Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ14901.5                           6 END     1          14       16                sodium/calcium exchanger 1 [Xenopus tropicalis]
     2   2.0    0Xt7.1-TTbA035c18.5                          4 END     1          14       25                PREDICTED: similar to Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange protein 1) [Danio rerio]

 This cluster: approximate FL confidence score = 0%

 1012087818 Xt7.1-XZT7019.3 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-XZT7019.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACCAATTTGGCACTAGTGATTGGTACACATTCCTGGAGAGAGCAGTTTACGGAAGCTATCACAGTTAGTGCTGGTGACGAGGAAGAGGAAGGTGATGGACGTGAGGAACGATTGCCATCATGCTTTGACTACGTTATGCATTTTCTCACAGTCTTCTGGAAAGTCCTCTTCGCCTTTGTTCCCCCCACAGAGTACTGGAATGGCTGGGCCTGCTTCTTTGTTTGTATCAGTATTGTGGGTATACTAACAGCTGTAATAGGAGACCTGGCTTCACACTTTGGTTGCACTGTTGGGTTGAAGGACTCTGTGACAGCTGTAGTGTTTGTGGCTCTTGGCACGTCTCTCCCAGATACATTTGCCAGTAAGGTGGCAGCAATGCAGGACCAATATGCTGACGCCTGTATTGGCAACGTAACAGGTAGCAATGCAGTTAACGTCTTCTTGGGTATTGGTGTTGCTTGGTCTGTGGCAGCCATCTATTGGGCTATCCAAGGCAAAGACTTTATTGTGGAGACAGGTTCCTTGGCCTTCTCTGTCACCCTCTTTACTATCTTCGCATTCATCAACATCGGCGTCCTGCTGTACCGCAGGAGACCTCATATAGGGGGGGAGTTGGGTGGCTCCCGTCTCTCCAAGACCCTCACAGCCATGCTGTTCATTGGCCTTTGGCTGCTGTATATATTGTTTTCCAGCCTGGAAGCCTACTGCCATATTAAAGGCTTTTGAAAGGTGATGAGGATGCAGAAGTCAGTTTCCTCCATGAACTTGGGCCTCAGTCATTCCATGGACTCTCCCAGACTGGATTGTGAGATGTTTCATTACAGTAGAGTTTGAGGGCACAGACTCGGTATAATGTATTTATTTATTTATTTTTCTAAACCCTTCTGTCCTAAATGTCTCCCCTTCCTATATCTTTCATGGGGTAGCAAAATAGCACAATTTGTTGTAAGAAGAGGGGTAAATGGAGTTCACCATTTTTCAAGGAGGTTTTCCCCTTTAAACTACAATGCACTTGCATAGATAACTATGCCAGGCAGACCAAAAACAAGAATCAGCTTTTCCTTGATTGACTTATACAACTCTAGGCATAAAAGCCTGCACTATTGGGTGGACAGGATGGTTGGAGAGACTTTCCGCCCTTCCTTATAATGAGCTTCATATCCTTTAAAAGGGAACTGTCACTGTT
                                                  Xt7.1-CHK-1008239348                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTGGCACTAGTGATTGGTACACATTCCTGGAGAGAGCAGTTTACGGAAGCTATCACAGTTAGTGCTGGTGACGAGGAAGAGGAAGGTGATGGACGTGAGGAACGATTGCCATCATGCTTTGACTACGTTATGCATTTTCTCACAGTCTTCTGGAAAGTCCTCTTCGCCTTTGTTCCCCCCACAGAGTACTGGAATGGCTGGGCCTGCTTCTTTGTTTGTATCAGTATTGTGGGTATACTAACAGCTGTAATAGGAGACCTGGCTTCACACTTTGGTTGCACTGTTGGGTTGAAGGACTCTGTGACAGCTGTAGTGTTTGTGGCTCTTGGCACGTCTCTCCCAGATACATTTGCCAGTAAGGTGGCAGCAATGCAGGACCAATATGCTGACGCCTGTATTGGCAACGTAACAGGTAGCAATGCAGTTAACGTCTTCTTGGGTATTGGTGTTGCTTGGTCTGTGGCAGCCATCTATTGGGCTATCCAAGGCAAAGACTTTATTGTGGAGACAGGTTCCTTGGCCTTCTCTGTCACCCTCTTTACTATCTTCGCATTCATCAACATCGGCGTCCTGCTGTACCGCAGGAGACCTCATATAGGGGGGGAGTTGGGTGGCTCCCGTCTCTCCAAGACCCTCACAGCCATGCTGTTCATTGGCCTTTGGCTGCTGTATATATTGTTTTCCAGCCTGGAAGCCTACTGCCATATTAAAGGCTTTTGAAAGGTGATGAGGATGCAGAAGTCAGTTTCCTCCATGAACTTGGGCCTCAGTCATTCCATGGACTCTCCCAGACTGGATTGTGAGATGTTTCATTACAGTAGAGTTTGAGGGCACAGACTCGGTATAATGTATTTATTTATTTATTTTTCTAAACCCTTCTGTCCTAAATGTCTCCCCTTCCTATATCTTTCATGGGGTAGCAAAATAGCACAATTTGTTGTAAGAAGAGGGGTAAATGGAGTTCACCATTTTTCAAGGAGGTTTTCCCCTTTAAACTACAATGCACTTGCATAGATAACTATGCCAGGCAGACCAAAAACAAGAATCAGCTTTTCCTTGATTGACTTATACAACTCTAGGCATAAAAGCCTGCACTATTGGGTGGACAGGATGGTTGGAGAGACTTTCCGCCCTTCCTTATAATGAGCTTCATATCCTTTAAAAGGGAACTGTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     2     2     1     2     2     2     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     4     5
                                                                       ...PROTEIN --- Dm ---- 4e-073     NP_524423.2 CG5685-PA, isoform A [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-082     NP_504415.2 Na/Ca eXchangers family member (ncx-2) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-089     XP_781349.2 PREDICTED: similar to sodium-calcium exchanger [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-112     NP_001034233.1 solute carrier family 8 (sodium/calcium exchanger), member 1b [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN --- Xl ---- 1e-112     CAA62344.1 sodium-calcium exchanger [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 2e-113     NP_001072941.1 solute carrier family 8 (sodium/calcium exchanger), member 1 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 8e-115     NP_683748.1 solute carrier family 8 (sodium/calcium exchanger), member 2 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-115     NP_055878.1 solute carrier family 8 member 2 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - ?? ---- 4e-116     XP_695595.1 PREDICTED: similar to sodium-calcium exchanger [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZT7019.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TGA------ATG---ATG------------------ATG---------------------ATG------------------------ATG------------------TGA------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------ATG---------------------------------------------------------------------------------------ATG---------------------------TAATGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2      skin BrSp      in                     EC2BBA28DF12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGGGGCCAGAGGGGGAAGCTGCGGAAGGGAGAGGAGCTGCACAGAAAGCCACGTGGATGGCAGAGCACAGTAGACAAGCTAATTAAGAAGACCAATTTGGCACTAGTGATTGGTACACATTCCTGGAGAGAGCAGTTTACGGAAGCTATCACAGTTAGTGCTGGTGACGAGGAAGAGGAAGGTGATGGACGTGAGGAACGATTGCCATCATGCTTTGACTACGTTATGCATTTTCTCACAGTCTTCTGGAAAGTCCTCTTCGCCTTTGTTCCCCCCACAGAGTACTGGAATGGCTGGGCCTGCTTCTTTGTTTGTATCAGTATTGTGGGTATACTAACAGCTGTAATAGGAGACCTGGCTTCACACTTTGGTTGCACTGTTGGGTTGAAGGACTCTGTGACAGCTGTAGTGTTTGTGGCTCTTGGCACGTCTCTCCCAGATACATTTGCCAGTAAGGTGGCAGCAATGCAGGACCAATATGCTGACGCCTGTATTGGCAACGTAACAGGTAGCAATGCAGTTAACGTCTTCTTGGGTAT
  5   1   2       bld Tad5      in                          XZT7019.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACCAATTTGGCACTAGTGATTGGTACACATTCCTGGAGAGAGCAGTTTACGGAAGCTATCACAGTTAGTGCTGGTGACGAGGAAGAGGAAGATGATGGACGTGAGGAACGATTGCCATCATGCTTTGACTACGTTATGCATTTTCTCACAGTCTTCTGGAAAGTCCTCTTCGCCTTTGTTCCCCCCACAGAGTACTGGAATGGCTGGGCCTGCTTCTTTGTTTGTATCAGTATTGTGGGTATACTAACAGCTGTAATAGGAGACCTGGCTTCACACTTTGGTTGCACTGTTGGGTTGAAGGACTCTGTGACAGCTGTAGTGTTTGTGGCTCTTGGCACGTCTCTCCCAGATACATTTGCCAGTAAGGTGGCAGCAATGCAGGACCAATATGCTGACGCCTGTATTGGCAACGTAACAGGTAGCAATGCAGTTAACGTCTTCTTGGGTATTGGTGTTGCTTGGTCTGTGGCAGCCATCTATTGGGCTATCCAAGGCAAAGACTTTATTGTGGAGACAGGTTCCTTGGCCTTCTCTGTCACCCTCTTTACTATCTTCGCATTCATCAACATCGGCGTCCTGCTGTACCGCAGGAGACCTCATATAGGGGGGGAGTTGGGTGGCTCCCGTCTCTCCAAGACCCTCACAGCCATGCTGTTCATTGGCCTTTGGCTGCTGTATATATTGTTTTCCAGCCTGGAAGCCTACTGCCATATTAAAGGCTTTTGAAAGGTGATGAGGATGCAGAAGTCAGTTTCCTCCATGAACTTGGGCCTCAGTCATTCCATGGACTCT
  3   1   2       bld Tad5      in                          XZT7019.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAATGCAGGACCAATATGCTGACGCCTGTATTGGCAACGTAACAGGTAGCAATGCAGTTAACGTCTTCTTGGGTATTGGTGTTGCTGGTCTGTGGGCAGCCATCTATTGGGCTATCCAAGGCAAAGACTTTATTGTGGAGACAGGTTCCTTGGCCTTCTCTGTCACCCTCTTTACTATCTTCGCATTCATCAACATCGGCGTCCTGCTGTACCGCAGGAGACCTCATATAGGGGGGGAGTTGGGTGGCTCCCGTCTCTCCAAGACCCTCACAGCCATGCTGTTCATTGGCCTTTGGCTGCTGTATATATTGTTTTCCAGCCTGGAAGCCTACTGCCATATTAAAGGCTTTTGAAAGGTGATGAGGATGCAGAAGTCAGTTTCCTCCATGAACTTGGGCCTCAGTCATTCCATGGACTCTCCCAGACTGGATTGTGAGATGTTTCATTACAGTAGAGTTTGAGGGCACAGACTCGGTATAATGTATTTATTTATTTATTTTTCTAAACCCTTCTGTCCTAAATGTCTCCCCTTCCTATATCTTTCATGGGGTAGCAAAATAGCACAATTTGTTGTAAGAAGAGGGGTAAATGGAGTTCACCATTTTTCAAGGAGGTTTTCCCCTTTAAACTACAATGCACTTGCATAGATAACTATGCCAGGCAGACCAAAAACAAGAATCAGCTTTTCCTTGATTGACTTATACAACTCTAGGCATAAAAGCCTGCACTATTGGGTGGACAGGATGGTTGGAGAGACTTTCCGCCCTTCCTTATAATGAGCTTCATATCCTTTAAAAGGGAACTGTCACTGTTTAAAAAAAAAAAAAAAGG
  5   1   2       bld Brn2                                CAAJ22984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCTATTGGGCTATCCAAGGCAAAGACTTTATTGTGGAGACAGGTTCCTTGGCCTTCTCTGTCACCCTCTTTACTATCTTCGCATTCATCAACATCGGCGTCCTGCTGTACCGCAGGAGACCTCATATAGGGGGGGAGTTGGGTGGCTCCCGTCTCTCCAAGACCCTCACAGCCATGCTGTTCATTGGCCTTTGGCTGCTGTATATATTGTTTTCCAGCCTGGAAGCCTACTGCCATATTAAAGGCTTTTGAAAGGTGATGAGGATGCAGAAGTCAGTTTCCTCCATGAACTTGGGCCTCAGTCATTCCATGGACTCTCCCAGACTGGATTGTGAGATGTTTCATTACAGTAGAGTTTGAGGGCACAGACTCGGTATAATGTATTTATTTATTTATTTTTCTAAACCCTTCTGTCCTAAATGTCTCCCCTTCCTATATCTTTCATGGGGTAGCAAAATAGCACAATTTGTTGTAAGAAGAGGGGTAAATGGAGTTCACCATTTTTCAAGGAGGTTTTCCCCTTTAAACTACAATGCACTTGCATAGATAACTATGCCAGGCAGACCAAAAACAAGAATCAGCTTTTCCTTGATTGACTTATACAACTCTAGGCATAAAAGCCTGCACTATTGGGTGGACAGGATGGTTGGAGAGACTTTCCGCCCTTCCCTTATATGAGCTTCATATCCTTTAAAAGGAACTGTCACTGTTATAAAAAAAAAAACCCCCACTAAACGCTAGTAAAT
  3   1   2       bld Brn3 5g3  out                        CAAK9312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTGTCACCCTCTTTACTATCTTCGCATTCATCAACATCGGCGTCCTGCTGTACCGCAGGAGACCTCATATAGGGGGGGAGTTGGGTGGCTCCCGTCTCTCCAAGACCCTCACAGCCATGCTGTTCATTGGCCTTTGGCTGCTGTATATATTGTTTTCCAGCCTGGAAGCCTACTGCCATATTAAAGGCTTTTGAAAGGTGATGAGGATGCAGAAGTCAGTTTCCTCCATGAACTTGGGCCTCAGTCATTCCATGGACTCTCCCAGACTGGATTGTGAGATGTTTCATTACAGTAGAGTTTGAGGGCACAGACTCGGTATAATGTATTTATTTATTTATTTTTCTAAACCCTTCTGTCCTAAATGTCTCCCCTTCCTATATCTTTCATGGGGTAGCAAAATAGCACAATTTGTTGTAAGAAGAGGGGTAAATGGAGTTCACCATTTTTCAAGGAGGTTTTCCCCTTTAAACTACAATGCACTTGCATAGATAACTATGCCAGGCAGACCAAAAACAAGAATCAGCTTTTCCTTGATTGACTTATACAACTCTAGGCATAAAAGCCTGCACTATTGGGTGGACAGGATGGTTGGAGAGACTTTCCGCCCTTCCTTATAATGAGCTTCATCTCCTTTAAAAGGGAACTGTCACTGTT
  3   1   2      seed Brn4      out                       CAAL20814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGTCACCCTCTTTACTATCTTCGCATTCATCAACATCGGCGTCCTGCTGTACCGCAGGAGACCTCATATAGGGGGGGAGTTGGGTGGCTCCCGTCTCTCCAAGACCCTCACAGCCATGCTGTTCATTGGCCTTTGGCTGCTGTATATATTGTTTTCCAGCCTGGAAGCCTACTGCCATATTAAAGGCTTTTGAAAGGTGATGAGGATGCAGAAGTCAGTTTCCTCCATGAACTTGGGCCTCAGTCATTCCATGGACTCTCCCAGACTGGATTGTGAGATGTTTCATTACAGTAGAGTTTGAGGGCACAGACTCGGTATAATGTATTTATTTATTTATTTTTCTAAACCCTTCTGTCCTAAATGTCTCCCCTTCCTATATCTTTCATGGGGTAGCAAAATAGCACAATTTGTTGTAAGAAGAGGGGTAAATGGAGTTCACCATTTTTCAAGGAGGTTTTCCCCTTTAAACTACAATGCACTTGCATAGATAACTATGCCAGGCAGACCAAAAACAAGAATCAGCTTTTCCTTGATTGACTTATACAACTCTAGGCATAAAAGCCTGCACTATTGGGTGGACAGGATGGTTGGAGAGACTTTCCGCCCTTCCTTATAATGAGCTTCATATCCTTTAAAAGGGAACTGTCACTGTTAT
  3   1   2       bld BrSp      in                     EC2BBA28DF12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATGAACTTGGGCCTCAGTCATTCCATGGACTCTCCCAGACTGGATTGTGAGATGTTTCATTACAGTAGAGTTTGAGGGCACAGACTCGGTATAATGTATTTATTTATTTATTTTTCTAAACCCTTCTGTCCTAAATGTCTCCCCTTCCTATATCTTTCATGGGGTAGCAAAATAGCACAATTTGTTGTAAGAAGAGGGGTAAATGGAGTTCACCATTTTTCAAGGAGGTTTTCCCCTTTAAACTACAATGCACTTGCATAGATAACTATGCCAGGCAGACCAAAAACAAGAATCAGCTTTTCCTTGATTGACTTATACAACTCTAGGCATAAAAGCCTGCACTATTGGGCGGACAGGATGGTTGGAGAGACTTTCCGCCCTTCCTTATAATGAGCTTCATATCCTTTAAAAGGGAACTGTCACTGTTATAAAAAAAAACCCCACTAAACATTAGTAAATAATTAATAATTCTTTATGACATATAGATGTTATTTTTTCTCATAGTTAGAGATATATATGATTTATTTATTATTTATGCTTCCTCAACCTAACATATAAATAACTCAACCCATGCTATTTGTCAGTAACGCAGAGCAAGTCGCTGGCTCACAGCATGAGTGTTTTGAATTAAAATTGGCTTTATAGAAAGCAGGAAAATGTACTGTATTTTTCAGTAGATTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)