Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-CAAK12689.3                           7 END     1          10       14                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012087422 Xt7.1-CUNH684.5 - 10 ESTs
                                                                       ...-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CUNH684.5                                                                                                                                                                                                  GCGCTGGGGATGAGCGATCCGCGTACGAGTGATGCCTAACGGGCGACATGGGCCAAGGGGACGAGACGGATCGCATCGTGATTAATGTGGGGGGGACCCGGCACCAAACCTACCGCAGCACCCTGCGCACCCTGCCGGGGACCCGCCTGGCCTGGTTGGCCGAGCCCGACGCCCACAGCCACTTCGACTACGATCCCCGGTCGGACGAGTTCTTCTTCGACCGACACCCGGGGGTCTTCGCCCACATCCTCAACTATTACCGGACTGGGAAGCTGCACTGCCCGGCCGATGTGTGCGGCCCGTTGTACGAGGAGGAGTTGGCCTTCTGGGGCATCGATGAGACCGACGTGGAGCCCTGTTGCTGGATGACTTACCGGCAGCACCGGGACGCCGAGGAGGCGCTGGACAGTTTCGGGGGGGGCCCGGTGGACTGTAACGGGGAGGACGGGGGGGCGGACGGTACCGGGGACTCGGGGGATGGGGAGGAAGAGCTGGAACTGACCAAGCGGCTGGCACTTAGCGACTCGCCCGATGGCAAACAGGGGGGCTTCTGGAGAAGGTGGCAGCCGCGCATCTGGGCTCTGTTTGAGGACCCCTACTCCTCCCGCTATGCCAGGTACGTGGCATTTGCCTCGCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGACCTTCAATCCCATCGTGAACAAGACGGAGACGGAGGTGGTGGGGAACGAGACCCAGTTGAGGTTCTACAGGGAGTCGGAGACGGAGGCCTTCCTGACCTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTTCGAGTTCCTCATGAGGATCACCTTCTGCCCCAACAAGGTGGAGTTCATCAAGAACACGTTGAACATCATTGACTTCGTGGCCATCCTGCCGTTCTACCTGGAGGTGGGGCTCAGCGGCCTGTCTTCCAAAGCTGCTAAGGACGTCCTGGGCTTCCTGCGGGTGGTCCGCTTTGTCCGGATCCTACGGATTTTCAAGCTGACCCGGCATTTTGTGGGCCTGCGGGTTCTGGGTCACACCCTCCGGGCCAGCACCAACGAGTTCTTGCTGCTCATTATATTCCTGGCGCTGGGGGTGCTGATCTTCGCCACCATGATCTACTACGCCGAGCGGATAGGTGCTAACCCCAACGACCCCAGCGCCAGCGAACACACCCAGTTCAAAAACATCCCCATCGGCTTCTGGTGGGCGGTGGTGACCATGACGACGCTGGGCTACGGAGACATGTACCCCAAGACTTGGTCGGGGATGCTGGTGGGGGCGCTGTGTGCCCTGGCCGGCGTGCTGACCATCGCCATGCCCGTGCCCGTCATCGTCAACAACTTCGGAATGTACTATTCTCTAGCCATGGCCAAGCAGAAGCTAC
                                                  Xt7.1-CHK-1008236274                                                                                                                                                                                                        GGGATGAGCGATCCGCGTACGAGTGATGCCTAACGGGCGACATGGGCCAAGGGGACGAGACGGATCGCATCGTGATTAATGTGGGGGGGACCCGGCACCAAACCTACCGCAGCACCCTGCGCACCCTGCCGGGGACCCGCCTGGCCTGGTTGGCCGAGCCCGACGCCCACAGCCACTTCGACTACGATCCCCGGTCGGACGAGTTCTTCTTCGACCGACACCCGGGGGTCTTCGCCCACATCCTCAACTATTACCGGACTGGGAAGCTGCACTGCCCGGCCGATGTGTGCGGCCCGTTGTACGAGGAGGAGTTGGCCTTCTGGGGCATCGATGAGACCGACGTGGAGCCCTGTTGCTGGATGACTTACCGGCAGCACCGGGACGCCGAGGAGGCGCTGGACAGTTTCGGGGGGGGCCCGGTGGACTGTAACGGGGAGGACGGGGGGGCGGACGGTACCGGGGACTCGGGGGATGGGGAGGAAGAGCTGGAACTGACCAAGCGGCTGGCACTTAGCGACTCGCCCGATGGCAAACAGGGGGGCTTCTGGAGAAGGTGGCAGCCGCGCATCTGGGCTCTGTTTGAGGACCCCTACTCCTCCCGCTATGCCAGGTACGTGGCATTTGCCTCGCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGACCTTCAATCCCATCGTGAACAAGACGGAGACGGAGGTGGTGGGGAACGAGACCCAGTTGAGGTTCTACAGGGAGTCGGAGACGGAGGCCTTCCTGACCTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTTCGAGTTCCTCATGAGGATCACCTTCTGCCCCAACAAGGTGGAGTTCATCAAGAACACGTTGAACATCATTGACTTCGTGGCCATCCTGCCGTTCTACCTGGAGGTGGGGCTCAGCGGCCTGTCTTCCAAAGCTGCTAAGGACGTCCTGGGCTTCCTGCGGGTGGTCCGCTTTGTCCGGATCCTACGGATTTTCAAGCTGACCCGGCATTTTGTGGGCCTGCGGGTTCTGGGTCACACCCTCCGGGCCAGCACCAACGAGTTCTTGCTGCTCATTATATTCCTGGCGCTGGGGGTGCTGATCTTCGCCACCATGATCTACTACGCCGAGCGGATAGGTGCTAACCCCAACGACCCCAGCGCCAGCGAACACACCCAGTTCAAAAACATCCCCATCGGCTTCTGGTGGGCGGTGGTGACCATGACGACGCTGGGCTACGGAGACATGTACCCCAAGACTTGGTCGGGGATGCTGGTGGGGGCGCTGTGTGCCCTGGCCGGCGTGCTGACCATCGCCATGCCCGTGCCCGTCATCGTCAACAACTTCGGAATGTACTATTCTCTAGCCATGGCCAAGCAGA
                                                      consensus depths                                                                                                                                                                                                       3     5     3     5     3     5     3     5     4     5     3     5     3     5     4     5     4     5     5     5     4     5     5     5     5     5     5     5     4     5     4     5     4     5     5     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     6     7     6     7     7     8     6     7     6     7     5     6     5     6     5     6     5     6     6     7     6     7     5     7     6     7     6     6     5     5     5     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4
                                               BLH ATG      47     140                                                                                                                                                                                                  
                                               BLH OVR      47     127                                                                                                                                                                                                  
                                               EST CLI     -36       1                                                                                                                                                                                                  
                                               ORF LNG      47      22                                                                                                                                                                                                  
                                                                                                                                                                                                                       PROTEIN --- Ci ---- 2e-072     AAS00646.1 potassium channel Kv4; CionaKv4 [Ciona intestinalis] ----------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED - Dr ---- 1e-072     XP_691312.1 PREDICTED: similar to Potassium voltage-gated channel subfamily A member 2 (Voltage-gated potassium channel subunit Kv1.2) (HBK5) (NGK1) (HUKIV) [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-112     NP_509795.1 EGg Laying defective EGL-36, SHaW family of potassium channels (egl-36) [Caenorhabditis elegans] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---= 5e-124     NP_476721.1 CG2822-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                         PREDICTED - Sp ---- 6e-128     XP_789154.2 PREDICTED: similar to voltage-gated potassium channel [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAD52813.1 Kv3.1 potassium channel [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 0          XP_693971.1 PREDICTED: similar to Potassium voltage-gated channel subfamily C member 1 (Voltage-gated potassium channel subunit Kv3.1) (Kv4) (NGK2) (RAW2) [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_004967.1 Shaw-related voltage-gated potassium channel protein 1 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_032447.1 potassium voltage gated channel, Shaw-related subfamily, member 1 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 0          XP_421008.2 PREDICTED: similar to voltage-gated potassium channel [Gallus gallus] ----------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CUNH684.5                                                                                                                                                                                                                               TGA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------ATG---------------------------------------------ATG------------------------------ATG---------------ATG
                                                                   ORF                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  3  -1   2       add Brn4      out                        CAAL7628.3p                                                                                                                                             TCACCCGAGGAAATCTATGATTAGTTCGGTGTGTGTATCATCCTATCGTGGGCGCAAGTCTGGGAACAAACCTCCCTCAAAATCATGTCTGAAAGAAGAGATGGCCAAGGGGGAAGACTCTGGCAAGATAACCATCAATGTTGGGGGGACTCGGCATGAGACCTACAAGAGCACCCTACGGACGTTGCCCGGCACACGCCTGGCATGGCTGGCAGACCCCGACACCGCCAGTAACTCGGAATCTGATTCTCAGCGGACCGAATTCTTCTTTGATAGGCACCCAGGCATCTTCTCCTATGTGCTCAATTACTACCGCACAGGCAAGCTGCACTGCCCGGCAGATATCTGCGGCCCCCTGTTCGAGGAGGAGCTAGCCTTCTGGGGGATAGATGAGACGGACGTGGAGCCCTGTTGCTGGATGACTTACCGCCAACACCGGGATGCTGAGGAGGCTCTGGACATTTTTGAGAACGTGGAACCTGAGGATGGGGAAGAGGAGAATAAAGGTTCCTCCCCAGAGCTTCTCTGCATCGAGGAGAGGACGGACAGGTCCAGGGGCTGTTGGAAAGTCTGGCAACCCAAGATGTGGGCTCTATTCGAAGATCCCTATTCATCCAGGGCTGCTCGGGTGGTAGCTTTTGTGTCCCTCTTCTTCATCCTTATGTCTATTACAACATTCTGCTTGGAGACCCATGAGTCATTTATTGTGGACAGAAATGTTACAGAGACAGTGACTATTGGAAACATGACAGAGATTTTAGTGGTGAGGGAGGTGGAGACAGAACCCATCCTCACTTACATTGAGGGGGTCTGTGTCTTCTGGTTCACTTTGGAGTTTCTTGTTCGAATTATATGCTGT
  5   1   2       bld Brn4 PIPE in                        CAAL21095.5p                                                                                                                                                              CTGAAGCTGCGCAGCTGTTGCTGTTGGAAATCGCAGCGCTGGGGATGAGCGATCCGCGTACGAGTGATGCCTAACGGGCGACATGGGCCAAGGGGACGAGACGGATCGCATCGTGATTAATGTGCGGGGGGACCCGGCACCAAACCTACCGCAGCACCCTGCGCACCCTGCCGGGGACCCGCCTGGCCTGGTTGGCCGAGCCCGACGCCCACAGCCACTTCGACTACGATCCCCGGTCGGACGAGTTCTTCTTCGACCGACACCCGGGGGTCTTCGCCCACATCCTCAACTATTACCGGACTGGGAAGCTGCACTGCCCGGCCGATGTGTGCGGCCCGTTGTACGAGGAGGAGTTGGCCTTCTGGGGCATCGATGAGACCGACGTGGAGCCCTGTTGCTGGATGACTTACCGGCAGCACCGGGACGCCGAGGAGGCGCTGGACAGTTTCGGGGGGGGCCCGGTGGACTGTAACGGGGAGGACGGGGGGGCGGACGGTACCGGGGACTCGGGGGATGGGGAGGAAGAGCTGGAACTGACCAAGCGGCTGGCACTTAGCGACTCGCCCGATGGCAAACAGGGGGGCTTCTGGAGAAGGTGGCAGCCGCGCATCTGGGCTCTGTTTGAGGACCCCTACTCCTCCCGCTATGCCAGGTACGTGGCATTTGCCTCGCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACG
  5   1   2       bld Met2      in                          CUNH684.5p                                                                                                                                                                 TCGGTCGGATTCCCGGGTCGACCCACGCGTCCGGCGCTGGGGATGAGCGATCCGCGTACGAGTGATGCCTAACGGGCGACATGGGCCAAGGGGACGAGACGGATCGCATCGTGATTAATGTGGGGGGGACCCGGCACCAAACCTACCGCAGCACCCTGCGCACCCTGCCGGGGACCCGCCTGGCCTGGTTGGCCGAGCCCGACGCCCACAGCCACTTCGACTACGATCCCCGGTCGGACGAGTTCTTCTTCGACCGACACCCGGGGGTCTTCGCCCACATCCTCAACTATTACCGGACTGGGAAGCTGCACTGCCCGGCCGATGTGTGCGGCCCGTTGTACGAGGAGGAGTTGGCCTTCTGGGGCATCGATGAGACCGACGTGGAGCCCTGTTGCTGGATGACTTACCGGCAGCACCGGGACGCCGAGGAGGCGCTGGACAGTTTCGGGGGGGGCCCGGTGGACTGTAACGGGGAGGACGGGGGGGCGGACGGTACCGGGGACTCGGGGGATGGGGAGGAAGAGCTGGAACTGACCAAGCGGCTGGCACTTAGCGACTCGCCCGATGGCAAACAGGGGGGCTTCTGGAGAAGGTGGCAGCCGCGCATCTGGGCTCTGTTTGAGGACCCCTACTCCTCCCGCTATGCCAGGTACGTGGCATTTGCCTCGCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGACCTTCAATCCCATCGTGAACAAGACGGAGACGGAGGTGGTGGGGAACGAGACCCAGTTGAGGTTCTACAGGGAGTCGGAGACGGAGGCCTTCCTGACCTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTTCGAGTTCCTCATGAGGATCACCTTCTGCCCCAACAGGTGGAGTTCATCAA
  5   1   2       bld Brn4      in                         CAAL7530.5p                                                                                                                                                                                      TTGGAAATCGCAGCGCTGGGGATGAGCGATCCGCGTACGAGTGATGCCTAACGGGCGACATGGGCCAAGGGGACGAGACGGATCGCATCGTGATTAATGTGGGGGGGACCCGGCACCAAACCTACCGCAGCACCCTGCGCACCCTGCCGGGGACCCGCCTGGCCTGGTTGGCCGAGCCCGACGCCCACAGCCACTTCGACTACGATCCCCGGTCGGACGAGTTCTTCTTCGACCGACACCCGGGGGTCTTCGCCCACATCCTCAACTATTACCGGACTGGGAAGCTGCACTGCCCGGCCGATGTGTGCGGCCCGTTGTACGAGGAGGAGTTGGCCTTCTGGGGCATCGATGAGACCGACGTGGAGCCCTGTTGCTGGATGACTTACCGGCAGCACCGGGACGCCGAGGAGGCGCTGGACAGTTTCGGGGGGGGCCCGGTGGACTGTAACGGGGAGGACGGGGGGGCGGACGGTACCGGGGACTCGGGGGATGGGGAGGAAGAGCTGGAACTGACCAAGCGGCTGGCACTTAGCGACTCGCCCGATGGCAAACAGGGGGGCTTCTGGAGAAGGTGGCAGCCGCGCATCTGGGCTCTGTTTGAGGACCCCTACTCCTCCCGCTATGCCAGGTACGTGGCATTTGCCTCGCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGACCTTNCATCCCATCGTGAACAAGACGGAGACGGAGGTGGTGGGGAACGAGACCCAGTTGAGGTTCTACAGGGAGTCGGAGACGGAGGCCTTCCCTGACTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTT
  5   1   2       bld Brn4      in                        CAAL18288.5p                                                                                                                                                                                          AAATCGCAGCGCTGGGGATGAGCGATCCGCGTACGAGTGATGCCTAACGGGCGACATGGGCCAAGGGGACGAGACGGATCGCATCGTGATTAATGTGGGGGGGACCCGGCACCAAACCTACCGCAGCACCCTGCGCACCCTGCCGGGGACCCGCCTGGCCTGGTTGGCCGAGCCCGACGCCCACAGCCACTTCGACTACGATCCCCGGTCGGACGAGTTCTTCTTCGACCGACACCCGGGGGTCTTCGCCCACATCCTCAACTATTACCGGACTGGGAAGCTGCACTGCCCGGCCGATGTGTGCGGCCCGTTGTACGAGGAGGAGTTGGCCTTCTGGGGCATCGATGAGACCGACGTGGAGCCCTGTTGCTGGATGACTTACCGGCAGCACCGGGACGCCGAGGAGGCGCTGGACAGTTTCGGGGGGGGCCCGGTGGACTGTAACGGGGAGGACGGGGGGGCGGACGGTACCGGGGACTCGGGGGATGGGGAGGAAGAGCTGGAACTGACCAAGCGGCTGGCACTTAGCGACTCGCCCGATGGCAAACAGGGGGGCTTCTGGAGAAGGTGGCAGCCGCGCATCTGGGCTCTGTTTGAGGACCCCTACTCCTCCCGCTATGCCAGGTACGTGGCATTTGCCTCGCTCTTCTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGACCTTCAATCCCATCGTGAACAAGAC
  5   1   0       add Brn3 SNG  out                       CAAK10963.5p                                                                                                                                                                                            CGCGACATGTCGCATACAGAGCAATGGGTAAGATCGACGAGAACGAGAGAATAATCCTCAACGTAGGGGGTACAAGGCACGAAACTTACCGAAGCACCTTAAAGACAGTGCCCGGGACGCGGCTGGCTCTGCTTGCCTGTGAATCGCAAAGTGAGCAAGGGCTGGACCAGCAGACAGTGTCGGGCTCCTTCAACATCACCTCCAGAGGCAACGAATTCTTCTTCGACAGGCACCCCGGAGTCTTCGCCTATGTCCTTAACTATTACCGCACCGGCAAGTTGCACTGCCCCGCAGATGTGTGCGGGCCCCTTTTTGAAGAGGAGCTGGCGTTTTGGGGCATTGATGAGACGGACGTGGAGCCTTGTTGCTGGATGACCTATCGGCAGCACCGGGATGCAGAAGAAGCTTTGGACATCTTCGAAACTCCGGACCTGATCACAGGGGAACCACCGCCTATAGATGAATATGAGGAGGATTTGGGTAAGAGACTGGCAATTGAGGACGTGGTGTGCCCCGATGGCAAAGTCGGTCGTTGGAGAAGACTACAACCTCGCATGTGGGCTTTATTTGAAGATCCATATTCTTCCAGAGCCGCCCGGTTCATCGCCTTTGCTTCCTTGTTCTTCATTCTGGTATCTATAACAACCTTTTGCTTGGAGACTCATGAAGCATTTAATACCATCATTAACAAAACGGAAACTGTAAACAATGGTACAGAATTAATCTCATTGATTGAAATAGAAACTGATCCAGCCTTGACGTATGTGGAAGGAGTATGCGTGGTTTGGTTCACATTTGAGTTTTTAGTACGTGTCATTTTCTGCCCCTGACAACTTGAATTCATCAGAAATCTTCTAAATATA
  3   1   2      seed Brn4      in                        CAAL18288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATCCTGGTCTCCATCACCACCTTCTGCCTGGAGACCCACGAGACCTTCAATCCCATCGTGAACAAGACGGAGACGGAGGTGGTGGGGAACGAGACCCAGTTGAGGTTCTACAGGGAGTCGGAGACGGAGGCCTTCCTGACCTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTTCGAGTTCCTCATGAGGATCACCTTCTGCCCCAACAAGGTGGAGTTCATCAAGAACACGTTGAACATCATTGACTTCGTGGCCATCCTGCCGTTCTACCTGGAGGTGGGGCTCAGCGGCCTGTCTTCCAAAGCTGCTAAGGACGTCCTGGGCTTCCTGCGGGTGGTCCGCTTTGTCCGGATCCTACGGATTTTCAAGCTGACCCGGCATTTTGTGGGCCTGCGGGTTCTGGGTCACACCCTCCGGGCCAGCACCAACGAGTTCTTGCTGCTCATTATATTCCTGGCGCTGGGGGTGCTGATCTTCGCCACCATGATCTACTACGCCGAGCGGATAGGTGCTAACCCCAACGACCCCAGCGCCAGCGAACACACCCAGTTCAAAAACATCCCCATCGGCTTCTGGTGGGCGGTGGTGACCATGACGACGCTGGGCTACGGAGACATGTACCCCAAGACTTGGTCGGGGATGCTGGTGGGGGCGCTGTGTGCCCTGGCCGGCGTGCTGACCATCGCCATGCCCGTGCCCGTCATCGTCAACAACTTCGGAATGTACTATTCTCTAGCCATGGCCAAGCAGAAGCTACC
  3   1   2       bld Brn4      in                         CAAL7530.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATCCTGGTCTCCATCACCACTTTCTGCCTGGAGACCCACGAGACCTTCAATCCCATCGTGAACAAGACGGAGACGGAGGTGGTGGGGAACGAGACCCAGTTGAGGTTCTACAGGGAGTCGGAGACGGAGGCCTTCCTGACCTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTTCGAGTTCCTCATGAGGATCACCTTCTGCCCCAACAAGGTGGAGTTCATCAAGAACACGTTGAACATCATTGACTTCGTGGCCATCCTGCCGTTCTACCTGGAGGTGGGGCTCAGCGGCCTGTCTTCCAAAGCTGCTAAGGACGTCCTGGGCTTCCTGCGGGTGGTCCGCTTTGTCCGGATCCTACGGATTTTCAAGCTGACCCGGCATTTTGTGGGCCTGCGGGTTCTGGGTCACACCCTCCGGGCCAGCACCAACGAGTTCTTGCTGCTCATTATATTCCTGGCGCTGGGGGTGCTGATCTTCGCCACCATGATCTACTACGCCGAGCGGATAGGTGCTAACCCCAACGACCCCAGCGCCAGCGAACACACCCAGTTCAAAAACATCCCCATCGGCTTCTGGTGGGCGGTGGTGACCATGACGACGCTGGGCTACGGAGACATGTACCCCAAGACTTGGTCGGGGATGCTGGTGGGGGCGCTGTGTGCCCTGGCCGGCGTGCTGACCATCGCCATGCCCGTGCCCGTCATCGTCAACAACTTCGGAATGTACTATTCTCTAGCCATGGCCAAGCAGAAGCTACC
  3   1   2       bld Met2      in                          CUNH684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGCCTGGAGACCCACGAGACCTTCAATCCCATCGTGAACAAGACGGAGACGGAGGTGGTGGGGAACGAGACCCAGTTGAGGTTCTACAGGGAGTCGGAGACGGAGGCCTTCCTGACCTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTTCGAGTTCCTCATGAGGATCACCTTCTGCCCCAACAAGGTGGAGTTCATCAAGAACACGTTGAACATCATTGACTTCGTGGCCATCCTGCCGTTCTACCTGGAGGTGGGGCTCAGCGGCCTGTCTTCCAAAGCTGCTAAGGACGTCCTGGGCTTCCTGCGGGTGGTCCGCTTTGTCCGGATCCTACGGATTTTCAAGCTGACCCGGCATTTTGTGGGCCTGCGGGTTCTGGGTCACACCCTCCGGGCCAGCACCAACGAGTTCTTGCTGCTCATTATATTCCTGGCGCTGGGGGTGCTGATCTTCGCCACCATGATCTACTACGCCGAGCGGATAGGTGCTAACCCCAACGACCCCAGCGCCAGCGAACACACCCAGTTCAAAAACATCCCCATCGGCTTCTGGTGGGCGGTGGTGACCATGACGACGCTGGGCTACGGAGACATGTACCCCAAGACTTGGTCGGGGATGCTGGTGGGGGCGCTGTGTGCCCTGGCCGGCGTGCTGACCATCGCCATGCCCGTGCCCGTCATCGTCAACAACTTCGGAATGTACTATTCTCTAGCCATGGCCAAGCAGAAGCTACC
  3   1   2       bld Brn4 PIPE in                        CAAL21095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGGGAGTCGGAGACGGAGGCCTTCCTGACCTACATCGAGGGGGTGTGCGTGGTCTGGTTCACCTTCGAGTTCCTCATGAGGATCACCTTCTGCCCCAACAAGGTGGAGTTCATCAAGAACACGTTGAACATCATTGACTTCGTGGCCATCCTGCCGTTCTACCTGGAGGTGGGGCTCAGCGGCCTGTCTTCCAAAGCTGCTAAGGACGTCCTGGGCTTCCTGCGGGTGGTCCGCTTTGTCCGGATCCTACGGATTTTCAAGCTGACCCGGCATTTTGTGGGCCTGCGGGTTCTGGGTCACACCCTCCGGGCCAGCACCAACGAGTTCTTGCTGCTCATTATATTCCTGGCGCTGGGGGTGCTGATCTTCGCCACCATGATCTACTACGCCGAGCGGATAGGTGCTAACCCCAACGACCCCAGCGCCAGCGAACACACCCAGTTCAAAAACATCCCCATCGGCTTCTGGTGGGCGGTGGTGACCATGACGACGCTGGGCTACGGAGACATGTACCCCAAGACTTGGTCGGGGATGCTGGTGGGGGCGCTGTGTGCCCTGGCCGGCGTGCTGACCATCGCCATGCCCGTGCCCGTCATCGTCAACAACTTCGGAATGTACTATTCTCTAGCCATGGCCAAGCAGAAGCTACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)