATTGATTGCAGCAAAGCTGGATAATATATGGAGTTTGCTTTATTGGGAGATTCCATCACAGAGATCTTCTCTACCTCCCAGGGACCGTTATGGTACGATCAATGGCCAAGGGGCCAGATAATTGAATTTGGACTGATTTGGCCAGACACAAAGGTGGCCATTTTGTGCAAAGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGACTGGGGGGTGCAGGGCCCACCGGGGCTTCTGCCTCAGGGGCCCCTGCACCCCTCAATGACCCTGCTGCCTTCACAACCCCCCCGCCATGCAGAGGCCCCCAACACCCTCCGTCCCCCTCCCTCAAGCACTTCTAAGAGAAACTTATCTGCAGCGCGTTGGGGGAGGGAGACGGCAGATCATGGGAGTGCCCTGGAGGGAATCAGATCTGGGCGGTCCAGTCCGAAGCTGGAACTGCCCCCTCCTCACTGGCGGGGTTGGGGCAGGCCCAATGTCTGTAGACCAGGGGGTGAGGGGTTAAAGTCACTAGAGGAAAGGGTTAAGCCTCCCATCTGCCAGTGACCCATTACAGGAGCAATTTGATGTCCTGAACCTGCCTGGAACCTGGATAAACCTGCAAGTCCCTACGGATATTTGGCCGGCCTTCTCACCACTAATAATGGGTCCCGTACCTCTATATACAGGTACGGGACCCATTATCCGGAAACCCATTATCCAGAAAGCCCCGAATTACGGGAAGCCCATCTCCCATAGACTCCATTATAATCAAATAATTAAAAATGTAAAAAACAATTCCTTTTTTCTCTGTAATAATAAAACAGTTCCTTGTACTTGATCCCAACTAAGATATAATGATTCCTTATTGAAGACAAAACAAGGCATGGTGATCCAAAATACAGAAGGACCTCTTATCCATAAATGTCCCAAACATTGTGGATAACAGGTCCCATAGCTGTAGTGCTATTTAGTTATTCAGTGCTTGGTTTCATGCAATGGTTGCCAAGGGCATTAAACATCATTATATTCACCCTTGATTACAGCGCAATAAATTGTAAATATATAACTATGAGCGGTCACCCATGATTTGCCATCACTTCTTGCAATCAAAATGACAAACGTACAGTATAATATTAACAGTTATATAGGGCGAGGAGGCCCCAGGAAGATTAAATAGCTCAGATTAAATACAACAAATTACTTCTTATTGAAAAGGATCTCTTGCAACTTTTTTTAATTGGGGGAAGGAATAGAGGCAGAGGGTTTATGTCCCCTTTATTCTCTTGCCCTGTATGTAACGTACCAAGTAGCAGCTCATGTAATGAACAAGGAAGAGCCAATGTGTGGGTGGAGATGCCCCAGCCTCAGCGCAGCCGCGGGTTATTTAAATTATAATAAATCTGTGATTGTAAATGTTCTGTATGTTTGATTTTCCTTTCATTCTGTATAATGTTAGATAAATAAATATAAATGTTTGTATCTCTCAAAAAAAAAAAAAAAA
  5   1   2       bld Neu0 5g                            IMAGE:6993112                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGACACGGAGTGTTCATGTGTCAGGGAGGCTGAATACATAAGAACTGAGTATGTGATCACCTGGGAATCCCAAAACTCTCTATAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAAAACACTGAAATCCCTGTGGTTTAAACGAGTCCTTTCCGTCCTTCAAGGGTAAACTCAAGAAAGAGGGTCCCCCCAGGAACCAACAGCCTGTTGGGTGGCAAAATCTTTTGAACTTTCAACCCGCTTTTCTTGGAAGACATGAATGTGGATTCGGAAGAAAATGGGTCCATACCCCCTTGGGAAGAAAATGGAAATTTTCCCAGCATTGTTAATTAAGAAGAACCTGGAAAAAGAATCTTTGGGCCCCCCTGGCTTGGGGAAAAAACCCCAAAGTCAATGAAACCACTTTGGGGGAAAAAATAATTTGGGCCTTCCCCCCTCNTGGAGAAAATAATTGGTGCCC
  5   1   2       bld Abd0 5g3  out                      IMAGE:6999958                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGGATACATCGATCCTGTTCAATTATTGAATGTCATATATAAAACAAGTGCCCTAATGTAACATTTGTGGCCCTACAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGCTTAACGAGTCTTTCGTCTTCAACGTAACTCAAGAAGAGGTCCCAAGACAACAGCTGTGGTGCAAAATCTTGACTTCACCGN
  5   1   2       bld Tad5                                    XZT76.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGTGTCAGGGAGGCTGAATACATAAGAACTGAGTATGTGATCACCTGGGAATCCCAAAACTCTCTATAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCNCAGGACACAGCTGTGGTGCAAATCTTTGACTTCACCGCTTTCTGAGCATGATGTGATC
  5   1   2       bld Tad5 CHI  out                         XZT8662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGCTGAATAATAAGAACTGAGTATGTGATCACCTGGGAATCCCAAAACTCTCTATAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGG
  5   1   2       bld Neu0 5g                            IMAGE:6995157                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGAATGTCATATATAAAACAAGTGCCCTAATGTAACATTTGTGGCCCTACAGGGGTTAGGCACTAGAGGCTGATTTTCTGCCAACTGGGAGGGTAAATCCCTCATCTCTCCAGTGACAGACATGGCGAGGAATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTTCACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAAATAGAAGGACTGGAAAAGATCTGGGCCCCTGCTGGGGAAGACCCGAGCATGAGCCCTTTGGGGAAATAATTTGCCTTCTCCTTTGGAAAAAATGTGGCCCTAGGC
  5   1   2       bld Neu       in                   TNeu120n12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCGACAAACACCACCGCGGCCACCACCATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCATAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCTAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAGGTAACTCA
  3   1   2      seed Neu       in                    TNeu120n12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATATACGCTACAACCACCAAGGAGCCTGAATCCTGGATCGACAGCATCTTGAACCAAATCCCCTTGCCCCGATGGGCTATTTATGCACTGGCCGGCTTGGCCCTATTCATCATCCTCCTCTTTATTATCTGCATTTGTTGCTGCTGCTGCAAAAGTAAGAAAAACAAGAAGAAGAAAGATAAAAAAATCGACATGGATAAAGTGCCGGGTAACTTAACCACGCATCTGGTTCAGCCTGGAGCAGGGAACTTGCAGAAAGGAGAGAAGGTGGAATATCGGGGCCGAGTGCAGTACTCACTGGAATACAATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAATAGAGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCT
  5   1   2       bld Eye       out                        CCAX8671.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTTCCAGACGGAGGAGCTCACCGTCGGGGTTAAGCAAGCAGCTGCTCTAAAAGCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAATAGAGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCTGGCCCTAAACAGAAAAAAATGGAAGCGGAAAAAGACAGCAGTGAAGAAGAGCACTCTGAAGCCATATTTCAATGAATCCTTTACTTTTGATGTGTCACTGGAACAAATGAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTGGGAAAGAACGAGCAGATTGGAAAATTATTTTTGGGGTGCCGAGCCTCAGGAAACGCTTTGCGCCATTGGTCC
  5   1   2       bld Gas8      out                         st40f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGATGGACCTTGGGGGGACATCAGACCCTTATGCCATAGTATACGTGACCAATGATACTCGGAAGAAATTCGAGACCAAAGTGAATCGCAAGACACTGAATCCTGTGTTTAACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAATAGAGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCTGGCCCTAAACAGAAAAAAATGGAAGCGGAAAAAGACAGCAGTGAAGAAGAGCACTCTGAAGCCATATTTCAATGAATCCTTTACTTTTGATGTGTCACTGGAACAAATGAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTG
  5   1   2       bld Gas7                                 XZG12159.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATCCTGTGTTTACGAGTCTTTCGTCTTCAAGGTAACTCAAGAAGAGGTCCCCAGGACAACAGCTGTGGTGCAAATCTTTGACTTCAACCGCTTCTTGAAGCATGATGTGATCGGAGAGATGGTCATACCCCTGGGAGAAGTGAATTTACAGCATGTAATAGAGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCTGGCCCTAAACAGAAAAAAATGGAAGCGGAAAAAGACAGCAGTGAAGAAGAGCACTCTGAAGCCATATTTCAATGAATCCTTTACTTTTGATGTGTCACTGGAACAAATGAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTGGGAAAGAACGAGCAGATTGGAAAATTATTTTTGGGGTGCCGAGCCTCAGGAAACGCTTTGCGCCATTGGTCCGACATGCTGGCTCATCCCCGACGACCCATCGCGCAATGGCACAAGCTCCAGGAGGCAGACGAGGTGGACAAAGTTCTTGAGCTCAAAAGGAACCTAAAACCATCTCTTCTCAGAAGTTTACCCTAATAAATGCATGTTCTGAGGCATCTCCATCGTACATTGCTGGATGGTTACTATAGAGACTGCGTATGTCTAGTATTGATTGCAACAAAGCTGG
  5   1   2       bld TbA       out                  TTbA050i16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGACTGGAAAGATCTGGGCCCTGCTGGGAAGACCGAGCATGAGCACTTGGGAGATATTTGCTTCTCTTTGAGATATGTGCCTAGCAGTGGGAAACTCACAATCATAATTCTAGAGGCAAAGAACCTTAAGAGGATGGACTCCGATGGATTCTCAGATCCATATGTGAAAGTTCACCTGGCCCTAAACAGAAAAAAATGGAAGCGGAAAAAGACAGCAGTGAAGAAGAGCACTCTGAAGCCATATTTCAATGAATCCTTTACTTTTGATGTGTCACTGGAACAAATGAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTGGGAAAGAACGAGCAGATTGGAAAATTATTTTTGGGGTGCCGAGCCTCAGGAAACGCTTTGCGCCATTGGTCCGACATGCTGGCTCATCCCCGACGACCCATTGCGCAATGGCACAAGCTCCAGGAGGCAGACGAGGTGGACAAAGTTCTTGAGCTCAAAAGGAACCTAAAACCATCTCTTCTCAGAAGTTTACCCTAATAAATGCATGTTCTGAGGCATCTCCATCGTACATTGCTGGATGGTTACTATAGAGACTGCGTATGTCTAGGATTGATTGCAGCAAAGCTGGATAATATATGGAGTTTGCTTTATTGGGAGATTCCATCACAGAGATCTTCTCTACCTCCCAGGGACCGTTATGGTACGATCAATGGCCAAGGGGCCAGATAATTGAATTTGGACTGATTTG
  5   1   2       bld Tad5      out                        XZT69902.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGAATCTAGACCTGATCATATCTGTGTGGGATCACGACAAAGTGGGAAAGAACGAGCAGATTGGAAAATTATTTTTGGGGTGCCGAGCCTCAGGAAACGCTTTGCGCCATTGGTCCGACATGCTGGCTCATCCCCGACGACCCATTGCGCAATGGCACAAGCTCCAGGAGGCAGACGAGGTGGACAAAGTTCTTGAGCTCAAAAGGAACCTAAAACCATCTCTTCTCAGAAGTTTACCCTAATAAATGCATGTTCTGAGGCATCTCCATCGTACATTGCTGGATGGTTACTATAGAGACTGCGTATGTCTAGGATTGATTGCAGCAAAGCTGGATAATATATGGAGTTTGCTTTATTGGGAGATTCCATCACAGAGATCTTCTCTACCTCCCAGGGACCGTTATGGTACGATCAATGGCCAAGGGGCCAGATAATTGAATTTGGACTGATTTGGCCAGACACAAAGGTGGCCATTTTGTGCAAAGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTGGACCTGGGGGGGTG
  5   1   2       bld Gas8      out                         st31c03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGACTGCGTATGTCTAGGATTGATTGCAGCAAAGCTGGATAATATATGGAGTTTGCTTTATTGGGAGATTCCATCACAGAGATCTTCTCTACCTCCCAGGGACCGTTATGGTACGATCAATGGCCAAGGGGCCAGATAATTGAATTTGGACTGATTTGGCCAGACACAAAGGTGGCCATTTTGTGCAAAGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTGGA
  5   1   2       bld Tbd0      out                    NISC_nl18a07.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTGATTTGGCCAGACACAAAGGTGGCCATTTTGTGCATGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGAACTGGGGGGTG
  5   1   2       bld Gas8      out                         st25p08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTGGCCATTTTGTGCAAAGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGACTGGGGGGT
  5   1   2       bld Tad5                                  XZT3199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTGTGCAAAGATCCACTCGATTGGTGACCTCTCCAAAAGAGCGGCTCTATAAGTGTATGGCCGGCATTAGAGATGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGACTGGGGGGTGCAGGGCCCACCGGGGCTTCTGCCTCAGGGGCCCCTGCACCCCTCAATGACCCTGCTGCCTTCACAACCCCCCCGCCATGCAGAGGCCCCCAACACCCTCCGTCCCCCTCCCTCAAGCACTTCTAAGAGAAACTTATCTGCAGCGCGTTGGGGGAGGGAGACGGCAGATCATGGGAGTGCCCTGGAGGGAATCAGATCTGGGCGGTCCAGTCCGAAGCTGGAACTGCCCCCTCCTCACTGGCGGGGTTGGGGCAGGCCCAATGTCTGTAGACCAGGGGGTGAGGGGTTAAAGTCACTAGAGGAAAGGGTTAAGCCTCCCATCTGCCAGTGACCCATTACAGGAGCAATTTGATGTCCTGAACCTGCCTGGAACCTGGATAAACCTGCAAGTCCCTACGGATATTTGGCCGGCCTTCTCACCACTAATAATGGGTCCCGTACCTCTATATACAGGTACGGGACCCATTAT
  5   1   2       bld Gas6                                 ANBT1821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGAGGGTGCTCCAGTGAATATCTAGTCTATAAGAGTGGGTACCTTGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGACTGGGGGGTGCAGGGCCCACCGGGGCTTCTGCCTCAGGGGCCCCTGCACCCCTCAATGACCCTGCTGCCTTCACAACCCCCCCGCCATGCAGAGGCCCCCAACACCCTCCGTCCCCCTCCCTCAAGCACTTCTAAGAGAAACTTATCTGCAGCGCGTTGGGGGAGGGAGACGGCAGATCATGGGAGTGCCCTGGAGGGAATCAGATCTGGGCGGTCCAGTCCGAAGCTGGAACTGCCCCCTCCTCACTGGCGGGGTTGGGGCAGGCCCAATGTCTGTAGACCAGGGGGTGAGGGGTTAAAGTCACTAGAGGAAAGGGTTAAGCCTCCCATCTGCCAGTGACCCATTACAGGAGCAATTTGATGTCCTGAACCTGCCTGGAACCTGGATAAACCTGCAAGTCCCCACGGATATTTGGCCGGCCTTCTCACCACTAATAATGGGTCCCCGGACCCCT
  5   1   2       bld Gas8      out                         st36o10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGGGTACCTTGGCTGTTATCTAACATAAGGAGATCGCAGGGCAGTCTTGGCTTCCCCTGATGAAATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAACGTGTCCTGTAAACTTGTATTAGAACTGCCCAGGGTTGGACTGGGGGGT
  5   1   2       bld Neu       out                  TNeu083d10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATATTAGAAGGGTAGACATTAGTAATGTGTAAATCGGCATATATATGGCCCATAGCTGCACCCTGTGAACCCCGACCCAATGTGTCCTGTAAACTTGTATTAGAACTACCCAGGGTCGGACTGGGGGGTGCAGAGCCCACTGGGGCTTCTGCCTCAGGGGCCCCTGCACCCCTCAATGACCCTGCTGCCTTCACAACCCCCCCCGCCATGCAGAGGCCCCCAACACCCTCCGTCCCCCTCCCTCAAGCGCTTCTAAGAAAAACTTACCTGCAGCGCGTTGGGGGAGGGAGTGCCCTGGGGGGAATCAATCTGGGCGGTCCTGTCCGAAGCTGGAACTGCCCCCCCTCACTGGCGGGGGTTGGGGCAGGCCCAATGTCTGTAGACCAGGGGGTGAGGGGTTAAAGTCACTAAGGAAAGGGTTAAGCCTCCCATCTGCCAGTGACCCATTACAGGAGCAATTTGATGTCCTGAACATGCCTGGAACCTGGATAAACCTGCAAGTCCCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)