Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012085891 Xt7.1-CABJ9424.5 - 11 ESTs
                                                                       ......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ9424.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGATCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCACACTGACTACCTGCCCAGCGGCCATTCTCCGGAGTACTACGGCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCAGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACTGCTTACACCAGGCAGCAAGTGCTTGAACTGGAAAAGGAGTTTCACTACAACCGCTATCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTTTCTGAGCGACAAATTAAGATTTGGTTCCAAAACAGGAGGATGAAATGGAAGAAAGATCACAAGCTCCCCAATACCAAGATCAGGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCCTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGAGGCAAAGCCTGTGTCCCCATGACTGGATCCTCTCTTTCTTTGCTTTTTGTTTGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTAAGAACAGGATCGTGTATATACCCTTATAATATACACCCCCTCTAGTAAGTCACCCCCCTTCCCAGTCATATTTGTTTCAACGTCACTTGGATTATGCTTTTACCTGTGTACATAGTTTACCAATAATAAAATTAT
                                                  Xt7.1-CHK-1008234817                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGATCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCACACTGACTACCTGCCCAGCGGCCATTCTCCGGAGTACTACGGCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCAGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACTGCTTACACCAGGCAGCAAGTGCTTGAACTGGAAAAGGAGTTTCACTACAACCGCTATCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTTTCTGAGCGACAAATTAAGATTTGGTTCCAAAACAGGAGGATGAAATGGAAGAAAGATCACAAGCTCCCCAATACCAAGATCAGGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCCTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGAGGCAAAGCCTGTGTCCCCATGACTGGATCCTCTCTTTCTTTGCTTTTTGTTTGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTAAGAACAGGATCGTGTATATACCCTTATAATATACACCCCCTCTAGTAAGTCACCCCCCTTCCCAGTCATATTTGTTTCAACGTCACTTGGATTATGCTTTTACCTGTGTACATAGTTTACCAATAATAAAATTATTTTCCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      2     3     2     3     2     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     6     4     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     4     5     4     5     4     5     5     6     5     6     5     6     6     7     6     7     6     7     6     7     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG       7     162                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR       7     241                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG       7       9                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 1e-023     XP_793141.1 PREDICTED: similar to CG1028-PK, isoform K [Strongylocentrotus purpuratus] --------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 6e-025     NP_001021164.1 abnormal cell LINeage family member (lin-39) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-036     NP_477201.1 Deformed CG2189-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 2e-039     BAE06501.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Bf ==== 4e-055     BAA78622.1 AmphiHox4 [Branchiostoma floridae] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 4e-070     NP_034589.3 homeo box B4 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 1e-070     NP_076920.1 homeo box B4 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 2e-074     NP_571193.1 homeo box B4a [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 5e-078     NP_990624.1 homeobox protein Hox-B4 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 1e-117     AAA49756.1 homeobox protein 1A [Xenopus laevis]  ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 1e-117     NP_001089733.1 hypothetical protein LOC734796 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 1e-137     AAH90114.1 Unknown (protein for IMAGE:6988079) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ9424.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------TGA------TAG---TAA------TAA------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------TGA------------------TAATAAATG---------------------------------------------------------------------TAA------------------------------------------------------TAA---------------------------------------------------------------------------TGA------ATG------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Gas1 FL                     IMAGE:6988079.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGATCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCACACTGACTACCTGCCCAGCGGCCATTCTCCCGAGTACTACGGCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCAGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTTGAACTGGAAAAGGAGTTTCACTACAACCGCTATCTGACCCGCAGGCGCAGGGTGGAAATTGCGCACACTTTGCGCCTTTCTGAGCGACAAATTAAGATTTGGTTCCAAAACAGGAGGATGAAATGGAAGAAAGATCACAAGCTCCCCAATACCAAGATCAGGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCCTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGAGGCAAAGCCTGTGTCCCCATGACTGGATCCTCTCTTTCTTTGCTTTTTGTTTGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTAAGAACAGGATCGTGTATATACCCTTATAATATACACCCCCCTCTAGTAAGTCACCCCCCTTCCCAGTCATATTTGTTTCAACGTCACTTGGATTATGCTTTTACCTGTGTACATAGTTTACCAATAATAAAATTATTTTTCCTCAAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas8      out                         st87h01.5p                                                                                                                                                                                                                                                                                                                                                                                TAATGGAAAAGGTGTGAGAGCTTTGCCCAATGTAGGGGCCCCATGTAATACTGTAATGTAGGAAGTATTGGAGCAGGGAGTGGGGGCCAGTCAACCTGACTGCTGTTAGTGGGGGAGTTGGAGCACGTTTCCATATCCGGCAGTGGTGGGCGCATTCCTATTGGCTCCTGGTGTCACATGGAAACCCAACTTTGTTCACTTGACAGTAAGTAGGAGGGTTTTGCGAAACAGGAAAACGTCCAGGGCTCTAGGAATAAATTGGACCTTATTTTTTGGGTGCAATTGAAAAGAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGATCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCACACTGACTACCTGCCCAGCGGCCATTCTCCGGAGTACTACGGCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCAGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCCAGGGGTAAGTTCTCTCTGCTACCTCCAAGCTCTCT
  5   1   2       bld Gas1 FL                            IMAGE:6988079                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGGTTCCGGAATTCCCGGGATGAGAATGAGTTCGTTTTTGATCAGCTCCACTATGTGGATCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCACACTGACTACCTGCCCAGCGGCCATTCTCCCGAGTACTACGGCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCAGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACAGCTTACACCAGGCAGCAAGTGCTTGAActggaaaaggagtttcactacaaccgctatctgacccgcaggcgcagggtggaaattgcgcacactttgcgcctttctgagcgacaaattaagatttggttccaaaacaggaggatgaaatggaagaaagatcacaaGCTCCCCAATACCAAGATCAGGTCTAACCCTTTCTGTGAACCTCCAAATTGCCGGGGGGGTCCCCCAAATCAGAACCAAGGGGACCCTTGTCTGCCAATGACCATCCCTAAGAATAACACAAATTAACCTCAACTGGTTTTGGTTCTTATTATAAAAGGGGA
  5   1   2   32  bld Tad5 PIPE                            XZT71857.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAAAGAAATAAATGAGAATGAGTTCGTTTTTGATCAGCTCCAACTATGTGGATCCCAAGTTTCCGCCCTGTGAGGAGTACTCCCACACTGACTACCTGCCCAGCGGCCATTCTCCGGAGTACTACGGCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCAGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACTGCTTACACCAGGCAGCAAGTGCTTGAActggaaaaggagtttcactacaaccgctatctgacccgcaggcgcagggtggaaattgcgcacactttgcgcctttctgagcgacaaattaagatttggttccaaaacaggaggatgaaatggaagaaagatcacaaGCTCCCCAATACCAAGATCAGGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCCTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGA
  5   1   2       bld Ovi1      in                         CABI5041.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCTGTGAGGAGTACTCCCACACTGACTACCTGCCCAGCGGCCATTCTCCGGAGTACTACGGCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCAGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACTGCTTACACCAGGCAGCAAGTGCTTGAActggaaaaggagtttcactacaaccgctatctgacccgcaggcgcagggtggaaattgcgcacactttgcgcctttctgagcgacaaattaagatttggttccaaaacaggaggatgaaatggaagaaagatcacaaGCTCCCCCATACCAAGATCAGGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGT
  5   1   2       bld Neu       in                   TNeu090p03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGGCCAGAAGAGGGAGAGCAGTTTCCAGCATGGGGCACCCTATTCCCGATCGCTTTCCAGCAGCAGCGCACCCTATACTTCTTGCCAGGGATCTGTGCGCCAAGGCGCAAGGCTGCCGCACTCCTCTGGGCTTCTTCCTGGCGAGAAAGCGCACTTGGAATCCAGCATAACCCCCACTTCGCCTCCATCCTGCGGCCTCATAGCCTCAGACCACAAGCACCCCGACTCCCCCGGCCAGGACCCAGTGGTGTACCCCTGGATGAAGAAAGCGCACATCTCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACAGCTTACACCAGCAGCAAGTGCTTGAActggaaaaggagtttcactacaaccgctatctgacccgcaggcgcagggtggaaattgcgcacactttgcgcctttctgagcgacaaattaagatttggttccaaaacaggaggatgaaatggaagaaagatcacaaGCTCCCCAATA
  5   1   2      seed Ski1      in                         CABJ9424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGGATGAAGAAAGCGCACATCTCCAGGGCCAGTTCCACTTACTCTGATGGGGAGGCCAAGAGATCCCGTACTGCTTACACCAGGCAGCAAGTGCTTGAActggaaaaggagtttcactacaaccgctatctgacccgcaggcgcagggtggaaattgcgcacactttgcgcctttctgagcgacaaattaagatttggttccaaaacaggaggatgaaatggaagaaagatcacaaGCTCCCCAATACCAAGATCAGGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCCTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGAGGCAAAGCCTGTGTCCCCATGACTGGATCCTCTCTTTCTTTGCTTTTTGTTTGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTA
  3   1   2       bld Ski1      in                         CABJ9424.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGCAGGGTGGAAATTGCGCACACTTTGCGCCTTTCTGAGCGACAAATTAAGATTTGGTTCCAAAACAGGAGGATGAAATGGAAGAAAGATCACAAGCTCCCCAATACCAAGATCAGGTCTAACCCTTCTGTGAACCTCCAAATTGCAGGGGGGTCCCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCCTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGAGGCAAAGCCTGTGTCCCCATGACTGGATCCTCTCTTTCTTTGCTTTTTGTTTGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTAAGAACAGGATCGTGTATATACCCTTATAATATACACCCCCTCTAGTAAGTCACCCCCCTTCCCAGTCATATTTGTTTCAACGTCACTTGGATTATGCTTTTACCTGTGTACATAGTTTACCAATAATAAAATTATTTTTCCTC
  3   1   2       bld Neu       in                    TNeu090p03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGGGGGGTCCCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCCTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGAGGCAAAGCCTGTGTCCCCATGACTGGATCCTCTCTTTCTTTGCTTTTTGTTTGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTAAGAACAGGATCGTGTATATACCCTTATAATATACACCCCCCTCTAGTAAGTCACCCCCCTTCCCAGTCATATTTGTTTCAACGTCACTTGGATTATGCTTTTACCTGTGTACATAGTTTACCAATAATAAAATTATTTTTCCTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas8                                 st102m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCAAATCAGAACAAAGGGAACCCTGTCTGCCAATGACATCCNTAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTNAGATTNGGAGAAGATAGAT
  5   1   2       bld Neu                            TNeu024o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGACTAAACAAAATAAACTCAACTGTTTTTGTTTCTAATTTATAAAAGGGGAGAAGAGACTTGGCTTGGCTCCCCGGCTCATCCAGGAGAAGCCTGTAGATAGATTTCAGATTTGGAGAAGATAGATCTATGTTTCATCTTTAATCACGCCAAACCCTGGCCCATTTGTCATGTTTACACTGCGGTACAAAGGCTGAACCTCATCTGACAGAACCAACGCTCATTTTAATAAATGAGGCAAAGCCTGTGTCCCCATGACTGGATCCTCTCTTTCTTTGCTTTTTGTTTGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTAAGAACAGGATCGTGTATATACCCTTATAATATACACC
  3   1   2       bld Ovi1      in                         CABI5041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTGGATCCTCTCTTTCTTNGCTTTTTGTTNGTGCTGTAGCAGTGCGTAATATGGTGCCCAAATCCATTACAATAGAGTGTTAGCTCTGAGGGGTTCAGTCTTGTAAATCTCATTGTTTCTCAGGAGTAACCTGTCACCCTCAGTTTGGGGCCTCAGATCACACCTATTTTGGGGGGCAAGCTGATCTAAAATGGGGTGTCCCAGGTTCAGGATATCATACCCAGTTGAAGCCTCTGGCACTGTAATATATATTTAAGAACAGGATCGTGTATATACCCTTATAATATACACCCCCTCTAGTAAGTCACCCCCCTTCCCAGTCATATTTGTTTCAACGTCACTTGGATTATGCTTTTACCTGTGTACATAGTTTACCAATAATAAAATTATTTTCCTCAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)