Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBXT21038.3                           7 END     5         100       71                (no blast hit)

 This cluster: approximate FL confidence score = 91%

 1012087418 Xt7.1-CABI635.3 - 5 ESTs
                                                                       .........-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CABI635.3                                                                                                                                                                                                        CGGACTTGCTAAACGCATCGCACCGTGTCTGTTGCGACGGAGGAAGAGTCCGCGGAGTTGGGGGGAGTCGCACCGTTGCCGACTACTGTCGCTCGCCCTTTTCAAATCACTGCCAGAGACTGCGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTAGCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGCCCACCTCTCACTCCCCGCACCCCCTTTTTGCATCTCAGCAACGGGACCCCTCAACTTTCTACCCTTGGTTAATACATCGGTACCGGTACCTGGGACACAGATTCCAAGGGAACGACACAAGTGCGGAGAGTTTCCTCCTACACAATGCACTGGCCCGGAAACCCAAACGGATCCGCACAGCCTTCTCCCCGTCTCAGTTACTGCGCCTGGAACACGCCTTCGAGAAGAACCACT
                                                  Xt7.1-CHK-1008243586                                                                                                                                                                                                              TGCTAAACGCATCGCACCGTGTCTGTTGCGACGGAGGAAGAGTCCGCGGAGTTGGGGGGAGTCGCACCGTTGCCGACTACTGTCGCTCGCCCTTTTCAAATCACTGCCAGAGACTGCGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTAGCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGCCCACCTCTCACTCCCCGCACCCCCTTTTTGCATCTCAGCAACGGGACCCCTCAACTTTCTACCCTTGGTTAATACATCGGTACCGGTACCTGGGACACAGATTCCAAGGGAACGACACAAGTGCGGAGAGTTTCCTCCTACACAATGCACTGGCCCGGAAACCCAAACGGATCCGCACAGCCTTCTCCCCGTCTCAGTTACTGCGCCTGGAACACGCCTTCGAGAAGAACCACTACGTTG
                                                      consensus depths                                                                                                                                                                                                             2     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2
                                               BLH ATG     275     654                                                                                                                                                                                                        
                                               BLH MIN     263      73                                                                                                                                                                                                        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 2e-009     BAE06399.1 transcription factor protein [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-014     NP_524825.1 CG9930-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---= 4e-017     AAK93792.1 homeodomain protein EmxB [Branchiostoma floridae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 1e-016     XP_783008.1 PREDICTED: similar to empty spiracles homolog 1 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 1e-050     CAJ82390.1 empty spiracles homolog 1 (Drosophila) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 3e-092     AAH74130.1 MGC81839 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 3e-092     NP_001086052.1 MGC81839 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 2e-092     NP_571355.2 empty spiracles homeobox 2 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 1e-093     NP_034262.1 empty spiracles homolog 2 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 2e-094     NP_004089.1 empty spiracles homolog 2 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 3e-096     XP_421783.2 PREDICTED: hypothetical protein [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CABI635.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  0   1   1           Neu  FL                     TNeu125h20.FL-Sanger                                                                                                                                                                                                ATCGTCTTCGGACTTGCTAAACGCATCGCACCGTGTCTGTTGCGACGGAGGAAGAGTCCGCGGAGTTGGGGGGAGTCGCACCGTTGCCGACTACTGTCGCTCGCCCTTTTCAAATCACTGCCAGAGACTGCGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTAGCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGCCCACCTCTCACTCCCCGCACCCCCTTTTTGCATCTCAGCAACGGGACCCCTCAACTTTCTACCCTTGGTTAATACATCGGTACCGGTACCTGGGACACAGATTCCAAGGGAACGACACAAGTGCGGAGAGTTTCCTCCTACACAATGCACTGGCCCGGAAACCCAAACGGATCCGCACAGCCTTCTCCCCGTCTCAGTTACTGCGCCTGGAACACGCCTTCGAGAAGAACCACTACGTTGTGGGCGCAGAAAGGAAACAGTTGGCGCACAGTCTCAGCCTCACCGAGACCCAGGTAAAAGTTTGGTTTCAGAACAGAAGGACAAAGTTCAAACGGCAGAAACTGGAGGAAGAGGGTTCCGACTCGTCGCAGAAGAAAAAAGGGGCCCATCACATCAACCGATGGAGGCTCGCCACCAAGCAGGCCAGTCCGGAGGAGATCGACGTCACCTCGGACGATTAACCATTAAGCACTTGGGACTTCCACAGACTTTTGCTTTCAATTAACTTTCAAACGAAGAAAATCCTAAAAGTGTTTGAGCTCCCAGGGAGTCGGGCCGGACTGAGCTCAGAACCAGAACTCGCAAGGCGGAAAGCGGAGAAGACGGGCAGCCCCCCCCCCCGGAGTGGCCTGGGCTTCAAGGTCAACCAGCAGGGGCCAAGGTCACCCACAGGTATTCAGTGAATAAGGACTGCGTTATCGTATCGCAAGATTTCGTTCTTTTGCACTTCCAACATTTCTTTTTCAAAATGACCCCCCCAAACAGCCAGAACCCACCAAACATGATAGAAAAAAACCTTTTTTATTATTATTATTCCATAAAACTTGAAATGCATGACAAATCGCCACATAGGTGGGTTTATATGGCTGCACAACCTCCATAAAACAACCCCCCCCCTCCTAATTTAAAAGTAGTTGTTTCGGCATTAGTATGCCCTTCCCTGCTGGCAGAGATCACCGCTCACCCTTTCGGCGGGGGCGGGGCCATCTTCCTACAGATTCCTGACGTCATGAAGGGTAACTTTTTGGTGCAATAAGATGACTGAAAACGCAGTTTGGCAGCAACTGAAATCTTTGCACATAAAGACTGCGCCAACCATGGAATTGTCGGTGCTGGGGAGGGTGAAAGGGTTAATGTAGGAGATCAGGAATGTGAATTTGCTCCCAAAATAATTCGCCATTTTATTGATTATACAGAAATCCCTGGGGGTTCCAGCTGTTCAGTTAAAAAACAAAATATTTTTAATGCTGCAGAAATAAACAGAGGGGAGTGTTTGTGCGGATATGAAGCATTTCCCACGGTGTCTGGTGCTTTAACCCCCACAGACTCGTCGCAAGGAGTCGCCAAAATGACGTTTTCGTGGATCATTTTGCAGAACTGATCACTTTTTTGGACAGTAATTCGGAAGCACTGAGATCTTTTTTTTTTTCTTTTTCACAATAGTAAAACGCTACTAAATATGGACAACAACAACAACAATATCCTAACGTTTCCCTAATGTCTTCTATTACCAGATTGTACATATTTTTGTGTTTGTGTTAATTTGTTAGAATTCTAACACACTATATACTTCCAAGAAGTATGGGAACTTGTCAATATTTTGTCAATAAAGATTTATCCAAAAAAAAAAAAAAAAAA
  5   1   2   10 seed Tbd1 5g3  out                       CBXT21038.b1 ...........................................................................................................................................................................AGTTTAGGGCACATCCATGGATCGTCTTCGGACTTGCTAAACGCATCGCACCGTGTCTGTTGCGACGGAGGAAGAGTCCGCGGAGTTGGGGGGAGTCGCACCGTTGCCGACTACTGTCGCTCGCCCTTTTCAAATCACTGCCAGAGACTGCGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTAGCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGCCCACCTCTCACTCCCCGCACCCCCTTTTTGCATCTCAGCAACGGGACCCCTCAACTTTCTACCCTTGGTTAATACATCGGTACCGGTACCTGGGACACAGATTCCAAGGGAACGACACAAGTGCGGAGAGTTTCCTCCTACACAATGCACTGGCCCGGAAACCCAAACGGATCCGCACAGCCTTCTCCCCGTCTCAGTTACTGCGCCTGGAACACGCCTTCGAGAAGAACCACTACGTTGT
  5   1   2       bld Gas8 5g3  out                        st102f03.5p                                                                                                                                                                                AGGGCACATCCATGGATCGTCTTCGGACTTGCTAAACGCATCGCACCGTGATCTGTTGCGACGGAGGAAGAGTCCGCGGAGTTGGGGGGAGTCGCACCGTTGCCGACTACTGTCGCTCGCCCTTTTCAAATCACTGCCAGAGACTGCGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTAGCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGCCCACCTCTCACTCCCCGCACCCCCTTTTTGCATCTCAGCAACGGGACCCCTCAACTTTCTACCCTTGGTTAATACATCGGTACCGGTACCTG
  5   1   2       bld TbA  5g3  out                  TTbA001k13.p1kSP6                                                                                                                                                                                              AAGAGGATGAGGAAGAAGGTGAACGCATCGCACCGTGTCTGTTGCGACGGAGGAAGAGTCCGCGGAGTTGGGGGGAGTCGCACCGTTGCCGACTACTGTCGCTCGCCCTTTTCAAATCACTGCCAGAGACTGCGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTAGCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGCCCACCTCTCACTCCCCGCACCCCCTTTTTGCATCTCAGCAACGGGACCCCTCAACTTTCTACCCTTGGTTAATACATCGGTACCGGTACCTGGGACACAGATTCCAAGGGAACGACACAAGTGCGGAGAGTTTCCTCCTACACAATGCACTGGCCCGGAAACCCAAACGGATCCGCACAGCCTTCTCCCCGTCTCAGTTACTGCGCCTGGAACACGCCT
  5   1   2       bld Neu  FL   out                  TNeu125h20.p1cSP6                                                                                                                                                                                                 TCGTCTTCGGACTTGCTAAACGCATCGCACCGTGTCTGTAGCGCCGGAGGAAGAGTCCGCGGAGTTGGGGGGAGTCGCACCGTTGCCGACTACTGTCGCTCGCCCTTTTCAAATCACTGCCAGAGACTGCGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTATCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGGCCA
  3  -1   2       bld Ovi1      out                         CABI635.3p                                                                                                                                                                                                                                                                                                                           GCGAGAGGGATCGGCCGAGGATTCTTCTAAAGTTGGAGATTCCGCTGGAGATTTTGCGCTTGGTTTTAGCCCCCTCTCCGTTGCGGTCTGGGCCCTTCTCCTCCCCCCCACCCCTGAACTACTGGCTGACACGGGAGGGGATCGGGGTTCGGGGGGCACCATGTTCCAACCCACCCCAAAAAGGTGCTTTACTATCGAGTCCTTGGTGGCCAAAGACAGTCCCTTGCCAGTCTCCCGTTCCGAAGAGCCAATCCGACCGGCCGCCCTCAGCTATGCCAACTCGGCCCCCATGAACCCCTTCCTCAACGGCTTCCACCCTACGGGCAGGGGGGTCTATTCCAACCCGGACTTGGTCTTCGCAGAGGCCGTTTCTCACCCACCCAACCCGGCAGTCCCTGTGCACCCTGTGCCCCCACCCCATGCCCTGGCAGCGCACCCCCTGCCCACCTCTCACTCCCCGCACCCCCTTTTTGCATCTCAGCAACGGGACCCCTCAACTTTCTACCCTTGGTTAATACATCGGTACCGGTACCTGGGACACAGATTCCAAGGGAACGACACAAGTGCGGAGAGTTTCCTCCTACACAATGCACTGGCCCGGAAACCCAAACGGATCCGCACAGCCTTCTCCCCGTCTCAGTTACTGCGCCTGGAACACGCCTTCGAGAAGAACCACTACGTTGTGGGCGCAGAAAGGAAACAGTTGGCGCACAGTCTCAGCCTCACCGAGACCCAGGTAAAAGTTTGGTTTCAGAACAGAAGGACAAAGTTCAAACGGCAGAAACTGGAGGAAGAGGGTTCCGACTCGTCGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)