Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 May 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 857.0    0Xt7.1-CBXT16286.5                           4 PI      86         52      753                noggin

 This cluster: approximate FL confidence score = 92%

 1012087834 Xt7.1-XZT72897.3 - 8 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths             2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     501     298        
                                               BLH MIN     501      96        
                                               BLH MPR     492      96        
                                               BLH OVR     501     209        
                                               CDS MIN     501      96        
                                               ORF LNG     501       8        
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 2e-017     XP_784090.2 PREDICTED: similar to noggin4 [Strongylocentrotus purpuratus] ---------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Ci ==== 1e-040     BAE06591.1 noggin [Ciona intestinalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bf ---- 9e-050     ABG66526.1 noggin [Branchiostoma floridae] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 2e-079     NP_571057.1 noggin 3 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 8e-102     NP_032737.1 noggin [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 5e-102     NP_005441.1 noggin precursor [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 4e-118     NP_989454.1 noggin [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 4e-131     AAA49916.1 noggin [Xenopus laevis]  =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 4e-131     NP_001079113.1 noggin [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 2e-133     AAT91717.1 noggin 1 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT72897.3                                                                 ATG------------TAA---------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------ATG---------------TGA------------------TGA---------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------TGA---------------------------------ATG------------------ATG---------ATGTAG---------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Tad5      in                         XZT12543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGGAGAAGGATCTTAATGAGACCTTGCTGAGGACTTTAATGGTTGGCCACTTTGACCCCAACTTTATGGCCATCAACCTGCCGGAGGAGAGACTTGGAGTGGAGGACCTTGGGGAGTTGGATCTCCTTCTTAGGCAGAAGCCCTCAGGGGCAATGCCAGCAGAAATCAAAGGACTGGAATTTTATGAGGGGCTTCAGGGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGTAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGGTTTGCAAAGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCATGGATAACCATTCAGTACCCTGTCATATCTGAGTGCAAATGTTCATGTTGAGACTCTTGGACTAATGCAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGGTCTAAATTACTATTAAAAGGTCAGTATTATTCTTTTAAATAACCAGTGTCTACTGTATTTCCAACACTATTATCCTGGGTGTGTTTTATTTTAAAATATATA
  3   1   2       bld Tad5      in                         XZT12543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAGAAGCCCTCAGGGGGCAATGCCGGCAGAAATCAAAGGACTGGAATTTTATGAGGGGCTTCAGGGCAAAAAGCACAGACTGAGCAAGAAACTCAGGAGAAAGTTGCAGATGTGGCTCTGGTCCCAGACCTTCTGTCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGTAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGGTTTGCAAAGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCATGGATAACCATTCAGTACCCTGTCATATCTGAGTGCAAATGTTCATGTTGAGACTCTTGGACTAATGCAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGGTCTAAATTACTATTAAAAGGTCAGTATTATTCTTTTAAATAACCAGTGTCTACTGTATTTCCAACACTATTATCCTGGTTGTGTTTTATTTTAATATTATTATTTTTTTTGCCTAATGTATCTCTATTTATATCCAAAAAAGAGCACTTCGCTCCGCGAAGCATTTTTTTTTTTTTTTCAAGAAAAACAAATTTAATAGTTTAATAATATAGAAGCATTTTTTCCCTTTATGGAAAACTTGCCTTTTTGATGAACCTCAAAAAC
  3   1   2       bld Tail 5g3  in                        CBSW10834.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTGTCCTTTACACATGGAATGACCTAGGGACCAGGTTTTGGCCTCGCTATGTGAAAGTAGGTAGCTGCTACAGTAAGAGGTCTTGTTCTGTGCCAGAGGGCATGGTTTGCAAAGCTGCCAAGTCTATGCATTTGACCATCTTAAGGTGGAGATGTCAACGCAGGGTTCAGCAGAAGTGTGCATGGATAACCATTCAGTACCCTGTCATATCTGAGTGCAAATGTTCATGTTGAGACTCTTGGACTAATGCAAAAGACAGTAGCTTCATGGTTCAAGCTTCATGTTATATGCACTGTAATATGTAGAAATGTATATGTGTGTATATATGGCATTGGTCTAAATTACTATTAAAAGGTCAGTATTATTCTTTTAAATAACCAGTGTCTACTGTATTTCCAACACTATTATCCTGGTTGTGTTTTATTTTAATATTATTATTTTTTTTGCCTAATGTATCTCTATTTATATCCAAAAAAGAGCACTTCGCTCCGCGAAGCATTTTTTTTTTTTTTTCAAGAAAAACAAATTTAATAGTTTAATAATATAGAAGCATTTTTTCCCTTTATGGAAAACTTGCCTTTTTGATGAACCTCAAAAACAAACAAAAAAAAAAAAAAA

In case of problems mail me! (