Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012088525 Xt7.1-CAAP7490.3 - 6 ESTs
                                                                       .......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAP7490.3                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGGACAAACTGGCAGCTCATTTTACAGGTGCTAAAGAAAATGACAAATTAGTTTGGAACAAATATGACCCTGATTCATCTATTGCTGAGAAAATGCTTAAGGATAACTCCATCGTTATTCCAGAAAATGGTCTCTACTTTGTGTACACCCAGGTGTCCTTCACAGGTCCTGACTGCCAAAGGGATCCTCTACACCTCACCCACACAGTCAACATAAAACCGGAGTCATACCCAAAAAATGATCCAATCCTCACTTCTATGAAAACAGTCTGTGAGGTGCGTTCAGGTTCTGCCTGGTTTCAGTCCATCTATGAAGGGGGGATCTTTAATCTTGAAAAGGGCTCTGTTATCTCAACTGAAACAGAACATACTGAACTTCTTGATGATGATAAAGAAAGTAAAATCTACCTGGGCATCCTTGCTGTGTGAGACAACATCCAGGGAGTTTTTAAATATTTTCATCAAAGCTGCTGGATAACTTTGGTAACGTCTCAATTTCATGCACACTAGTTTGCCAAGTAAGAAAAGTTGGACAATATGTGTTTCTTATTTGGCCCAGCTACAAATGTTGCTTTACACTGCTACTGAGAGTAAGGGACTCATAATCCTGGGCAAATCCTGGACCAAACAGCATTAGCAAATGATATGCTGTGAAGCTTTATAACTTATTCAGATTGATGTGTGATGTAAAAAAAAGTCCCTTGAAGATTTCACACAGGATGGGCAGACGTCTGCTTCATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTAATAAGTGTCTTATATGTGTGTATTTATTTATTTATTTAAGTATTTATTTTATTATTTATCTATACATTCTTTATTTAAATCTGTTGAGTATAAGAGGAATTATTGCTATGTAAAGCTGTCATGTATATGCATACAGTGTATGTAATTCCCTGTCATAAATCTCTAGCTATCTTCATTGGAAAGATTTATAAATCTGTTTTACTCTGCAAACACAGCAGCCATTCAGTTAATTGAAAAAGTGAGCAAAGTAAATGTGAATCTTCACCATTCAGTTCCCTTTAATGCTTTAAAGCAATGGTTATTGCTGGTTTGCTTGTTTTTTTATTGAACTGTATCTGAGAATTCTTGAGACTTCATATAAAGGCTCATTTCTAACCCCCATTGCTAAGCAATGATCTACTTTGTCATGTCTTATATAATACTAGACTAAGATGACCAAATCAGCCCCTTTAGTGACATCTGGTAAATCTGTAATAGACATCATGCTATTGCTCAACTGAAAGCCAAACTGTTGGGCCCATACAATACATGTCAGATTGTGATCAGCTGACCAGCTTATCTTTCTGTTAAAACATATTGTTTTATTTTATTATGTCTTTAAATTGGAAGTTTCATTCTTAATCGTTTATCTGCCTTTGTTGTGGATAGTTCTGGTGGGGATGGAAACGCTACTCTGTATGTGTTTTTTCATACAGTTTCAATAAATATTTAAAAT
                                                  Xt7.1-CHK-1008242000                                                                                                                                                                                                                                                                                                                                                                                                                              CAAACTGGCAGCTCATTTTACAGGTGCTAAAGAAAATGACAAATTAGTTTGGAACAAATATGACCCTGATTCATCTATTGCTGAGAAAATGCTTAAGGATAACTCCATCGTTATTCCAGAAAATGGTCTCTACTTTGTGTACACCCAGGTGTCCTTCACAGGTCCTGACTGCCAAAGGGATCCTCTACACCTCACCCACACAGTCAACATAAAACCGGAGTCATACCCAAAAAATGATCCAATCCTCACTTCTATGAAAACAGTCTGTGAGGTGCGTTCAGGTTCTGCCTGGTTTCAGTCCATCTATGAAGGGGGGATCTTTAATCTTGAAAAGGGCTCTGTTATCTCAACTGAAACAGAACATACTGAACTTCTTGATGATGATAAAGAAAGTAAAATCTACCTGGGCATCCTTGCTGTGTGAGACAACATCCAGGGAGTTTTTAAATATTTTCATCAAAGCTGCTGGATAACTTTGGTAACGTCTCAATTTCATGCACACTAGTTTGCCAAGTAAGAAAAGTTGGACAATATGTGTTTCTTATTTGGCCCAGCTACAAATGTTGCTTTACACTGCTACTGAGAGTAAGGGACTCATAATCCTGGGCAAATCCTGGACCAAACAGCATTAGCAAATGATATGCTGTGAAGCTTTATAACTTATTCAGATTGATGTGTGATGTAAAAAAAAGTCCCTTGAAGATTTCACACAGGATGGGCAGACGTCTGCTTCATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTAATAAGTGTCTTATATGTGTGTATTTATTTATTTATTTAAGTATTTATTTTATTATTTATCTATACATTCTTTATTTAAATCTGTTGAGTATAAGAGGAATTATTGCTATGTAAAGCTGTCATGTATATGCATACAGTGTATGTAATTCCCTGTCATAAATCTCTAGCTATCTTCATTGGAAAGATTTATAAATCTGTTTTACTCTGCAAACACAGCAGCCATTCAGTTAATTGAAAAAGTGAGCAAAGTAAATGTGAATCTTCACCATTCAGTTCCCTTTAATGCTTTAAAGCAATGGTTATTGCTGGTTTGCTTGTTTTTTTATTGAACTGTATCTGAGAATTCTTGAGACTTCATATAAAGGCTCATTTCTAACCCCCATTGCTAAGCAATGATCTACTTTGTCATGTCTTATATAATACTAGACTAAGATGACCAAATCAGCCCCTTTAGTGACATCTGGTAAATCTGTAATAGACATCATGCTATTGCTCAACTGAAAGCCAAACTGTTGGGCCCATACAATACATGTCAGATTGTGATCAGCTGACCAGCTTATCTTTCTGTTAAAACATATTGTTTTATTTTATTATGTCTTTAAATTGGAAGTTTCATTCTTAATCGTTTATCTGCCTTTGTTGTGGATAGTTCTGGTGGGGATGGAAACGCTACTCTGTATGTGTTTTTTCATACAGTTTCAATAAATATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                             2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                                                       PROTEIN --- Xt ---- 2e-007     AAI35357.1 Unknown (protein for IMAGE:7606424) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 1e-011     NP_998024.2 tumor necrosis factor, alpha [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Gg ---- 5e-013     NP_001019749.1 tumor necrosis factor (ligand) superfamily, member 15 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                          PROTEIN --- Mm ---- 2e-017     NP_038721.1 tumor necrosis factor alpha [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 2e-017     NP_000585.2 tumor necrosis factor alpha [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAP7490.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------TAG---------TAA---------------ATG---------------------------------------------TGA---TAA---------------------------------------------------ATG---TGA---------------------TGA------ATGTAA------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA------------------------------------------TAA------------------------------TAA------------------------------------TAA---------TGA------TAAATGTGA------------------------ATG---TAA------------------------------------------------------------------------------------------------------TGA---------------------TAA---TAG------ATG------------------------------------------------ATG------------TGA---------------------------------------TGA---------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       bld Int1      in                         CAAP7490.5p                                                                                                                                                                                                                                                                                                         ACTGTTTTGGCAGTATGTACTGCTTCGGACAGCATCTTGGCCACTGTATAACCAGTTCATGTATTTTTATCTTACAGAATCTGTACCAGTAGCCAGAGCCCAAGCAAGAAAAGGGGACAAACTGGCAGCTCATTTTACAGGTGCTAAAGAAAATGACAAATTAGTTTGGAACAAATATGACCCTGATTCATCTATTGCTGAGAAAATGCTTAAGGATAACTCCATCGTTATTCCAGAAAATGGTCTCTACTTTGTGTACACCCAGGTGTCCTTCACAGGTCCTGACTGCCAAAGGGATCCTCTACACCTCACCCACACAGTCAACATAAAACCGGAGTCATACCCAAAAAATGATCCAATCCTCACTTCTATGAAAACAGTCTGTGAGGTGCGTTCAGGTTCTGCCTGGTTTCAGTCCATCTATGAAGGGGGGATCTTTAATCTTGAAAAGGGCTCTGTTATCTCAACTGAAACAGAACATACTGAACTTCTTGATGATGATAAAGAAAGTAAAATCTACCTGGGCATCCTTGCTGTGTGAGACAACATCCAGGGAGTTTTTAAATATTTTCATCAAAGCTGCTGGATAACTTTGGTAACGTCTCAATTTCATGCACACTAGTTTGCCAAGTAAGAAAAGTTGGACAATATGTGTTTCTTATTTGGCCCAGCTACAAATGTTGCTTTACACTGCTACTGAGAGTAAGGGACTCATAATCCTGGGCAAATCCTGGACCAAACAGCATTAGCAAATGATATGCTGTGAAGCTTTATAACTTATTCAGATTGATGTGTGATGTAAAAAAAAGTCCCTTGAAGATTTCACACAGGATGGGCAGACGTCTGCTTCATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTA
  5   1   2       bld Ski1      in                         CABJ1354.5p                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGGACAAACTGGCAGCTCATTTTACAGGTGCTAAAGAAAATGACAAATTAGTTTGGAACAAATATGACCCTGATTCATCTATTGCTGAGAAAATGCTTAAGGATAACTCCATCGTTATTCCAGAAAATGGTCTCTACTTTGTGTACACCCAGGTGTCCTTCACAGGTCCTGACTGCCAAAGGGATCCTCTACACCTCACCCACACAGTCAACATAAAACCGGAGTCATACCCAAAAAATGATCCAATCCTCACTTCTATGAAAACAGTCTGTGAGGTGCGTTCAGGTTCTGCCTGGTTTCAGTCCATCTATGAAGGGGGGATCTTTAATCTTGAAAAGGGCTCTGTTATCTCAACTGAAACAGAACATACTGAACTTCTTGATGATGATAAAGAAAGTAAAATCTACCTGGGCATCCTTGCTGTGTGAGACAACATCCAGGGAGTTTTTAAATATTTTCATCAAAGCTGCTGGATAACTTTGGTAACGTCTCAATTTCATGCACACTAGTTTGCCAAGTAAGAAAAGTTGGACAATATGTGTTTCTTATTTGGCCCAGCTACAAATGTTGCTTTACACTGCTACTGAGAGTAAGGGACTCATAATCCTGGGCAAATCCTGGACCAAACAGCATTAGCAAATGATATGCTGTGAAGCTTTATAACTTATTCAGATTGATGTGTGATGTAAAAAAAAGTCCCTTGAAGATTTCACACAGGATGGGCAGACGTCTGCTTCATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTAATAAGTGTCTTATAT
  5   1   2       bld Int1      in                        CAAP10902.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCCTTGCTGTGTGAGACAACATCCAGGGAGTTTTTAAATATTTTCATCAAAGCTGCTGGATAACTTTGGTAACGTCTCAATTTCATGTACACTAGTTTGCCAAGTAAGAAAAGTTGGACAATATGTGTTTCTTATTTGGCCCAGCTACAAATGTTGCTTTACACTGCTACTGAGAGTAAGGGACTCATAATCCTGGGCAAATCCTGGACCAAACAGCATTAGCAAATGATATGCTGTGAAGCTTTATAACTTATTCAGATTGATGTGTGATGTAAAAAAAAGTCCCTTGAAGATTTCACACAGGATGGGCAGACGTCTGCTTCATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTAATAAGTGTCTTATATGTGTGTATTTATTTATTTATTTAAGTATTTATTTTATTATTTATCTATACATTCTTTATTTAAATCTGTTGAGTATAAGAGGAATTATTGCTATGTAAAGCTGTCATGTATATGCATACAGTGTATGTAATTCCCTGTCATAAATCTCTAGCTATCTTCATTGGAAAGATTTATAAATCTGTTTTACTCTGCAAACACAGCAGCCATTCAGTTAATTGAAAAAGTGAGCAAAGTAAATGTGAATCTTCACCATTCAGTTCCCTTTAATGCTTTAAAGCAATGGTTATTGCTGGGTTGCTTGTTTTTTTATTGAACTGTATCTG
  3   1   2      seed Int1      in                         CAAP7490.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGATTGATGTGTGATGTAAAAAAAAGTCCCTTGAAGATTTCACACAGGATGGGCAGACGTCTGCTTCATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTAATAAGTGTCTTATATGTGTGTATTTATTTATTTATTTAAGTATTTATTTTATTATTTATCTATACATTCTTTATTTAAATCTGTTGAGTATAAGAGGAATTATTGCTATGTAAAGCTGTCATGTATATGCATACAGTGTATGTAATTCCCTGTCATAAATCTCTAGCTATCTTCATTGGAAAGATTTATAAATCTGTTTTACTCTGCAAACACAGCAGCCATTCAGTTAATTGAAAAAGTGAGCAAAGTAAATGTGAATCTTCACCATTCAGTTCCCTTTAATGCTTTAAAGCAATGGTTATTGCTGGTTTGCTTGTTTTTTTATTGAACTGTATCTGAGAATTCTTGAGACTTCATATAAAGGCTCATTTCTAACCCCCATTGCTAAGCAATGATCTACTTTGTCATGTCTTATATAATACTAGACTAAGATGACCAAATCAGCCCCTTTAGTGACATCTGGTAAATCTGTAATAGACATCATGCTATTGCTCAACTGAAAGCCAAACTGTTGGGCCCATACAATACATGTCAGATTGTGATCAGCTGACCAGCTTATCTTTCTGTTAAAACATATTGTTTTATTTTATTATGTCTTTAAATTGGAAGTTTCATTCTTAATCGTTTATCTGCCTTTGTTGTGGATAGTTCTGGTGGGGATGGAAACGCTACTCTGTATGTGTTTTTTCATACAGTTTCAATAAATATTTAAAATC
  3   1   2       bld Ski1      in                         CABJ1354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTCCCTTGAAGATTTCACACAGGATGGGCAGACGTCTGCTTCATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTAATAAGTGTCTTATATGTGTGTATTTATTTATTTATTTAAGTATTTATTTTATTATTTATCTATACATTCTTTATTTAAATCTGTTGAGTATAAGAGGAATTATTGCTATGTAAAGCTGTCATGTATATGCATACAGTGTATGTAATTCCCTGTCATAAATCTCTAGCTATCTTCATTGGAAAGATTTATAAATCTGTTTTACTCTGCAAACACAGCAGCCATTCAGTTAATTGAAAAAGTGAGCAAAGTAAATGTGAATCTTCACCATTCAGTTCCCTTTAATGCTTTAAAGCAATGGTTATTGCTGGTTTGCTTGTTTTTTTATTGAACTGTATCTGAGAATTCTTGAGACTTCATATAAAGGCTCATTTCTAACCCCCATTGCTAAGCAATGATCTACTTTGTCATGTCTTATATAATACTAGACTAAGATGACCAAATCAGCCCCTTTAGTGACATCTGGTAAATCTGTAATAGACATCATGCTATTGCTCAACTGAAAGCCAAACTGTTGGGCCCATACAATACATGTCAGATTGTGATCAGCTGACCAGCTTATCTTTCTGTTAAAACATATTGTTTTATTTTATTATGTCTTTAAATTGGAAGTTTCATTCTTAATCGTTTATCTGCCTTTGTTGTGGATAGTTCTGGTGGGGATGGAAACGCTACTCTGTATGTGTTTTTTCATACAGTTTCAATAAATATTAAAATC
  3   1   2       bld Int1      in                        CAAP10902.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCATCACTTTTGCTGCATATACTGACTGTAGCAGCACTGTTTTTAATAAGTGTCTTATATGTGTGTATTTATTTATTTATTTAAGTATTTATTTTATTATTTATCTATACATTCTTTATTTAAATCTGTTGAGTATAAGAGGAATTATTGCTATGTAAAGCTGTCATGTATATGCATACAGTGTATGTAATTCCCTGTCATAAATCTCTAGCTATCTTCATTGGAAAGATTTATAAATCTGTTTTACTCTGCAAACACAGCAGCCATTCAGTTAATTGAAAAAGTGAGCAAAGTAAATGTGAATCTTCACCATTCAGTTCCCTTTAATGCTTTAAAGCAATGGTTATTGCTGGTTTGCTTGTTTTTTTATTGAACTGTATCTGAGAATTCTTGAGACTTCATATAAAGGCTCATTTCTAACCCCCATTGCTAAGCAATGATCTACTTTGTCATGTCTTATATAATACTAGACTAAGATGACCAAATCAGCCCCTTTAGTGACATCTGGTAAATCTGTAATAGACATCATGCTATTGCTCAACTGAAAGCCAAACTGTTGGGCCCATACAATACATGTCAGATTGTGATCAGCTGACCAGCTTATCTTTCTGTTAAAACATATTGTTTTATTTTATTATGTCTTTAAATTGGAAGTTTCATTCTTAATCGTTTATCTGCCTTTGTTGTGGATAGTTCTGGTGGGGATGGAAACGCTACTCTGTATGTGTTTTTTCATACAGTTTCAATAAATATTTAAAATC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)