Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:6993680.5                       5 END     1           4       20                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 341.0    0Xt7.1-IMAGE:6993680.5                       5 PI      82          1      304                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012084962 Xt7.1-TNeu129b13.3.5 - 25 ESTs
                                                                       ..0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu129b13.3.5   GGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAGAAAGTGGGAGCTGTGCGTGCAGGGCACCCAGAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTACTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTTTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGAAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCATGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATCTGAACATGTTTTAATAAATAAATCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAA
                                                  Xt7.1-CHK-1008229173         AAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAGAAAGTGGGAGCTGTGCGTGCAGGGCACCCAGAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTACTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTTTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGAAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCATGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCxxxxxxGTAAAAAATATTCAGTCTTGTAAAAAAAATxxxxxxATGTTTTxxxAAATAAATxxxxGxCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAAATAATT
                                                      consensus depths        2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     4     2     4     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     7     7     7    10    11     9    10     9    10     9    11     9    11     9    11     9    11     9    11    11    12    11    12    11    12    12    12    12    12    11    12    11    13     6    12     6    12    11    13    11    13     7    13     7    14     8    15     8    15     8    16     9    16     8    16     8    16     8    16     7    15     7    15     7    15     7    15     7    15     7    15     7    16     7    15     7    15     7    15     7    15     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     7    14     6    13     6    13     5    13     6    13     6    13     4    13     5    13     4    10     4    10     4     9     4     7     4     7     4     7     2     5     2     4     2     4
  5   1   2  SIG                                    Xt7.1-TNeu129b13.3   GGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAGAAAGTGGGAGCTGTGCGTGCAGGGCACCCAGAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTACTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCTCCACCACCCCCTCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGTCTGCCCAGTGGATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTC------------------------------------------------------------CAGAAGTTTGGAGCTCAAAGTCTGCACGGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTAGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAA
  5   1   2                                         Xt7.1-TTbA053g01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGAATCCCATTAACCGGCTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGCAGCAGTACAGCCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTTTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGAAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCATGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGTCGGACAACAACCCTTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGATTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCAAAAAAAAAAAAAAAAAAG
  5   1   2  SIG                                    Xt7.1-TNeu054d13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGGAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCACGGGGCCTTTGAAAAAAGAAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGNGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAAGGCAAGGAGGATTCCTACCTGATGNACAGTGACCTGGACTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTATGATATTTAGGGTCATTCCGAAATGACTATAAAGGGTTTGTGTATAGATCCTGGTTAATCATCATCCAAGCCCCCAGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTGGGGATTTAATAGGGCAAGA
  5   1   2                                         Xt7.1-TNeu104n03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGAAAGTTTGGAGCTCAAAGTCTGCACGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTTTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTTTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTGGGAAAAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACTGCTAGCACTCCAGCAAAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGATTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAATCATGTCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTAAATTCTCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGATGGCCGTTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CG----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------G--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -G-----G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -A-------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------T-----
                                               BLH ATG     704     432   
                                               BLH MIN     704     168   
                                               BLH MPR     416     168   
                                               BLH OVR     704     236   
                                               CDS MIN     704     168   
                                               EST CLI      -2      25   
                                               ORF LNG     704      15   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sc ---- 2e-009     NP_010177.1 Regulation of phosphate metabolism; Pho2p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ce ==== 6e-015     NP_508796.1 C.Elegans Homeobox (ceh-1) [Caenorhabditis elegans] ====================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 6e-018     BAE06563.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Sp ---- 2e-018     NP_001009577.1 homeobox transcription factor Nk1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        REMOVED --- Dm ---- 7e-044     NP_477146.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bf ==== 3e-050     ABD85192.1 gastrulation brain homeobox [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 5e-123     NP_990399.1 gastrulation brain homeo box 2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 1e-130     NP_694496.1 gastrulation brain homeo box 2 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 2e-149     NP_034392.1 gastrulation brain homeobox 2; stimulated by retinoic acid gene 7 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 4e-150     NP_001476.2 gastrulation brain homeo box 2 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          AAK93965.1 homeobox protein GBX-2b [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001083900.1 homeobox protein GBX-2b [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 0          NP_001011472.1 hypothetical LOC496963 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu129b13.3.5                                                                                                                                                                                                                                                                                                                             TGA------------------------------------------------------------TAA---------------------------------------------------------------------------------------TAG------------------------TAATGA------------TGA------------------------------------------------------------------------------ATG---------------------------------TGA---------TAG------------------------------------------TGA---------------ATG------------------------ATGATGATG---------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAA---------------------TGA---------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------ATG------TAGATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------TAA---------------------------------------------ATG------------------------------------------TAA---------------------TGA---------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2  SIG                                    Xt7.1-TNeu129b13.3   GGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAGAAAGTGGGAGCTGTGCGTGCAGGGCACCCAGAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTACTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCTCCACCACCCCCTCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGTCTGCCCAGTGGATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTC------------------------------------------------------------CAGAAGTTTGGAGCTCAAAGTCTGCACGGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTAGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAA
                                                  Xt7.1-CHK-1008295332         AAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAGAAAGTGGGAGCTGTGCGTGCAGGGCACCCAGAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTACTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCTCCACCACCCCCTCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGTCTGCCCAGTGGATTCTGTTCCAGCCTTGCCCAGGGCATGGCACT------------------------------------------------------------------------TTTGGAGCTCAAAGTCTGCACGGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTAGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAAATAATT
  5   1   2   12  ext Gas7 5g3  in                         XZG18007.5p GGGGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAGAAAGTGGGAGCTGTGCGTGCAGGGCACCCAGAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTACTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCC
  5   1   2       ext Neu       in                   TNeu059g14.p1cSP6   GGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCACCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAGAAAGTGGGAGCTGTGCGTGCAGGGCACCCAGAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTACTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCAGAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCA
  5   1   4      seed Neu       in                   TNeu129b13.p1cSP6         GAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATGCCGTTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGGCAGAGAGGAGAGACCCCATTTCTGCGGGAAGAATCCCAAACACAGAAGGAGAAAGTCCCCAGAAAGCAAAAAGTGGGAGCTGTGCGTGCGGGGGGCCCAAAAGGAGCACCCAGGAAAGCAAAGCAAAATCGTCACTCAGAGAGAGAAATGGCCCTCAGCACCCAGTGAAGAAGCAACACAGCCAGGAAACTGGAAGGGGTGAAGTGATTCCTTCAGAGGAGACAATTCCCATATAGAGAGGCTGTGTACTCAGGGCATCCAATAAGAGAGGGGTGCTAGAGAGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTGTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCAC
  5   1   2       ext Neu  5g3  in                   TNeu114a16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                               AGACCCCCCACTATACAGAGAGGGACTCACATAAGCCTGGCGCACATAAAGCTGTCACCAAAGAATCTCCATAGAGCAGTGGGAGGCCCTCCTTTACTTAATGAAGGTTTAGTCTGTGACCCATACAGAATACTGCTTTGTATATCTGGCTTTGGCACCCATCACCCACTTCTACCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGGTCTTGCCCCCTCCACCACCCCCTCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGTCTGCCCAGTGGATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTC
  5   1   2       ext Gas                            TGas027p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAGTTTGGAGCTCAAAGTCTGCACGGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTAGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGC
  5   1   3        nb Gas                            TGas037a13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACAATATCTCCTGCCAAACTGCACACAAANAGGACGACACCCCAGNAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCCGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGTGATTTTTGCACTTGGGGTGGCT
  5   1   3        nb Gas                            TGas049h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCANAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACGGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGCGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCANCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTANTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGA
  3   1   3        nb Neu       ?                     TNeu093k01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCTCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTANAAAAACTCCAGTCTTGTGAAATCCAAAAAAAAAAAAAAAAAA
  3   1   4      seed Neu       in                    TNeu129b13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCTGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGTGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAAACGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu044f22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGAGAGGGTCAAGGCTGGTAATGCGAACTCCAAAACTGGGGAGCCCTCTAGAAACCCCAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTANTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGA
  3   1   2       ext Neu  5g3  in                    TNeu114a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCAAAATTGTTGTGCCCATCCCAGTCCATGTCAGTAGGTTTGCCATACGGAGCCAACACCAGCAGCTGGAGCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCTGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGTGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAAATAATTCCT
  3   1   2       ext Neu       in                    TNeu059g14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAAGCAAGACCTTGAAATGGGCAATGGACATCAGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCNAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCCGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCNCCCTGCCCTGGGNGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAAATAATTCCTTGCAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7 5g3  in                         XZG18007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAGAGAAATCCATTTTGTGGCCCTCCAGTTGTTAATCTACATCTACCAGTATCCCCTGACAGCCAAGGGCAATTAGAGGGTGGTGGAAGTTGTAGTTTTACAACAACGATAGGGCCATAATCTGGTCATCCCTGGACAATGAACAGATTAGCCATGGGTCAGACAATGGAGGTCACAGGACGTCAATAACCAATTCCCTCCTAGACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGGTGATTTTTGCACTTGTGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTTCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAAAAAAAAAAAAAAAGG
  5   1   3        nb Gas                            TGas024l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTTTCCAGAAAGACCCCAGTACTTATTATGTTAAGAAGAAGGGTGATTTTTGCACTTGGGGTGGCTAAAAGGTTAGTTCTTCAGGAACTTAATTTTATGTACAGATAGATGGAAGCTGGCCTCTTTTTAAGGGGTGGTGGACAAAACCCTCTCAAAGCCGTCTTAATTCTAATGTTCTGGACTTTCTATGGACAGAGGCTTAGTGAGAGCTCTGGAACCGGCCACAGGGTTGCGTTGCCTGAAAAGTGCTGTGGGAGCAAAGTTACTTCGGTACGACTGAGGGGGGTACATGCCGAAAAGATGGTAACATCTTCCCCCCCCCCTGCCCTGGGGTGCAATCCCCTTAAACAAACTGAACATGTTTTCTAAATTCTCCCAGAGCCTCAGATTATGTTGTGGTTAATTTATTCTGTGTTGCTTATTTCTTATAAGTTATAAAACTTAAAAAACTCAGTCTTGTGAAATCCAATCATGTCTCTAATAAATAATTCCTTGCAGCC
  5   1   2                                         Xt7.1-TTbA053g01.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGAATCCCATTAACCGGCTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGCAGCAGTACAGCCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTTTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGAAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCATGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGTCGGACAACAACCCTTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGATTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCAAAAAAAAAAAAAAAAAAG
                                                  Xt7.1-CHK-1008295336                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATCCCATTAACCGGCTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGCAGCAGTACAGCCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTTTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGAAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCATGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGTCGGACAACAACCCTTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGATTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCAAAAAAAAAAAAA
  5   1   4      seed TbA       in                   TTbA053g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGAATCCCATTAACCGGCTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGCAGCAGTACAGCCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTTTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGAAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCATGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCANACTCAGCGAGGTCCAGGTCANAATCTGGTTC
  3   1   4      seed TbA       in                    TTbA053g01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGTCGGACAACAACCCTTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGATTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCAAAAAAAAAAAAAAAAAAGCG
  5   1   2  SIG                                    Xt7.1-TNeu054d13.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGGAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCACGGGGCCTTTGAAAAAAGAAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGNGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAAGGCAAGGAGGATTCCTACCTGATGNACAGTGACCTGGACTAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTATGATATTTAGGGTCATTCCGAAATGACTATAAAGGGTTTGTGTATAGATCCTGGTTAATCATCATCCAAGCCCCCAGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTGGGGATTTAATAGGGCAAGA
                                                  Xt7.1-CHK-1008295340                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGGAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCACGGGGCCTTTGAAAAAAGAAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGNGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAAGGCAAGGAGGATTCCTACCTGATGNACAGTGACCTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAAxxAxCCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTATGATATTTAGGGTCATTCCGAAATGACTATAAAGGGTTTGTGTATAGATCCTGGTTAATCATCATCCAAGCCCCCAGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTGGGGATTTAATAGG
  5   1   4   12 seed Gas7 5g3  in                          XZG3632.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCGGCCTGTGATCTTGCCCCCTCCACCACCCCCTCCTCCATCTCTGTCTCAAGCCACTCTGCAGCCAACTCTCCCTTCAGCGCATCCCCACCACCAGATCCCCAGCCTGCCCAGTGCATTCTGTTCCAGCCTTGCCCAGGGCATGGCACTTACCTCGACACTCATGGCTTCTCTGCCAGGGGGATTCTCAGCCTCCGCCCAGCACCAGGAGGCAGTCAGAAAGTTTGGAGCTCAAAGTCTGCACGGGGCCTTTGAAAAAAGAAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGNGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAAGGCAAGGAGGATTCCTACCTGATGNACAGTGACCTGGACTACAGTTC
  5   1   2       ext BrSp      in                     EC2BBA29CF05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACCATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTA
  3   1   2       add Neu       out                   TNeu054d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAAACTGGGGAGCCTTCTAGAAACCCCTAAAANTAGTGGTTCCCATCCCCAGTCCACTGTCAATAGGTTTGCTATACGGAGCCAACACCAGCACGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAACAACCCTTAGAATCCCTTGACAAATTAAATTTGATGTAGAATTTTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTTTGCACTTGGGGAGGCTAAATGTTTAATTTTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATTTTCATTTTCCGGTTTTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTTTTCAGCCCAGGATCTTTTTTTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATTTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTTTTATACATTTTAAAAAAAGGAAAATATTCAGTCTTGTAAAAAAAATTAATCATCAGCTTGAGGAATAAATTGATGGCCGTTCTATGAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   4      seed Gas7 5g3  in                          XZG3632.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGTCGGACAACAACCCTTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGATTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAAGGTAAAAAATATTCAGTCTTGTAAAAAAATTAATCATGTCCCTAATAAATAAATTGA
  5   1   3        nb Neu                            TNeu082i23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCGAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTGTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTGCCTAATAAATAAATTGATGGCC
  5   1   3        nb Neu                            TNeu038f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGATTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAATTTAATCATGTCCCTAATAAATAAATTGATGGCC
  3   1   2       ext BrSp      in                     EC2BBA29CF05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACCATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTCTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTCTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTATGATATTTAGGGTCATTCCGAAATGACTATAAAGGGTTTGTGTATAGATCCTGGTTAATCATCATCCAAGCCCCCAGAGACTCATTTTGTCAAACATGATGTGTGTGAATTGAATGGGGGAGTCACCAAAAAAGAAGGCTGTGGGGATTTAATAGGGCAAGACA
  5   1   2                                         Xt7.1-TNeu104n03.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGAAAGTTTGGAGCTCAAAGTCTGCACGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTTTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTTTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTGGGAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008295330                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTTTGGAGCTCAAAGTCTGCACGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTTTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTTTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTGGGAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Neu       in                   TNeu104n03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGAAAGTTTGGAGCTCAAAGTCTGCACGGGGGCCTTTGAAAAAAGCAAAGGGGGCCAATCTGATGAAGAAGATGGTAACAAGACCTACATAACCAAAGAGGGCACCTTGCTGCCTTTCTCTGCTTCGGAAGCTTCTCTGGGTCCAGTCCGTGGGCAGGGGAAAGAGGAGTCTGGGATGGAAGCAGAAGGAAAGGGCAAGGAGGATTCCTACCTGATGGACAGTGACCTGGACTACAGTTCAGATGACAATATCTCCTGCCAAACTGCACACAAAGAGGACGACACCCCAGAGGAAAGCCCCCCAAACTCAAATCCTTCTAATAACAGCAACACCAGCTCCACAGGGAAGAACCGACGGAGGAGGACTGCCTTCACCAGTGAACAACTGCTGGAACTAGAGAAAGAGTTCCACTGCAAGAAGTACTTGTCCCTGACAGAGAGATCCCAGATCGCACATGTGCTCAAACTCAGCGAGGTCCAGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCT
  3   1   4      seed Neu       in                    TNeu104n03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGTCAAAATCTGGTTCCAGAACCGCAGAGCCAAGTGGAAGAGGGTCAAGGCTGGTAATGTAAACTCCAAAACTGGGGAGCCTTCTAGAAACCCTAAAATAGTGGTTCCCATCCCAGTCCATGTCAATAGGTTTGCTATACGGAGCCAACACCAGCAGCTGGAGCAAGGGAGACCGTGAAACACTGCTAGCACTCCAGCAAAGGAATCCATTCTGTCACCCTCCATTTGACGGACAACAACCCTTAGAATCCCTTGACAAATTAAATCTGATGTAGAATTCTGGGAGAAGAAGTTTCACAACTGTAAGATCAAACAACAAACATAAAAAGACTGAACCAGTTCCCTTCAAGACTTTCCAGAAAGATACTATTTATTATTTGAAGAAGGGGGGACTTCTGCACTTGGGGAGGCTAAATGTTTAATTCTATTGGGCCTGAAATGTATGCACAAATAGATGGAAATTGGCTTCTTTTTCATAGGTGATGGACTAAACCTCTCCAAGCCATCTTCATTTTCCGGTTCTGGACTTGATATGGATAGAGGTATAGTGCAAGCTCTGGAACTGGACCAAGGGCCATGTTTTTTCAGCCCAGGATCTTTTTCTCCAGCTCTTGTCATTTAAAGGCAAAGGCCCAGATATGAACAGACTTTTTTCATTTTCCAAGAATCTAAGATTATTTTGTGGTTAATTTATTCTGTTTCCTATTCTTATACATTTTAAAATGTAAAAAATATTCAGTCTTGTAAAAAAAATTAATCATGTCCCTAATAAATAAATTGATGGCCGTTCTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)