Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 45%

 1012086544 Xt7.1-TTpA041o09.5 - 12 ESTs
                                                                       ......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA041o09.5                                                                                                                                                                                                                                             GTTTTTGATGGACTCTTTGGCCGGTAGCTGCAGAGGAGAGACTTATTCCACCAACCAAGGGATGTATATGCAGACTGGGAGCGATTTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCAAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTATCCATCTTACCTCTCTCAACTGGACAGTTGGTGCGAACCCAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCATCCTGCTCTTTCCCAACCAATGTCAAGGAGGAGAATGTTTGTTGCATGTACAGTACGGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACGCGCTCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCAGTCAAGGTTACTCAATGGAGAAGACCCCAAGCTGTCACACCACTGGCGACTTTGAGACAACTTTTGAGAATAGGACGAGTGTTAGCGCAAGAAGTGAGATCTTGGAACAACAACAAGCTGGGGGGAAGGGGGGGTTCCCCGAAAACACCAAGACGGACAACCAGTCCCTGGCCACCAACCTTACTACCAGCTCTGCCACCGCCAGTGATATAAAGACAGAGAAAAGTCTCCCAGCCCCCAAACTGCCACCCTCCGAAGGGGACAAGGAGCCGAGCAAGAACACAGACACCAGCACCGACAATTCTGACGCTGAAGCAAAAGAGGATATAAAGGCAGAAAACGCTGCAGGAAATTGGCTGACAGCTAAGAGCGGAAGAAAGAAAAGGTGTCCTTATACTAAGCACCAGACGCTGGAACTGGAAAAGGAGTTCTTGTTTAATATGTACTTGACCCGTGAGCGCCGCCTAGAGATTAGTAAGAGTATCAACTTAACAGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAATTAAAGAAGATGAACAGGGAGAACCGAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGAGCTTCAAAAAAAAAGAGTAATAAGAAAGAGGAAAAAACGCAAAAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGCAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGACATTACATATATATAAATATATATAGAAAAAATACACTTAAATATATATCTTATGCAGCTCCTCTAACTGGGCGACTGCATATTTAAGTAAGGGGAAAAGAACAGTATTGCTACTCCTTTAAAATACATTTCTTGTGACC
                                                  Xt7.1-CHK-1008234478                                                                                                                                                                                                                                                   GATGGACTCTTTGGCCGGTAGCTGCAGAGGAGAGACTTATTCCACCAACCAAGGGATGTATATGCAGACTGGGAGCGATTTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCAAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTATCCATCTTACCTCTCTCAACTGGACAGTTGGTGCGAACCCAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCATCCTGCTCTTTCCCAACCAATGTCAAGGAGGAGAATGTTTGTTGCATGTACAGTACGGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACGCGCTCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCAGTCAAGGTTACTCAATGGAGAAGACCCCAAGCTGTCACACCACTGGCGACTTTGAGACAACTTTTGAGAATAGGACGAGTGTTAGCGCAAGAAGTGAGATCTTGGAACAACAACAAGCTGGGGGGAAGGGGGGGTTCCCCGAAAACACCAAGACGGACAACCAGTCCCTGGCCACCAACCTTACTACCAGCTCTGCCACCGCCAGTGATATAAAGACAGAGAAAAGTCTCCCAGCCCCCAAACTGCCACCCTCCGAAGGGGACAAGGAGCCGAGCAAGAACACAGACACCAGCACCGACAATTCTGACGCTGAAGCAAAAGAGGATATAAAGGCAGAAAACGCTGCAGGAAATTGGCTGACAGCTAAGAGCGGAAGAAAGAAAAGGTGTCCTTATACTAAGCACCAGACGCTGGAACTGGAAAAGGAGTTCTTGTTTAATATGTACTTGACCCGTGAGCGCCGCCTAGAGATTAGTAAGAGTATCAACTTAACAGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAATTAAAGAAGATGAACAGGGAGAACCGAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGAGCTTCAAAAAAAAAGAGTAATAAGAAAGAGGAAAAAACGCAAAAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGCAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGACATTACATATATATAAATATATATAGAAAAAATACACTTAAATATATATCTTATGCAGCTCCTCTAACTGGGCGACTGCATATTTAAGTAAGGGGAAAAGAACAGTATTGCTACTCCTTTAAAATACATTTCTTGTGACCGTTATT
                                                      consensus depths                                                                                                                                                                                                                                                  2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     6     4     6     4     5     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     3     4     4     4     4     4     4     5     4     5     4     5     3     5     3     5     4     6     4     6     4     7     4     7     4     7     4     7     3     7     2     6     2     6     2     6     3     7     7     8     4     8     4     8     4     8     4     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     3     3     2     3
                                               BLH ATG     -32      71                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 3e-019     NP_001021164.1 abnormal cell LINeage family member (lin-39) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 4e-022     NP_477201.1 Deformed CG2189-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 1e-026     BAE06496.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED = Sp ==== 7e-028     XP_783352.1 PREDICTED: similar to Homeobox protein Hox-B9 (Hox-2.5) [Strongylocentrotus purpuratus] ====================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Bf ==== 2e-029     AAF81909.1 homeodomain-containing protein Hox11 [Branchiostoma floridae] ==============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xt ---- 9e-031     AAI22055.1 Unknown (protein for IMAGE:7860727) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN --- Dr ---- 1e-074     NP_571241.1 homeo box D10a; homeobox gene D-10 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 2e-080     XP_001233806.1 PREDICTED: similar to Hoxc10 protein, partial [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 3e-127     NP_034592.1 homeo box C10 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 7e-131     NP_059105.2 homeo box C10; homeobox protein Hox-C10; homeoprotein C10 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 0          AAH77298.1 Hoxc10 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- ?? ---- 0          NP_001083948.1 Hoxc10 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA041o09.5                                                                                                                                                                                                             ATG------------------------------------ATG---------------------------------------------------ATG---ATG---------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAG------------------------------TAG------------------------TGA---------------------------------------------ATG------TAA------------------------------------------------------------------------------------TAA---------------------------------------------ATG------TGA---TAAATG---------------------TGA---------------------------------------------------------------------------------------------TAA------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       bld Tbd1      in                        CBXT16016.b1                                                                                                                                                                                     CCTCTTTAAAAACCCTGTCTGAAAATGTCATGTCCCAACAATGTGACTCCTAACTCGTTTTTGATGGACTCTTTGGCCGGTAGCTGCAGAGGAGAGACTTATTCCACCAACCAAGGGATGTATATGCAGACTGGGAGCGATTTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCAAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTATCCATCTTACCTCTCTCAACTGGACAGTTGGTGCGAACCCAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCATCCTGCTCTTTCCCAACCAATGTCAAGGAGGAGAATGTTTGTTGCATGTACAGTACGGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACGCGCTCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCAGTCAAGGTTACTCAATGGAGAAGACCCCAAGCTGTCACACCACTGGCGACTTTGAGACAACTTTTGAGAATAGGACGAGTGTTAGCGCAAGAAGTGAGATCTTGGAACAACAACAAGCTGGGGGGAAGGGGGGGTTCCCCGAAAACACCAAGACGGACAACCAGTCCCTGGCCACCAACCTTACTACCAGCTCTGCCACCGCCAGTGATATAAAGACAGAGAAAAGTCTCCCAGCCCCCAAACTGCCACTCTCCGAAGGGGACAAGGAGCCGAGCAAGAACACAGACACCAGCACCGACAATTCTGACGCTGAAGCAAAAGAG
  5   1   2       add Tbd0                               IMAGE:6980776                                                                                                                                                                                                                                             GTTTTTGATGGACTCTTTGGCCGGTAGCTGCAGAGGAGAGACTTATTCCACCAACCAAGGGATGTATATGCAGACTGGGAGCGATTTCAGCTGTGGGATGATGAGAAACTGTGGAATTGTCCCGTCTCTTTCAAAAAGGGACGATGTGAATAACCCTGGCTTGTCTCTCAACACCTATCCATCTTACCTCTCTCAACTGGACAGTTGGTGCGAACCCAAAAATACTTACAGGATTGAACAACCTGTTGCAAGGCAGCTCTCATCCTGCTCTTTCCCAACCAATGTCAAGGAGGAGAATGTTTGTTGCATGTACAGTACGGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACGCGCTCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCAGTCAAGGTTACTCAATGGAGAAGACCCCAAGCTGTCACACCACTGGCGACTTTGAGACAACTTTTGAGAATAGGACGAGTGTTAGCGCAAGAAGTGAGATCTTGGAAACACAACAGCTGGGGGGAAGGGGGGGTTCCCGAAACACCAAGACGGACAACCATCCTGGCCAACAACTTACTACAGCTCGCACCGCAGTGAAATAAACAGATAAAGTCTCCACCCCCAAATGCCCCCTCAAGGGGAAAGGCCCACAAAACCAACCCCCCCAATTTGACCTAACAAAAAGAATAGGCAAAACCTCGGAATGCGAACCTAA
  3   1   2      skin Tbd1      in                        CBXT16016.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGGAGAATGTTTTGTTGCATGTACAGTACGGATAAAAGAGCGAAAAATGCCACCGAGGCTGCCCTCTACCCAAACCAGATGCCAGAGACGCGCTCAAGTGACCATGAAGTTCCTGTCCCCAGTTACTACCGAGCCAGTCAAGGTTACTCAATGGAGAAGACCCCAAGCTGTCACACCACTGGCGACTTTGAGACAACTTTTGAGAATAGGACGAGTGTTAGCGCAAGAAGTGAGATCTTGGAACAACAACAAGCTGGGGGGAAGGGGGGGTTCCCCGAAAACACCAAGACGGACAACCAGTCCCTGGCCACCAACCTTACTACCAGCTCTGCCACCGCCAGTGATATAAAGACAGAGAAAAGTCTCCCAGCCCCCAAACTGCCACCCTCCGAAGGGGACAAGGAGCCGAGCAAGAACACAGACACCAGCACCGACAATTCTGACGCTGAAGCAAAAGAGGATATAAAGGCAGAAAACGCTGCAGGAAATTGGCTGACAGCTAAGAGCGGAAGAAAGAAAAGGTGTCCTTATACTAAGCACCAGACGCTGGAACTGGAAAAGGAGTTCTTGTTTAATATGTACTTGACCCGTGAGCGCCGCCTAGAGATTAGTAAGAGTATCAACTTAACAGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAATTAAAGAAGATGAACAGGGAGAACCGAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGAGCTTCAAAAAAAAAGAGTAATAAGAAAGAGGAAAAAACGCAAAAAAAAAAAAAAA
  5  -1   2       bld Egg                            TEgg094d24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTCCTGTCCCCAGTTACTACCGAGCCAGTCAAGGTTACTCAATGGAGAAGACCCCAAGCTGTCACACCACTGGCGACTTTGAGACAACTTTTGAGAATAGGACGAGTGTTAGCGCAAGAAGTGAGATCTTGGAACAACAACAAGCTGGGGGGAAGGGGGGGTTCCCCGAAAACACCAAGACGGACAACCAGTCCCTGGCCACCAACCTTACTACCAGCTCTGCCACCGCCAGTGATATAAAGACAGAGAAAAGTCTCCCAGCCCCCAAACTGCCACCCTCCGAAGGGGACAAGGAGCCGAGCAAAAACACAGACACCAGCACCGACAATTCTGACGCTGAAGCAAAAGAGGATATAAAGGCAGAAAACGCTGCAGGAAATTGGCTGACAGCTAAGAGCGGAAGAAAGAAAAGGTGTCCTTATACTAAGCACCAGACGCTGGAACTGGAAAAGGAGTTCTTGTTTAATATGTACTTGACCCGTGAGCGCCGCCTAGAGATTAGTAAGAGTATCAACTTAACAGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAATTAAAGAAGATGAACAGGGAGAACCGAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGA
  5   1   2       bld Neu                            TNeu001k05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCAAACAGCAGATCCCTCCTCACTTCACAGGGCAANAAATGAATGAGAATCCGAGCAGCCAAGACTCAGGCAAAGTCCCATCTGGGGAGAGTCCCGATCCCAAGGCTGCGCATCANGAGGACAGGAGCTGCCTGGCTGAGGTGTCTGTGTCCAGCCCANAAGTGCAGGACAAGGAGACGAAAGAGGAAATCAAGTCTGATACCCCAACGAGCAATTGGCTAACTGCAAAGAGTGGCAGAAAGAAGAGTGTCCCTATACCAAACACCAGACATTGGAGTTAGAGAAAGAGTTCTTGTTTAATATGTATCTGACGCGGGAGCGCCGCCTAAAGATCAGTAAGAGTGTGAATCTCACTGACAGGCAGGTCAAGATCTGGTTTCAAAATCGCAGAATGAAGTTAAAGAAGATGAGCAGAGAGAACCGAATCCGCGAACTGACCGCGAATCTGACTTTTTCGTAAGAAGTGACCAAAATGCTATTTAACCTTTGACAAAGCATCAGCCATTGCTACACTCGGAGAGACTTTAAGAACATTTCAGAAACATATTTTTTTTTTTT
  5   1   2      seed TpA       in                   TTpA041o09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAGAACACAGACACCAGCACCGACAATTCTGACGCTGAAGCAAAAGAGGATATAAAGGCAGAAAACGCTGCAGGAAATTGGCTGACAGCTAAGAGCGGAAGAAAGAAAAGGTGTCCTTATACTAAGCACCAGACGCTGGAACTGGAAAAGGAGTTCTTGTTTAATATGTACTTGACCCGTGAGCGCCGCCTAGAGATTAGTAAGAGTATCAACTTAACAGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAATTAAAGAAGATGAACAGGGAGAACCGAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGAGCTTCAAAAAAAAAGAGTAATAAGAAAGAGGAAAAAACGCAAAAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGCAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGA
  5   1   2       bld Neu       in                   TNeu079c20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAACTAGTGTGAGCGCCGCTTATAGATTAGTAAGAGTATCAACTTAACAGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAATTAAAGAAGATGAACAGGGAGAACCTAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGAGCTTCAAAAAAAAAGAGTAATAAGAAAGAGGAAAAAACGCAGAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTG
  3   1   2       bld Neu       in                    TNeu079c20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGAAAATCTGGTTTCAGACCCGCAGGATGAAATTAAAGAAGATGAACAGGGAGAACCGAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGAGCTTCAAAAAAAAAGAGTAATAAGAAAGAGGAAAAAACGCAAAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGCAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGACATTACATATATATAAATATATATAGAAAAAATACACTTAAATATATATCTTATGCAGCTCCTCTAACTGGGCGACTGCATATTTAAGTAAGGGGAAAAGAACAGTATTGCTACTCCTTTAAAATACATTTCTTGTGACCGTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA041o09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATTAAAGAAGATGAACAGGGAGAACCGAATTCGGGAACTGACTTCCAATTTTAATTTTACTTGAGCTTCAAAAAAAAAGGGTAATAAGAAAGGGGAAAAAACGCAAAAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTTTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGCAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGACATTACATATATATAAATATATATAGAAAAAATACACTTAAATATATATCTTATGCAGCTCCTCTAACTGGGCGACTGCATATTTAAGTAAGGGGAAAAGAACAGTATTGCTACTCCTTTAAAATACATTTCTTGTGACCGTTATTTAAAAAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Tbd1      in                         CBXT9754.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAGGAAAAAACGCAAAAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGCAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGACATTACATATATATAAATATATATAGAAAAAATACACTTAAATATATATCTTATGCAGCTCCTCTAACTGGGCGACTGCATATTTAAGTAAGGGGAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT9754.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAAGAGGAAAAAACGCAAAAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGACAGAAATGGCAACTCCCCTACCCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGCAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGACATTACATATATATAAATATATATAGAAAAAATACACTTAAATATATATCTTATGCAGCTCCTCTAACTGGGCGACTGCATATTTAAGTAAGGGGAAAAAAAAAAAAAAA
  5  -1   2       bld Neu                            TNeu002g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAAAAAAAAAAAAAAAAGCCAACAACAAAGAACCCAAGCCAGAAATGGCAACTTCCCCNNTACCCACCCCTAAAAAGAAATTTTAAACAAAAAATAGTCAATTCGAATAACATTTTCTAAGTCGTTATTGAAAAGCATATAAAAGCAACTTGTAAGTATACCGTTAGGTAGCCCTGCTGTTATTTTGGCTATTCCAGTCTGTAGATAAAGCTACATCGATATAAAGCATGATCATATATTGCATCCCTGTTCCTATGTACAAAGCCAGCTACTGAAATGGTATCTTAAGTTATTTACTTCCAGCACAAACTGAGAGACATTTTTATTACTTTTCTTTTGGTAAATAACCTTATAGAGGATCCCAAATGCGTTTAAAGTTTGCTCCATCAGTGTAACCTGTATATTGTATCGCAAAGCAGAATGACAAACTGATTTTAAATGTTTGTAAATGAGCAGCTGAAGTGAGGTTATGGACATTACATATATATAAATATATATAGAAAAAATACACTTAAATATATATCTTATGCAGCTCCTCTAACTGGGCGACTGCATATTTAAGTAAGGGGAAAAGAACAGTATTGCTACTCCTTTAAAATACTTTCTTGTGACCGTTATTTAAAAAAAAAAAAAAAAAAGCGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)