Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABH9114.3                           20 END     2          28       10                (no blast hit)
     2   2.0    0Xt7.1-CABH9336.5                            4 END     4          57      100                Similar to BCL2-associated athanogene 3 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012087681 Xt7.1-CABH9336.3 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABH9336.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTTGTTCCTGCCCCTGTTCCAATGCCTCCTCCAGAAGTAATACCTGTTGTTCCTGCCCCTGTTCCAATGCCCCCTCCAGAAGTAATACCTGTTCCCTCCCCTGTTCCAATGCCCCCTCCAGAAGTTCCACCTGTTCCACAGGAACCAGCCCCCGAGAAGGCAGCAGAAGTGCCAGAACCTCAACACAAACACCCCGGTGTCCTTCAGGTCGAGAGGATCTTGGAGCGAATAAAGCCCATGGAGCAAGCCGTCACTGGCTTTCGGGGCCGCAAAAATGAGAAAGCTTATTTGATACTGGAGGAAGATCTCACAAAAGTGCTGCTGGCTCTGGATTCGGTAGATCCCGAAGGGCGAGTAGATGTGCGTCAGGCAAGAAGGGATGGTGTCAGAAAAGTCCAGAAAGTTCTGGAAATACTGGAACAGAAAGCGTCCGAGAACTCCCAGTGTAGCCAGGGTTCGGACTCGGCTGGCGGCTCGCAAGATTCCATGGATGTAGATAACACAGTGTACAGAAGTAGTGGAGCGACGCAAAACGCGCAAATGGAACCTGCGGCCAGTTCGGTGGGACACTAGGCGCCCGCTTTTGGGAAGAAAGATGAACTTGACGACGTGGGTTGGAATTGAGTTTAGCTGCATGCGTTTGGAACATTTCTAAATCTCTTGCTTTTTCACTCCACTATAAGAAGCATGAACACCGCAAACCTGGGATATTTATCCAACATACTCAATGCTTGAATGGACTTTGCACTCAGTCAGCAACCACTGGGGTTATTCGCCAAAGTACTACTGCCCAAGTATCCACTGGGTTATTTACACTTACATAAAGAGATATCTGTGTGCTGAATTACACCCGCTGTTAGTACTGTTCATTGCTCATGTTTGGCATTTCATGTGTAGAGTTTTATAACAGATATCAAATCTTATTTCATGAATGGCAAAACACTGTAGACATGGTTTATTTTACAAACTCCACTTACTGTACCAGCCCAGAGGTGCAGCAGCCCTATAACAGGTCCAGGTCATTAGGGTTGCCCCCAGCAGCTCCCCATCTTGGATCTTGTTAGGCCATCTTTTGTGTGTCAGTGGCACTGCACGTGCTCAGTAGGCTCTGGGCTGCTGCTAATGTAACTATATGGGTAGCTACTTTGTTAAGCTTTATTTCTCCATTAGCTCATTTCACTACTGTTGGGGTGATATGGTGCAGCCATAGCTGCTTTCACTACTGCTGATTCTGAATAATGGCTGCTATTGCACGTGGAACCTAGGGAGCCGAGGTATCTGTAACCTGTGATGTATAATTGAATGGGCTGTCGAGCTTCTCATAGAAGGAAACCTATTTCATATGATGTTGCATATATGTGCTGCTCAGTTCCCATATAATATAAGCAAAGCAGACTGGCATCTCCCACACTGCTGCTCACGCTATGAGAATGGAAAGTCTACACATACGGCATATTTTACTTGGAATATGTAGCAGAATCATTTTTCGTACCTGGGCGTCATTTTAAAGCCCAATTGTCCCTTTAGGAAACACCTATAGAGCATGGCTGGCAGTTACC
                                                  Xt7.1-CHK-1008239172                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTGCCCCTGTTCCAATGCCTCCTCCAGAAGTAATACCTGTTGTTCCTGCCCCTGTTCCAATGCCCCCTCCAGAAGTAATACCTGTTCCCTCCCCTGTTCCAATGCCCCCTCCAGAAGTTCCACCTGTTCCACAGGAACCAGCCCCCGAGAAGGCAGCAGAAGTGCCAGAACCTCAACACAAACACCCCGGTGTCCTTCAGGTCGAGAGGATCTTGGAGCGAATAAAGCCCATGGAGCAAGCCGTCACTGGCTTTCGGGGCCGCAAAAATGAGAAAGCTTATTTGATACTGGAGGAAGATCTCACAAAAGTGCTGCTGGCTCTGGATTCGGTAGATCCCGAAGGGCGAGTAGATGTGCGTCAGGCAAGAAGGGATGGTGTCAGAAAAGTCCAGAAAGTTCTGGAAATACTGGAACAGAAAGCGTCCGAGAACTCCCAGTGTAGCCAGGGTTCGGACTCGGCTGGCGGCTCGCAAGATTCCATGGATGTAGATAACACAGTGTACAGAAGTAGTGGAGCGACGCAAAACGCGCAAATGGAACCTGCGGCCAGTTCGGTGGGACACTAGGCGCCCGCTTTTGGGAAGAAAGATGAACTTGACGACGTGGGTTGGAATTGAGTTTAGCTGCATGCGTTTGGAACATTTCTAAATCTCTTGCTTTTTCACTCCACTATAAGAAGCATGAACACCGCAAACCTGGGATATTTATCCAACATACTCAATGCTTGAATGGACTTTGCACTCAGTCAGCAACCACTGGGGTTATTCGCCAAAGTACTACTGCCCAAGTATCCACTGGGTTATTTACACTTACATAAAGAGATATCTGTGTGCTGAATTACACCCGCTGTTAGTACTGTTCATTGCTCATGTTTGGCATTTCATGTGTAGAGTTTTATAACAGATATCAAATCTTATTTCATGAATGGCAAAACACTGTAGACATGGTTTATTTTACAAACTCCACTTACTGTACCAGCCCAGAGGTGCAGCAGCCCTATAACAGGTCCAGGTCATTAGGGTTGCCCCCAGCAGCTCCCCATCTTGGATCTTGTTAGGCCATCTTTTGTGTGTCAGTGGCACTGCACGTGCTCAGTAGGCTCTGGGCTGCTGCTAATGTAACTATATGGGTAGCTACTTTGTTAAGCTTTATTTCTCCATTAGCTCATTTCACTACTGTTGGGGTGATATGGTGCAGCCATAGCTGCTTTCACTACTGCTGATTCTGAATAATGGCTGCTATTGCACGTGGAACCTAGGGAGCCGAGGTATCTGTAACCTGTGATGTATAATTGAATGGGCTGTCGAGCTTCTCATAGAAGGAAACCTATTTCATATGATGTTGCATATATGTGCTGCTCAGTTCCCATATAATATAAGCAAAGCAGACTGGCATCTCCCACACTGCTGCTCACGCTATGAGAATGGAAAGTCTACACATACGGCATATTTTACTTGGAATATGTAGCAGAATCATTTTTCGTACCTGGGCGTCATTTTAAAGCCCAATTGTCCCTTTAGGAAACACCTATAGAGCATGGCTGGCAGTTACCTGATAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                           PREDICTED - Sp ---- 4e-008     XP_001199380.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 1e-013     NP_729912.1 CG32130-PB, isoform B [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                           PROTEIN --- Dr ---- 1e-029     NP_001003533.1 zgc:100859 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                              PREDICTED - Gg ---- 1e-034     XP_001233435.1 PREDICTED: BCL2-associated athanogene 3 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-035     NP_004272.2 BCL2-associated athanogene 3 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-036     NP_038891.4 Bcl2-associated athanogene 3 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 2e-078     AAH43807.1 Similar to BCL2-associated athanogene 3 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 2e-078     NP_001079487.1 BCL2-associated athanogene 3 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABH9336.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------TAG------------------------------------------------TGA---TAG---------------------------------------------------------ATG------------------------------------------TGAATG------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAG------------------------------ATG---------------TAG---------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------ATGTAA---------TAG---------TAA---------------TAG---------------------TGA------------------------------------------TAA------------------------------------------TAA------ATG------TGAATG---------------------------------------------------ATG------------------TAA---------------------------------------------TGA------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld TbA       out                  TTbA010b24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCGCAGAGAACAAACCAACTTCTCCAACCAGGGATCAGCTTCAAGGGCAAATCCCCATACAAGTACTCCTACAGGAGAAAGTCTGTAAGTCCCCTCCGCCGACATCAGCTCCAACAAGGGAAGAGGAGAAGGTTCCGGCCCCTGTTCCAATGGCCCCTCCAGAAATAATACCTGTTGTTCCTGCCCCTGTTCCAATGCCTCCTCCAGAAGTAATACCTGTTGTTCCTGCCCCTGTTCCAATGCCCCCTCCAGAAGTAATACCTGTTCCCACCCCTGTTCCAATGCCCCCTCCAGAAGTTCCACCTGTTCCACAGGAGCCAGCCCCCGAGAAGGCAGCAGAAGTGCCAGAACCTCAACACAAACACCCCGGTGTCCTTCAGGTCGAGAGGATCTTGGAGCGAATAAAGCCCATGGAGCAAGCCGTCACTGGCTTTCGGGGCCGCAAAAATGAGAAGGCTTATTTGATACTGGAGGAAGATCTCACAAAAGTGCTGCTGGCTCTGGATTCGGTAGATCCCGAAGGGCGAGTAGATGTGCGTCAGGCAAGAAGGGATGGTGTCAGAAAAGTCCAGAAAGTTCTGGAAATACTGGAACAGAAAGCGTCCGAGAACTCCCAGTGTAGCCAGGGTTCGGACTCGGCTGGCGGCTCGCAAGATTCCATGGATGTAGATAACACAGTGTACAGAAGTAGTGGAGCGACACAAAACGCGCAAATGGA
  3   1   2      seed Mus1      out                        CABH9336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTTGTTCCTGCCCCTGTTCCAATGCCTCCTCCAGAAGTAATACCTGTTGTTCCTGCCCCTGTTCCAATGCCCCCTCCAGAAGTAATACCTGTTCCCTCCCCTGTTCCAATGCCCCCTCCAGAAGTTCCACCTGTTCCACAGGAACCAGCCCCCGAGAAGGCAGCAGAAGTGCCAGAACCTCAACACAAACACCCCGGTGTCCTTCAGGTCGAGAGGATCTTGGAGCGAATAAAGCCCATGGAGCAAGCCGTCACTGGCTTTCGGGGCCGCAAAAATGAGAAAGCTTATTTGATACTGGAGGAAGATCTCACAAAAGTGCTGCTGGCTCTGGATTCGGTAGATCCCGAAGGGCGAGTAGATGTGCGTCAGGCAAGAAGGGATGGTGTCAGAAAAGTCCAGAAAGTTCTGGAAATACTGGAACAGAAAGCGTCCGAGAACTCCCAGTGTAGCCAGGGTTCGGACTCGGCTGGCGGCTCGCAAGATTCCATGGATGTAGATAACACAGTGTACAGAAGTAGTGGAGCGACGCAAAACGCGCAAATGGAACCTGCGGCCAGTTCGGTGGGACACTAGGCGCCCGCTTTTGGGAAGAAAGATGAACTTGACGACGTGGGTTGGAATTGAGTTTAGCTGCATGCGTTTGGAACATTTCTAAATCTCTTGCTTTTTCACTCCACTATAAGAAGCATGAACACCGCAAACCTGGGATATTTATCCAACATACTCAATGCTTGAATGGACTTTGCACTCAGTCAGCAACCACTGGGGTTATTCGCCAAAGTACTACTGCCCAAGTATCCACTGGGTTATTTACACTTACATAAAGAGATATCTGTGTGCTGAATT
  3   1   2       bld Mus1      out                        CABH7278.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTGTTCCTGCCCCTGTTCCAATGCCTCCTCCAGAAGTAATACCTGTTGTTCCTGCCCCTGTTCCAATGCCCCCTCCAGAAGTAATACCTGTTCCCTCCCCTGTTCCAATGCCCCCTCCAGAAGTTCCACCTGTTCCACAGGAACCAGCCCCCGAGAAGGCAGCAGAAGTGCCAGAACCTCAACACAAACACCCCGGTGTCCTTCAGGTCGAGAGGATCTTGGAGCGAATAAAGCCCATGGAGCAAGCCGTCACTGGCTTTCGGGGCCGCAAAAATGAGAAAGCTTATTTGATACTGGAGGAAGATCTCACAAAAGTGCTGCTGGCTCTGGATTCGGTAGATCCCGAAGGGCGAGTAGATGTGCGTCAGGCAAGAAGGGATGGTGTCAGAAAAGTCCAGAAAGTTCTGGAAATACTGGAACAGAAAGCGTCCGAGAACTCCCAGTGTAGCCAGGGTTCGGACTCGGCTGGCGGCTCGCAAGATTCCATGGATGTAGATAACACAGTGTACAGAAGTAGTGGAGCGACGCAAAACGCGCAAATGGAACCTGCGGCCAGTTCGGTGGGACACTAGGCGCCCGCTTTTGGGAAGAAAGATGAACTTGACGACGTGGGTTGGAATTGAGTTTAGCTGCATGCGTTTGGAACATTTCTAAATCTCTTGCTTTTTCACTCCACTATAAGAAGCATGAACACCGCAAACCTGGGATATTTATCCAACATACTCAATGCTTGAATGGACTTTGCACTCAGTCAGCAACCACTGGGGTTATTCGCCAAAGTACTACTGCCCAAGTATCCACTGGGTTATTTACACTTACATAAAGAGATATCTGTGTGCTGAATTAAAAAAAA
  3   1   2       bld Te5       out                        CAAO7033.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATGCCTCCTCCAGAAGTAATACCTGTTGTTCCTGCCCCTGTTCCAATGCCCCCTCCAGAAGTAATACCTGTTCCCTCCCCTGTTCCAATGCCCCCTCCAGAAGTTCCACCTGTTCCACAGGAACCAGCCCCCGAGAAGGCAGCAGAAGTGCCAGAACCTCAACACAAACACCCCGGTGTCCTTCAGGTCGAGAGGATCTTGGAGCGAATAAAGCCCATGGAGCAAGCCGTCACTGGCTTTCGGGGCCGCAAAAATGAGAAAGCTTATTTGATACTGGAGGAAGATCTCACAAAAGTGCTGCTGGCTCTGGATTCGGTAGATCCCGAAGGGCGAGTAGATGTGCGTCAGGCAAGAAGGGATGGTGTCAGAAAAGTCCAGAAAGTTCTGGAAATACTGGAACAGAAAGCGTCCGAGAACTCCCAGTGTAGCCAGGGTTCGGACTCGGCTGGCGGCTCGCAAGATTCCATGGATGTAGATAACACAGTGTACAGAAGTAGTGGAGCGACGCAAAACGCGCAAATGGAACCTGCGGCCAGTTCGGTGGGACACTAGGCGCCCGCTTTTGGGAAGAAAGATGAACTTGACGACGTGGGTTGGAATTGAGTTTAGCTGCATGCGTTTGGAACATTTCTAAATCTCTTGCTTTTTCACTCCACTATAAGAAGCATGAACACCGCAAACCTGGGATATTTATCCAACATACTCAATGCTTGAATGGACTTTGCACTCAGTCAGCAACCACTGGGGTTATTCGCCAAAGTACTACTGCCCAAGTATCCACTGGGTTATTTACACTTACATAAAGAGATATCTGTGTGCTGAATT
  5   1   2       bld Mus1      out                        CABH9114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCAAATGGAACCTGCGGCCAGTTCGGTGGGACACTAGGCGCCCGCTTTTGGGAAGAAAGATGAACTTGACGACGTGGGTTGGAATTGAGTTTAGCTGCATGCGTTTGGAACATTTCTACATCTCTTGCTTTTTCACTCCACTATAAGAAGCATGAACACCGCAAACCTGGGATATTTATCCAACATACTCAATGCTTGAATGGACTTTGCACTCAGTCAGCAACCACTGGGGTTATTCGCCAAAGTACTACTGCCCAAGTATCCACTGGGTTATTTACACTTACATAAAGAGATATCTGTGTGCTGAATTACACCCGCTGTTAGTACTGTTCATTGCTCATGTTTGGCATTTCATGTGTAGAGTTTTATAACAGATATCAAATCTTATTTCATGAATGGCAAAACACTGTAGACATGGTTTATTTTACAAACTCCACTTACTGTACCAGCCCAGAGGTGCAGCAGCCCTATAACAGGTCCAGGTCATTAGGGTTGCCCCCAGCAGCTCCCCATcttggatcttgttaggccatcttttgtgtgtcagtggcactgcacgtgctcagtaggctctgggctgctgCTAATGTAACTATATGGGTAGCTACTTTGTTAAGCTTTATTTCTCCATTAGCTCATTTCACTACTGTTGGGGTGATATGGTGCAGCCATAGCTGCTTTCACTACTGCTGATTCTGAATAATGGCTGCTATTGCACGTGGAACCTAGGGAGCCGAGGTATCTGTAACCTGTGATGTATAATTGAATGGGCTGTCGAGCTTCTCATAGAAGGAAACCTATTTCATATGATGTTGCATATATGTGCTGCTCAGTTCCCATATAATATAAGCAAAGCAGACTGGCATCTCCCACAC
  3   1   2       bld Te4  PIPE out                       CAAN10042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTACTACTGCCCAAGTATCCACTGGGTTATTTACACTTACATAAAGAGATATCTGTGTGCTGAATTACACCCGCTGTTAGTACTGTTCATTGCTCATGTTTGGCATTTCATGTGTAGAGTTTTATAACAGATATCAAATCTTATTTCATGAATGGCAAAACACTGTAGACATGGTTTATTTTACAAACTCCACTTACTGTACCAGCCCAGAGGTGCAGCAGCCCTATAACAGGTCCAGGTCATTAGGGTTGCCCCCAGCAGCTCCCCATcttggatcttgttaggccgtcttttgtgtgtcagtggcactgcacgtgctcagtaggctctgggctgctgCTAATGTAACTATATGGGTAGCTACTTTGTTAAGCTTTATTTCTCCATTAGCTCATTTCACTACTGTTGGGGTGATATGGTGCAGCCATAGCTGCTTTCACTACTGCTGATTCTGAATAATGGCTGCTATTGCACGTGGAACCTAGGGAGCCGAGGTATCTGTAACCTGTGATGTATAATTGAATGGGCTGTCGAGCTTCTCATAGAAGGAAACCTATTTCATATGATGTTGCATATATGTGCTGCTCAGTTCCCATATAATATAAGCAAAGCAGACTGGCATCTCCCACACTGCTGCTCACGCTATGAGAATGGAAAGTCTACACATACGGCATATTTTACTTGGAATATGTAGCAGAATCATTTTTCGTACCTGGGCGTCATTTTAAAGCCCAATTGTCCCTTTAGGAAACACCTATAGAGCATGGCTGGCAGTTACCTGATACTCTGC
  5   1   2       bld In63                            IMAGE:8959387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGGCCCCGCTCGCTAATGTAACTATATGGGTAGCTACTTTGTTAAGCTTTATTTCTCCATTAGCTCATTTCACTACTGTTGGGGTGATATGGTGCAGCCATAGCTGCTTTCACTACTGCTGATTCTGAATAATGGCTGCTATTGCACGTGGAACCTAGGGAGCCGAGGTATCTGTAACCTGTGATGTATAATTGAATGGGCTGTCGAGCTTCTCATAGAAGGAAACCTATTTCATATGATGTTGCATATATGTGCTGCTCAGTTCCCATATAATATAAGCAAAGCAGACTGGCATCTCCCACACTGCTGCTCACGCTATGAGAATGGAAAGTCTACACATACGGCATATTTTACTTGGAATATGTAGCAGAATCATTTTTCGTACCTGGGCGTCATTTTAAAGCCCAATTGTCCCTTTAGGAAACACCTATAGAGCATGGCTGGCAGTTACCTGATACTCTGCAAAAAGAAAAAATGGCCTCGGTGCACATAGTGCGTTTCCATTGGAGTTCATCTGTCCAGCAATGATCATTATTTACTATATTATCTCTAGTTGTGACAGTGCCTGGGGAAATGAGATTTTAGGGGGTGCTGGGAGTTGTACCAGCTTAAGGGCCACAGAGAGATATAATGTTACTGTTGCCATTTGCTCTGTTTACCTTGTATCCCCCAACTCAAAAGCCTCAGCTGGGGATGAATTTAGCATTAGCACCTTACCCTGCCAGAAATTGTTTTTCATATAGTTATATAGCCAAATGTAATGATAAAGGCTGGATTGGACCATGTCTAGCTAATGTCGAGCTCTTACTTGCTCTCTTACAGTCTCTAGCTGTAGCAGTTCGATACATTCATGAACTAAAGGGCCATTGGACATAACTGCCATATGACTGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)